The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	364824	413330	4981102	terminase,tail,portal,integrase,lysis	Salmonella_phage(83.08%)	66	378131:378145	410362:410376
WP_001043675.1|364824_365877_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|366159_367263_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|367274_368525_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_010835868.1|368730_369894_-|integrase	site-specific integrase	integrase	A0A192Y6Q1	Salmonella_phage	100.0	3.7e-230
WP_016048814.1|370123_370474_-	hypothetical protein	NA	A0A192Y649	Salmonella_phage	100.0	8.3e-61
WP_016048815.1|370544_371213_-	DUF551 domain-containing protein	NA	A0A192Y7X3	Salmonella_phage	100.0	2.5e-130
WP_010835870.1|371216_371405_-	hypothetical protein	NA	A0A192Y8X2	Salmonella_phage	100.0	4.6e-26
WP_010835871.1|371527_371815_-	hypothetical protein	NA	A0A192Y6Q6	Salmonella_phage	100.0	4.3e-47
WP_010835872.1|371825_372119_-	DUF2856 family protein	NA	A0A192Y654	Salmonella_phage	100.0	1.9e-50
WP_016048817.1|372165_372450_-	sigma-70 family RNA polymerase sigma factor	NA	A0A192Y7Y0	Salmonella_phage	100.0	4.0e-45
WP_010835873.1|372449_373157_-	Recombination protein	NA	A0A192Y8X7	Salmonella_phage	100.0	1.1e-139
WP_033566940.1|373438_373714_-	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	96.7	2.5e-44
WP_010835874.1|373848_374214_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	100.0	3.6e-59
WP_023890943.1|374357_374936_+	superinfection exclusion protein B	NA	A0A192Y7Z0	Salmonella_phage	100.0	8.8e-100
WP_016048819.1|374956_375340_-	hypothetical protein	NA	A0A192Y8Y8	Salmonella_phage	100.0	3.0e-64
WP_000834165.1|375671_375875_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	100.0	9.1e-28
WP_001532928.1|375913_376993_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_001104735.1|377126_377780_-	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	100.0	4.6e-129
WP_001059982.1|377889_378099_+	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
378131:378145	attL	CTACGTCGCTGACAA	NA	NA	NA	NA
WP_000424138.1|378232_378523_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	100.0	2.4e-45
WP_010835877.1|378691_379513_+	replication protein	NA	A0A192Y6S6	Salmonella_phage	100.0	5.2e-154
WP_016048822.1|379509_380886_+	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	100.0	1.5e-254
WP_000248681.1|380958_381165_+	hypothetical protein	NA	A0A192Y802	Salmonella_phage	100.0	1.1e-31
WP_016048823.1|381179_381377_+	hypothetical protein	NA	A0A192Y900	Salmonella_phage	100.0	3.4e-27
WP_023890942.1|381637_381901_+	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	100.0	8.2e-45
WP_016048826.1|382125_382563_+	recombination protein NinB	NA	A0A192Y6T2	Salmonella_phage	100.0	1.3e-79
WP_016048827.1|382699_382876_+	NinE family protein	NA	A0A1V0E5I9	Salmonella_phage	100.0	4.6e-28
WP_016048828.1|382878_383220_+	DUF2591 domain-containing protein	NA	A0A192Y677	Salmonella_phage	100.0	1.2e-64
WP_010835878.1|383212_383389_+	protein ninF	NA	A0A192Y808	Salmonella_phage	100.0	6.7e-27
WP_010835879.1|383381_383651_+	hypothetical protein	NA	A0A192Y905	Salmonella_phage	100.0	1.6e-43
WP_000002244.1|383650_383941_+	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	100.0	1.0e-51
WP_016048829.1|383937_384333_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y6T7	Salmonella_phage	100.0	3.1e-72
WP_001287665.1|384329_384899_+	HNH endonuclease	NA	A0A192Y683	Salmonella_phage	100.0	1.1e-107
WP_000149880.1|384895_385099_+	protein ninH	NA	A0A1V0E5I5	Salmonella_phage	100.0	5.5e-33
WP_016048830.1|385079_385259_+	hypothetical protein	NA	A0A192Y814	Salmonella_phage	100.0	7.1e-24
WP_000027541.1|385255_385774_+	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	100.0	9.0e-96
WP_000286100.1|386237_386441_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_023890940.1|386418_386916_+	lysozyme	NA	A0A192Y6U3	Salmonella_phage	100.0	3.8e-91
WP_010835883.1|386912_387380_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	100.0	1.0e-77
WP_016048832.1|387592_388279_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	100.0	1.6e-124
WP_000808100.1|388589_388832_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	100.0	1.0e-33
WP_016048833.1|388834_389239_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	100.0	4.0e-67
WP_000729925.1|389242_389731_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_010835897.1|389708_391208_+|terminase	terminase large subunit	terminase	I1TEI5	Salmonella_phage	100.0	8.2e-307
WP_010835896.1|391208_393383_+|portal	portal protein	portal	I1TEI6	Salmonella_phage	100.0	0.0e+00
WP_000433852.1|393396_394308_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_010835895.1|394307_395600_+	protein Coat	NA	I1TEI8	Salmonella_phage	100.0	4.2e-243
WP_010835894.1|395638_395848_+	hypothetical protein	NA	I1TEI9	Salmonella_phage	100.0	2.8e-32
WP_010835893.1|395831_396332_+	Packaged DNA stabilization protein gp4	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
WP_010835892.1|396291_397710_+	Tail accessory protein	NA	I1TEJ1	Salmonella_phage	100.0	6.4e-277
WP_016048834.1|397713_398415_+	hypothetical protein	NA	I1TEJ2	Salmonella_phage	100.0	9.4e-72
WP_016048835.1|398414_398870_+	DUF2824 family protein	NA	I1TEJ3	Salmonella_phage	100.0	1.8e-87
WP_006819472.1|398872_399562_+	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	3.9e-94
WP_016048836.1|399604_400942_+	DNA transfer protein 2	NA	I1TEJ5	Salmonella_phage	100.0	1.4e-244
WP_016048837.1|400941_402873_+	hypothetical protein	NA	I1TEJ6	Salmonella_phage	100.0	0.0e+00
WP_071533035.1|403011_403305_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|403325_403574_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_016048838.1|403709_405713_+|tail	tailspike protein	tail	I1TEJ8	Salmonella_phage	100.0	0.0e+00
WP_016048812.1|405771_407229_-	O-antigen conversion translocase	NA	I1TED7	Salmonella_phage	100.0	5.8e-241
WP_016048813.1|407218_408151_-	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	100.0	5.5e-176
WP_000915523.1|408147_408510_-	GtrA family protein	NA	I1TED9	Salmonella_phage	100.0	3.9e-61
WP_001529718.1|409009_410224_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000035054.1|410652_410856_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
410362:410376	attR	CTACGTCGCTGACAA	NA	NA	NA	NA
WP_001529719.1|410855_411287_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000476150.1|412125_412308_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032150717.1|412301_413330_+	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
>prophage 2
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	1035527	1044259	4981102	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|1035527_1036646_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1036642_1038589_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1038718_1038940_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1039263_1039584_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1039614_1041891_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1042082_1042541_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1043003_1044259_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	1094322	1185239	4981102	terminase,tail,protease,integrase,holin,lysis,tRNA	Salmonella_phage(58.7%)	91	1097231:1097250	1161127:1161146
WP_001154025.1|1094322_1095126_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1095118_1096441_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1096421_1097126_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1097125_1101592_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1097231:1097250	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1101936_1103778_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1104037_1104586_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1104613_1105261_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1105322_1106513_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1106697_1107789_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1108395_1109796_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1109996_1110458_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1110774_1111989_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1112233_1113670_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1113747_1114950_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020899445.1|1115144_1116437_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000065276.1|1116481_1116730_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1116770_1117010_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1117052_1118210_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_020899444.1|1118172_1121373_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	78.8	0.0e+00
WP_023139985.1|1121499_1121850_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1121898_1122030_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1122326_1122761_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1122866_1123094_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1123128_1123449_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_000062943.1|1123533_1124517_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1124519_1125269_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1125279_1125627_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1125623_1126082_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1126085_1126394_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1126397_1127042_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1127041_1127299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1127353_1128331_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1128342_1128939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1129530_1129764_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1129873_1130095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1130179_1130782_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_001096542.1|1130990_1131602_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000801757.1|1131598_1131739_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097242.1|1131735_1132425_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_001534733.1|1132619_1132745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1132880_1133330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1133690_1134377_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_077248428.1|1134652_1134982_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_000984584.1|1134965_1135418_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_024143045.1|1135435_1135882_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1136350_1136896_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1138016_1138349_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1138448_1138946_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1139062_1139596_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1139685_1140381_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1140390_1141128_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1141025_1141730_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000033415.1|1141801_1145152_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1145190_1145433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031247858.1|1145486_1147925_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000143167.1|1147924_1148506_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1148981_1149950_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1150597_1151224_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1151292_1151592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1151576_1152263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1152533_1152725_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1153151_1155764_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1155971_1156982_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1157147_1157690_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1157686_1158796_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1158894_1161003_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1161015_1162923_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1161127:1161146	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1162937_1164191_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1164195_1165836_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_033567177.1|1165832_1166396_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1166651_1166819_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1166918_1167437_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1167505_1169266_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1169451_1169904_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1169975_1171028_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1171384_1171894_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1172110_1172716_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1172702_1174856_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1174874_1175321_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1175444_1177499_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1177534_1177993_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1178087_1178750_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1178920_1179337_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1179381_1179699_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1179756_1180968_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1181182_1181731_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1181756_1182536_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1182584_1182866_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1182862_1183192_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1183278_1183938_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1184558_1185239_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	1972321	1979130	4981102	integrase,tail	Salmonella_phage(33.33%)	11	1967184:1967206	1976899:1976921
1967184:1967206	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1972321_1973203_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1973675_1973864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1973928_1974096_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1974352_1974886_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1974939_1975170_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1975359_1975854_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1975913_1976768_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1977141_1977495_-	YebY family protein	NA	NA	NA	NA	NA
1976899:1976921	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1977511_1978387_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1978387_1978762_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1978899_1979130_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	2054580	2133861	4981102	terminase,tail,protease,portal,holin,integrase,head,plate,transposase,capsid	Salmonella_phage(76.81%)	105	2061118:2061133	2135484:2135499
WP_000502119.1|2054580_2055039_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2055219_2056425_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2056503_2057991_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2058247_2059651_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2059665_2060073_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2060072_2060441_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_022630963.1|2060512_2061997_+	alpha-amylase	NA	NA	NA	NA	NA
2061118:2061133	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2062036_2062462_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2062647_2063853_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2063849_2064083_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2064347_2064734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2064853_2065168_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2065384_2067067_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2067059_2068055_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2068047_2068755_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2068754_2070125_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2070146_2070590_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2070586_2071804_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2071908_2072376_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2072380_2073385_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2073381_2073795_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2073794_2074172_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2074171_2074909_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2074918_2075188_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2075196_2075991_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2076272_2076896_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2076934_2077183_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2077257_2077485_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2077794_2078610_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2078588_2080301_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2080465_2080711_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2080727_2081639_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2081814_2082735_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2082723_2083194_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2083174_2084605_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2084678_2085374_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2085465_2085765_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2086414_2087611_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2087871_2088060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2088070_2088283_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2088737_2090006_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2090008_2090428_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2090554_2090716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2091909_2092122_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2092118_2092532_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2092579_2092693_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2092767_2093001_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2093114_2093720_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000554735.1|2093689_2095252_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_001207832.1|2095238_2095826_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785581.1|2095828_2096908_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_000605055.1|2096900_2097314_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_001273649.1|2097318_2097852_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066632.1|2097851_2098910_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_033567259.1|2098906_2100247_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001033736.1|2100306_2100756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785381.1|2100772_2102698_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_000588852.1|2102782_2103109_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515953.1|2103105_2103462_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_033567258.1|2103461_2104958_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_065305283.1|2104947_2105112_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_000779213.1|2105133_2105691_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_033567257.1|2105687_2106200_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_033567256.1|2106171_2106576_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_000927721.1|2106572_2106896_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033572442.1|2106898_2107099_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_033572441.1|2107148_2108354_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033567207.1|2108368_2109019_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_000466255.1|2108996_2110238_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605609.1|2110237_2110420_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_033567282.1|2110431_2112165_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000929191.1|2112161_2112656_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135098.1|2112781_2113132_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2113182_2113515_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2113977_2114370_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2114366_2114981_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2114980_2115262_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2115248_2115635_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2115780_2116038_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2116188_2116941_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_070793644.1|2116954_2117944_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_001061452.1|2117951_2118812_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_000779148.1|2118828_2119218_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_033567232.1|2119226_2120102_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000054228.1|2120098_2120572_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567233.1|2120568_2121543_-	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000620702.1|2121539_2121764_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087404.1|2121760_2122903_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000509731.1|2122899_2123454_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2123482_2123707_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2123804_2124500_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2124705_2125044_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2125006_2125231_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2125770_2126142_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2126199_2127027_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2127163_2127703_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2127773_2128307_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2128308_2128566_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2128576_2129158_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2129161_2129731_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2129755_2129998_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2129999_2130989_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2131280_2132078_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2132449_2132740_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2133387_2133861_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2135484:2135499	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	2219855	2230361	4981102		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2219855_2221169_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2221195_2222275_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2222279_2223053_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2223049_2224042_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2224047_2224599_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2224599_2225478_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2225525_2226425_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2226424_2227510_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2227886_2228780_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2228957_2230361_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	2298669	2307840	4981102	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2298669_2300703_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2300943_2301402_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2301573_2302104_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2302160_2302628_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2302674_2303394_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2303390_2305076_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2305298_2306030_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2306089_2306197_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2306177_2306909_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2306892_2307840_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	2327247	2393643	4981102	holin,tail,lysis	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2327247_2327943_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2328096_2328981_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2329157_2329877_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2329873_2330119_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2330323_2331565_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956095.1|2331558_2332794_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2332868_2333879_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2333894_2335415_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2335548_2336547_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2337045_2338068_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2338217_2339360_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2339374_2340043_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2340372_2341230_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2341218_2341608_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2341612_2342980_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2343196_2344084_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2344116_2345439_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2345482_2347474_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2347819_2349289_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2349478_2350342_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2350462_2351512_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2351590_2352448_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2352512_2354201_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2354217_2355156_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2355155_2356286_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2356654_2357836_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2357900_2358566_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2358567_2358690_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2359077_2359332_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2359655_2360228_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2360440_2361427_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2361456_2362176_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2362589_2363162_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2363487_2365044_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2365150_2366956_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2366965_2368060_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2368059_2369085_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2369086_2370676_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2370679_2371024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2371414_2372605_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2372632_2373328_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2373479_2375240_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2375364_2375649_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2375757_2376378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2376405_2377413_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2377592_2377820_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2377851_2379612_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2379892_2380396_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2380423_2380714_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2381061_2382891_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2382944_2383388_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2383765_2384293_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2384295_2385537_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2386129_2386459_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2386755_2388087_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2388115_2388484_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2388498_2389488_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2389816_2392183_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2392351_2392555_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2392851_2393643_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	2733229	2839016	4981102	terminase,tail,protease,portal,holin,integrase,head,lysis,transposase,tRNA,capsid	Salmonella_phage(39.06%)	111	2757774:2757790	2846920:2846936
WP_000940032.1|2733229_2733961_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2734079_2734883_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2735027_2735906_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2736087_2737131_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2737134_2737953_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2737963_2738977_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2738977_2739964_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2739954_2740593_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2740718_2741996_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2741990_2743130_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2743325_2744579_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2744903_2746094_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2746275_2747820_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2748180_2749512_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2749594_2751739_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2751794_2753255_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2753303_2753642_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2753718_2755056_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2755052_2755817_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2755818_2757249_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2757774:2757790	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2757898_2761786_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2761807_2762041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2762041_2763586_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2763636_2764188_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2764212_2764848_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2764851_2766213_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2766223_2767117_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2767232_2768081_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684027.1|2768119_2769037_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2769058_2770255_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2770370_2771297_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2771334_2771595_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2771706_2772087_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2772086_2772818_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_033567169.1|2772829_2773558_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2773569_2774475_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2774471_2775152_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2775425_2776400_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2776416_2778216_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2778620_2780114_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2780580_2780718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2781430_2781595_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2782174_2782240_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2782302_2782515_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2782621_2782849_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2782945_2783524_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2783513_2784338_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2784334_2786707_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2786760_2787003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2787041_2790404_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2790465_2791113_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2791010_2791748_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2791754_2792453_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2792462_2792792_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2792794_2795890_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2795861_2796200_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2796196_2796592_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077248250.1|2796642_2797389_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000033885.1|2797396_2797798_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2797906_2799037_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2799085_2799664_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2799691_2800075_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2800085_2800445_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2800502_2801531_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2801585_2801933_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2801945_2803442_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2803431_2805012_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2805008_2805212_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2805195_2807127_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2807098_2807644_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2807930_2808332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2808567_2809020_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|2809037_2809490_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2809473_2809803_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2810078_2810765_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2810979_2811168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2811674_2812238_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2812510_2813188_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2813184_2813325_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2813321_2813933_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929803.1|2814141_2814744_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001574100.1|2814783_2815089_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_001217666.1|2815078_2815318_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000445792.1|2816182_2816656_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|2816655_2817180_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|2817176_2817524_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2817534_2818284_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2818286_2819270_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2819354_2819729_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|2819694_2819931_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009037.1|2820060_2820465_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000917562.1|2820863_2821022_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2821043_2821394_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2821520_2824448_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2824410_2825568_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2825610_2825850_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2825890_2826175_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2826152_2827382_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2827879_2828359_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2828355_2829312_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2829311_2829962_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2829993_2830569_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2830565_2830730_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2830993_2832616_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2832600_2833338_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2833468_2834803_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2834820_2835720_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2835822_2836410_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2836471_2836855_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2837173_2837863_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2837978_2839016_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2846920:2846936	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 10
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	2865825	2934471	4981102	integrase,transposase,tRNA	Escherichia_phage(40.0%)	51	2899140:2899155	2927080:2927095
WP_000469804.1|2865825_2866593_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2866637_2867186_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2867204_2867453_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2867766_2869128_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2869293_2870085_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2870104_2871391_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2871511_2872117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2872151_2872742_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2872864_2873743_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2873828_2875490_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2875638_2875977_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2876142_2876433_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2876422_2876899_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2877048_2877531_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237668.1|2878144_2889619_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|2889683_2891093_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2891089_2893270_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2893277_2894441_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_136612495.1|2895041_2896106_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.2	1.0e-117
WP_001542209.1|2896119_2896287_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|2896333_2896927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2897316_2898510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|2898844_2899672_-	hypothetical protein	NA	NA	NA	NA	NA
2899140:2899155	attL	ACAAACATATATTCTT	NA	NA	NA	NA
WP_000701821.1|2900122_2900338_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2900373_2902443_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2902863_2904147_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2904191_2905010_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|2905163_2905520_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2905614_2905899_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2906011_2906533_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2906529_2906904_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|2906900_2907881_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|2907891_2908905_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|2909199_2910402_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|2910475_2911111_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_031603456.1|2911134_2911698_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|2911697_2912540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2912669_2914211_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|2914433_2916113_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000088556.1|2917229_2918105_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_001521074.1|2918270_2920145_+	membrane protein	NA	NA	NA	NA	NA
WP_010989066.1|2920404_2921688_-	membrane protein	NA	NA	NA	NA	NA
WP_001682341.1|2922265_2922862_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	91.3	2.6e-99
WP_000061088.1|2924575_2925214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000073810.1|2925210_2927193_-	AAA family ATPase	NA	NA	NA	NA	NA
2927080:2927095	attR	AAGAATATATGTTTGT	NA	NA	NA	NA
WP_085983317.1|2927471_2928633_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
WP_000388997.1|2929413_2929953_-	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
WP_000079794.1|2930020_2931541_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_001067855.1|2931770_2932475_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|2933059_2933920_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|2934069_2934471_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP036174	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS009777 chromosome, complete genome	4981102	4460841	4481261	4981102	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4460841_4461570_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4461766_4462057_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4462305_4462761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4462757_4463363_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4463367_4465113_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4465115_4465748_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4465740_4466856_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4466846_4467206_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4467369_4468917_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4468916_4469846_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4469842_4470205_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4470532_4471255_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4471264_4472308_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4472295_4472505_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4472504_4473458_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4473457_4475812_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4475908_4476037_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4475996_4476314_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4476365_4476890_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4476889_4478317_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4478306_4478504_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4478500_4478956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4479115_4479430_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4479442_4480048_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4480050_4480338_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4480913_4481261_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
