The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP037877	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 chromosome, complete genome	4786287	976635	984252	4786287	transposase,protease	Planktothrix_phage(16.67%)	6	NA	NA
WP_000125877.1|976635_978582_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|978711_978933_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|979256_979577_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|979607_981884_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|982075_982534_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|982996_984252_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP037877	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 chromosome, complete genome	4786287	1034345	1133141	4786287	tRNA,integrase,terminase,holin,tail,portal,protease,lysis	Salmonella_phage(43.64%)	100	1037254:1037273	1109029:1109048
WP_001154025.1|1034345_1035149_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1035141_1036464_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1036444_1037149_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1037148_1041615_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1037254:1037273	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1041959_1043801_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1044060_1044609_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1044636_1045284_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1045345_1046536_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1046720_1047812_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1048418_1049819_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1050019_1050481_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1050797_1052012_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1052256_1053693_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1053770_1054973_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1055167_1056460_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1056504_1056753_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1056793_1057033_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1057075_1058233_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1058195_1061081_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1061207_1061507_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1061528_1061687_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014344008.1|1061679_1061940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1061989_1062400_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1062519_1062759_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1062724_1063099_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1063183_1064167_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800013.1|1064169_1064919_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.2	1.1e-137
WP_079832191.1|1064929_1065277_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	95.7	2.3e-55
WP_000065108.1|1065273_1065585_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1065662_1065953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1066244_1066478_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1066589_1066811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1066893_1067496_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1067704_1068316_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1068312_1068459_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1068448_1069246_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_010989004.1|1069312_1069630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1069803_1069929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1070064_1070514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076181665.1|1070874_1071561_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	99.1	3.9e-131
WP_001574216.1|1071836_1072166_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_077949617.1|1072149_1072602_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	96.6	1.1e-78
WP_001541990.1|1072619_1073099_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1073306_1073840_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1073796_1075935_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1075931_1076138_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1076164_1077682_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_001107908.1|1079764_1080088_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1080080_1080380_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1080360_1080927_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1080923_1081325_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1081336_1082086_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1082131_1082530_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1082526_1082856_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1082935_1085923_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1085919_1086252_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1086350_1086848_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1086964_1087498_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1087587_1088283_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1088292_1089030_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1088927_1089632_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000033415.1|1089703_1093054_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1093092_1093335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080193197.1|1093388_1095827_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	3.7e-91
WP_000143167.1|1095826_1096408_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001526469.1|1096883_1097852_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000334547.1|1098499_1099126_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1099194_1099494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1099478_1100165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1100435_1100627_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1101053_1103666_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1103873_1104884_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1105049_1105592_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1105588_1106698_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1106796_1108905_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1108917_1110825_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1109029:1109048	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1110839_1112093_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1112097_1113738_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1113734_1114298_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1114553_1114721_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1114820_1115339_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1115407_1117168_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1117353_1117806_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1117877_1118930_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1119286_1119796_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1120012_1120618_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1120604_1122758_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1122776_1123223_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1123346_1125401_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1125436_1125895_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1125989_1126652_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1126822_1127239_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1127283_1127601_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1127658_1128870_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1129084_1129633_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1129658_1130438_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1130486_1130768_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1130764_1131094_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1131180_1131840_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1132460_1133141_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP037877	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 chromosome, complete genome	4786287	1922349	1929158	4786287	tail,integrase	Salmonella_phage(33.33%)	11	1917212:1917234	1926927:1926949
1917212:1917234	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1922349_1923231_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1923703_1923892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1923956_1924124_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1924380_1924914_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1924967_1925198_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1925387_1925882_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1925941_1926796_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1927169_1927523_-	YebY family protein	NA	NA	NA	NA	NA
1926927:1926949	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1927539_1928415_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1928415_1928790_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1928927_1929158_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP037877	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 chromosome, complete genome	4786287	2004608	2083952	4786287	transposase,terminase,integrase,head,holin,capsid,tail,plate,portal,protease,lysis	Salmonella_phage(85.07%)	103	2011146:2011161	2085575:2085590
WP_000502119.1|2004608_2005067_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2005247_2006453_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2006531_2008019_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2008275_2009679_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2009693_2010101_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2010100_2010469_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2010540_2012025_+	alpha-amylase	NA	NA	NA	NA	NA
2011146:2011161	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2012064_2012490_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2012675_2013881_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2013877_2014111_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2014375_2014762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2014881_2015196_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2015412_2017095_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2017087_2018083_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2018075_2018783_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2018782_2020153_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2020174_2020618_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2020614_2021832_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2021936_2022404_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2022408_2023413_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2023409_2023823_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2023822_2024200_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2024199_2024937_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2024946_2025216_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2025224_2026019_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2026300_2026924_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2026962_2027211_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2027285_2027513_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2027822_2028638_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2028616_2030329_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2030493_2030739_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2030755_2031667_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2031842_2032763_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2032751_2033222_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2033202_2034633_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2034706_2035402_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2035493_2035793_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2036442_2037639_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2037899_2038088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2038098_2038311_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2038765_2040034_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2040036_2040456_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2040582_2040744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2041374_2041596_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2041808_2042816_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_000760554.1|2043100_2043670_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	7.3e-107
WP_000554737.1|2043669_2045232_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2045218_2045806_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_014343855.1|2045808_2046330_-|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_014343856.1|2046364_2046910_-	phage protein	NA	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_000605050.1|2046881_2047295_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2047299_2047833_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066635.1|2047832_2048891_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	99.7	6.6e-202
WP_000863818.1|2048887_2050228_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2050261_2052190_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2052274_2052601_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2052597_2052954_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2052953_2054450_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2054439_2054604_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2054607_2055168_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2055164_2055677_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2055648_2056053_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2056049_2056373_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2056375_2056576_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2056626_2057832_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2057846_2058497_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2058474_2059716_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2059715_2059898_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2059909_2061643_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2061639_2062134_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2062259_2062610_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2062670_2062973_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2063192_2063612_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2063824_2064310_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2064306_2064921_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2064923_2065268_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2065429_2065864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2065793_2066051_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2066183_2066807_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_065314711.1|2066817_2067807_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	1.0e-188
WP_001061457.1|2067814_2068675_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2068691_2069081_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2069077_2069971_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2069970_2070453_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2070454_2071273_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2071269_2071494_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2071490_2072648_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2072644_2073199_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2073227_2073452_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2073549_2074245_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2075059_2075431_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2075488_2076316_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2076452_2076992_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2077062_2077293_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2077289_2077805_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2077801_2078419_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2078415_2079249_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2079252_2079822_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2079846_2080089_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2080090_2081080_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2081371_2082169_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2082540_2082831_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2083478_2083952_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2085575:2085590	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP037877	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 chromosome, complete genome	4786287	2169946	2180452	4786287		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2169946_2171260_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2171286_2172366_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2172370_2173144_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2173140_2174133_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2174138_2174690_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2174690_2175569_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2175616_2176516_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2176515_2177601_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2177977_2178871_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2179048_2180452_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP037877	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 chromosome, complete genome	4786287	2248759	2257930	4786287	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2248759_2250793_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2251033_2251492_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2251663_2252194_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2252250_2252718_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2252764_2253484_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2253480_2255166_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2255388_2256120_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2256179_2256287_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2256267_2256999_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2256982_2257930_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP037877	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 chromosome, complete genome	4786287	2277337	2343732	4786287	tail,holin,lysis	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2277337_2278033_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2278186_2279071_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2279247_2279967_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2279963_2280209_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2280413_2281655_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956095.1|2281648_2282884_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2282958_2283969_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2283984_2285505_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2285638_2286637_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2287135_2288158_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2288307_2289450_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2289464_2290133_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2290462_2291320_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2291308_2291698_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2291702_2293070_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2293286_2294174_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2294206_2295529_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2295572_2297564_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2297908_2299378_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2299567_2300431_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2300551_2301601_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2301679_2302537_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2302601_2304290_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2304306_2305245_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2305244_2306375_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2306743_2307925_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2307989_2308655_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2308656_2308779_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2309166_2309421_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2309744_2310317_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2310529_2311516_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2311545_2312265_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2312678_2313251_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2313576_2315133_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2315239_2317045_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2317054_2318149_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2318148_2319174_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2319175_2320765_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2320768_2321113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2321503_2322694_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2322721_2323417_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2323568_2325329_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2325453_2325738_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2325846_2326467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2326494_2327502_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2327681_2327909_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2327940_2329701_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2329981_2330485_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_020843597.1|2330512_2330803_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2331150_2332980_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2333033_2333477_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2333854_2334382_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2334384_2335626_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2336218_2336548_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_001526364.1|2336844_2338176_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2338204_2338573_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_116024798.1|2338587_2339577_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	96.7	1.3e-188
WP_001115840.1|2339905_2342272_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2342440_2342644_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2342940_2343732_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP037877	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 chromosome, complete genome	4786287	2682615	2789785	4786287	transposase,tRNA,terminase,integrase,head,holin,capsid,tail,portal,protease,lysis	Salmonella_phage(40.62%)	112	2707160:2707176	2797689:2797705
WP_000940032.1|2682615_2683347_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2683465_2684269_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2684413_2685292_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2685473_2686517_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2686520_2687339_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2687349_2688363_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2688363_2689350_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2689340_2689979_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2690104_2691382_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2691376_2692516_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2692711_2693965_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2694289_2695480_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2695661_2697206_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_136571518.1|2697566_2698898_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2698980_2701125_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2701180_2702641_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2702689_2703028_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2703104_2704442_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2704438_2705203_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2705204_2706635_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2707160:2707176	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2707284_2711172_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2711193_2711427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2711427_2712972_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2713022_2713574_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2713598_2714234_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2714237_2715599_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2715609_2716503_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2716618_2717467_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2717505_2718423_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2718444_2719641_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2719756_2720683_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2720720_2720981_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2721092_2721473_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2721472_2722204_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2722215_2722944_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2722955_2723861_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2723857_2724538_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2724811_2725786_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2725802_2727602_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2728006_2729500_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2729954_2730092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2730804_2730969_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2731548_2731614_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2731676_2731889_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2731995_2732223_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2732319_2732898_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2732887_2733712_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2733708_2736081_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2736134_2736377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526393.1|2736415_2739778_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.6	0.0e+00
WP_000246126.1|2739839_2740487_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2740384_2741122_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2741128_2741827_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2741836_2742166_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372072.1|2742168_2745264_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_010989052.1|2745235_2745574_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2745570_2745966_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2746016_2746763_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2746770_2747172_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2747280_2748411_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2748459_2749038_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2749065_2749449_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2749459_2749819_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2749876_2750905_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2750959_2751307_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2751319_2752816_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2752805_2754386_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2754382_2754586_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2754569_2756501_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2756472_2757018_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2757304_2757706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2757941_2758394_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2758411_2758864_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2758847_2759177_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2759452_2760139_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2760353_2760542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2761048_2761612_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2761884_2762562_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2762558_2762699_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2762695_2763307_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929791.1|2763515_2764118_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2764152_2764401_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2764517_2764751_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000704096.1|2765020_2766013_+	peptidase M85	NA	NA	NA	NA	NA
WP_000065102.1|2766039_2766558_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	89.8	1.4e-40
WP_000113618.1|2766554_2766902_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	96.5	2.7e-56
WP_000800012.1|2766912_2767662_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_157355909.1|2767664_2768753_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	88.5	1.4e-154
WP_010835408.1|2768837_2769212_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_001274939.1|2769171_2769414_-	hypothetical protein	NA	A0A0M4QX15	Salmonella_phage	67.9	5.6e-24
WP_014344514.1|2769486_2769900_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.0	1.5e-45
WP_000106861.1|2770042_2771152_+	AAA family ATPase	NA	E7C9Q8	Salmonella_phage	58.4	1.6e-118
WP_000917561.1|2771632_2771791_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	96.2	2.6e-22
WP_014344515.1|2771812_2772163_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	2.7e-59
WP_000017130.1|2772289_2775217_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	95.7	0.0e+00
WP_077905217.1|2775179_2776337_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	1.8e-216
WP_001237032.1|2776379_2776619_+	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	97.5	2.2e-36
WP_014344516.1|2776659_2776944_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	87.2	1.1e-42
WP_001007935.1|2776921_2778151_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	6.4e-233
WP_000589087.1|2778648_2779128_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2779124_2780081_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2780080_2780731_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2780762_2781338_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2781334_2781499_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2781762_2783385_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2783369_2784107_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2784237_2785572_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2785589_2786489_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2786591_2787179_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2787240_2787624_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2787942_2788632_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2788747_2789785_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2797689:2797705	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP037877	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 chromosome, complete genome	4786287	4347478	4367898	4786287	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587738.1|4347478_4348207_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4348403_4348694_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4348942_4349398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4349394_4350000_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4350004_4351750_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4351752_4352385_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4352377_4353493_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4353483_4353843_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4354006_4355554_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4355553_4356483_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4356479_4356842_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4357169_4357892_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4357901_4358945_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4358932_4359142_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4359141_4360095_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262500.1|4360094_4362449_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4362545_4362674_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4362633_4362951_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4363002_4363527_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4363526_4364954_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4364943_4365141_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4365137_4365593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4365752_4366067_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270440.1|4366079_4366685_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	1.2e-59
WP_001226442.1|4366687_4366975_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4367550_4367898_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	0	51306	247701	integrase,transposase	Stx2-converting_phage(18.18%)	50	39828:39844	61266:61282
WP_000624622.1|668_1016_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|1035_2607_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000470506.1|2967_3483_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_001044069.1|3630_4380_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000833503.1|4405_4798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000061015.1|4820_5243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000945974.1|5301_5913_-	lipoprotein	NA	NA	NA	NA	NA
WP_000593841.1|6019_6829_+	DsbA family protein	NA	NA	NA	NA	NA
WP_000281817.1|6880_8140_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	43.1	7.1e-94
WP_001395519.1|8123_8558_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	41.1	1.2e-21
WP_000963400.1|8735_9350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000694887.1|9497_9851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502663.1|10126_13462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012817917.1|13757_13979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537778.1|14228_14615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447552.1|14626_15052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534813.1|15085_15559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011080.1|15641_16001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974326.1|16546_17944_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001447551.1|18206_19013_+	DUF4263 domain-containing protein	NA	NA	NA	NA	NA
WP_001118621.1|20018_20942_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
WP_000613948.1|21002_21176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001089068.1|21288_22494_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_001322387.1|22572_23199_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001447544.1|23176_23863_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460651.1|23870_24257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562370.1|24249_24570_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001352368.1|26570_27779_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_011011079.1|27911_28520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000429174.1|28769_29069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250919.1|29416_30196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011078.1|30251_31184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000173534.1|31180_31696_-	thermonuclease family protein	NA	V5UN65	Mycobacterium_phage	28.3	7.1e-08
WP_000282148.1|31919_33347_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.0e-101
WP_011011077.1|33475_33646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529857.1|33670_34966_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000323423.1|35003_35207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010892342.1|35261_36482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272280.1|36484_36673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062400.1|36841_37297_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001233873.1|38897_39449_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	48.9	1.2e-45
WP_001049170.1|39445_40288_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
39828:39844	attL	TGGGTATGGATAAAGTC	NA	NA	NA	NA
WP_000098664.1|40438_41101_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	63.3	6.8e-72
WP_001115167.1|41467_41932_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809340.1|41928_42546_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000105680.1|42867_44088_+	autotransporter strand-loop-strand O-heptosyltransferase	NA	NA	NA	NA	NA
WP_053276064.1|44080_47893_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_024168330.1|47987_48329_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001089792.1|48743_49553_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_105462163.1|50093_51306_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	86.5	8.5e-145
61266:61282	attR	TGGGTATGGATAAAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	65262	117566	247701	protease,integrase,transposase	Enterobacteria_phage(16.67%)	48	99725:99739	119255:119269
WP_001582168.1|65262_67389_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_000090709.1|67375_68218_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_010892343.1|68832_69501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085012003.1|69723_72732_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_001196200.1|72890_73472_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	48.3	5.5e-41
WP_000085084.1|73548_74940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001084041.1|74936_77009_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000493286.1|77684_78014_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|77994_78276_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
WP_000019452.1|78553_79534_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	4.4e-184
WP_001118621.1|79811_80735_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
WP_001100942.1|81134_81782_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001176934.1|82118_83360_-	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_000301240.1|83444_84020_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
WP_004026609.1|84106_84685_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_073528079.1|84723_85764_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.3	4.1e-71
WP_004026604.1|85787_86243_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_042014824.1|86265_87417_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_042014825.1|87413_87998_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.4	2.0e-11
WP_042014827.1|88308_89367_+	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
WP_042014831.1|89378_90521_+	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	28.4	1.8e-32
WP_004181732.1|90513_91287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004210251.1|91288_92368_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	33.8	1.1e-39
WP_042014833.1|92367_93324_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042014837.1|94127_94586_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_042014838.1|94848_95043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073528080.1|95848_96487_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032248957.1|96511_97153_+	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	1.8e-05
WP_004026585.1|97153_97792_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_032248959.1|97884_98925_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_073528081.1|98924_100658_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
99725:99739	attL	AAAAAAGTTACTTTT	NA	NA	NA	NA
WP_032248920.1|100685_102185_+	kinase	NA	NA	NA	NA	NA
WP_000783215.1|103587_103950_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_001114073.1|103997_104351_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_001287388.1|104971_105376_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_089617545.1|106143_106593_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	35.4	7.5e-06
WP_089617546.1|106900_107320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001209044.1|107425_108232_-	HNH endonuclease	NA	G0X580	Salmonella_phage	37.9	1.3e-13
WP_000493077.1|108637_108841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341067.1|109253_109646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011011074.1|109712_109913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000111572.1|109902_110178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000416123.1|110325_110802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247564.1|110837_110981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232452.1|111058_112132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807689.1|113616_114372_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
WP_001324690.1|115957_116170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086279.1|116384_117566_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
119255:119269	attR	AAAAGTAACTTTTTT	NA	NA	NA	NA
>prophage 3
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	128904	130158	247701		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001113001.1|128904_130158_-	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
>prophage 4
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	138008	143665	247701		Bacillus_phage(50.0%)	4	NA	NA
WP_000517883.1|138008_139793_-	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	26.4	2.1e-19
WP_000792088.1|139974_140847_+	lipoprotein	NA	NA	NA	NA	NA
WP_000880375.1|141368_141623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166873.1|141625_143665_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	26.2	5.4e-27
>prophage 5
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	158800	159835	247701		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000137273.1|158800_159835_-	hypothetical protein	NA	A0A0A7NPX4	Enterobacteria_phage	34.3	6.7e-42
>prophage 6
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	163081	164089	247701		Aeromonas_phage(100.0%)	1	NA	NA
WP_001278833.1|163081_164089_-	peptide transporter	NA	A0A1I9KFW9	Aeromonas_phage	32.1	3.9e-10
>prophage 7
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	179184	187993	247701		Salmonella_phage(60.0%)	8	NA	NA
WP_001282731.1|179184_180060_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
WP_001015069.1|180594_181671_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
WP_000357614.1|181688_181889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682872.1|181885_182593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001178650.1|182875_183697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001225593.1|183711_184536_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
WP_001281654.1|184895_186053_+	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
WP_136571528.1|186238_187993_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	30.7	1.2e-67
>prophage 8
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	192837	193719	247701		Salmonella_phage(100.0%)	1	NA	NA
WP_000097746.1|192837_193719_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
>prophage 9
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	198887	200179	247701		Sphingobium_phage(50.0%)	2	NA	NA
WP_000178072.1|198887_199592_-	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	7.1e-11
WP_000902167.1|199819_200179_-	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.9e-08
>prophage 10
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	203806	204103	247701		Escherichia_phage(100.0%)	1	NA	NA
WP_000581856.1|203806_204103_+	toxin-plasmid maintenance system killer protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
>prophage 11
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	211589	214589	247701		Salmonella_phage(66.67%)	6	NA	NA
WP_011011060.1|211589_212321_+	hypothetical protein	NA	Q71T76	Escherichia_phage	57.1	3.3e-67
WP_001058453.1|212317_212629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001395478.1|212659_213184_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	62.8	6.2e-44
WP_000478449.1|213214_213823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000055244.1|213838_214192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011011059.1|214268_214589_+	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.0	5.3e-06
>prophage 12
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	221198	222404	247701		Yersinia_phage(100.0%)	1	NA	NA
WP_000108723.1|221198_222404_+	DNA-binding protein	NA	A0A2P9HXK7	Yersinia_phage	27.5	2.0e-13
>prophage 13
NZ_CP037875	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence	247701	227907	229819	247701		Clostridioides_phage(50.0%)	2	NA	NA
WP_011011085.1|227907_228621_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.4	5.7e-08
WP_000476770.1|228637_229819_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	28.1	7.5e-05
>prophage 1
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	0	2605	96545		Xanthomonas_phage(100.0%)	4	NA	NA
WP_000983042.1|679_835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477658.1|847_1132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139307.1|1246_1810_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000177629.1|1864_2605_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	3.9e-07
>prophage 2
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	20457	20877	96545		Salmonella_phage(100.0%)	1	NA	NA
WP_001229397.1|20457_20877_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	88.9	2.2e-68
>prophage 3
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	27346	27568	96545		Vibrio_virus(100.0%)	1	NA	NA
WP_001278699.1|27346_27568_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	42.3	1.0e-08
>prophage 4
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	37801	41713	96545		Emiliania_huxleyi_virus(33.33%)	5	NA	NA
WP_000117513.1|37801_39799_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.0	5.5e-16
WP_000131520.1|39867_40110_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000741240.1|40164_40683_-	single-stranded DNA-binding protein SSB2	NA	A0A0A0P1Q9	Enterobacteria_phage	82.5	6.8e-51
WP_156036612.1|41276_41426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015983.1|41389_41713_-	hypothetical protein	NA	G8C7V1	Escherichia_phage	56.5	2.0e-13
>prophage 5
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	44905	54201	96545	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_000088645.1|44905_45586_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
WP_000369839.1|45967_46324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000490265.1|46316_46787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000925627.1|47297_47720_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000457541.1|47719_48994_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_001541561.1|49075_50053_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_000427676.1|50049_51255_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728917.1|51669_52611_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_001541562.1|52642_53209_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|53265_53601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|53784_54201_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
>prophage 6
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	57750	58311	96545		Ralstonia_phage(100.0%)	1	NA	NA
WP_001240331.1|57750_58311_+	recombinase family protein	NA	A0A1W5LU24	Ralstonia_phage	42.7	1.3e-31
>prophage 7
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	63818	63983	96545		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|63818_63983_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 8
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	69405	69756	96545		Escherichia_phage(100.0%)	1	NA	NA
WP_001541541.1|69405_69756_+	helix-turn-helix domain-containing protein	NA	A0A077SLN2	Escherichia_phage	80.5	1.9e-44
>prophage 9
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	72816	73599	96545	integrase	Macacine_betaherpesvirus(100.0%)	1	65575:65587	80504:80516
65575:65587	attL	ATTTCTGGTTACT	NA	NA	NA	NA
WP_000082169.1|72816_73599_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000082169.1|72816_73599_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
80504:80516	attR	ATTTCTGGTTACT	NA	NA	NA	NA
>prophage 10
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	77439	78429	96545		Salmonella_phage(100.0%)	1	NA	NA
WP_001527061.1|77439_78429_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.6	1.2e-101
>prophage 11
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	89515	90073	96545		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000725062.1|89515_90073_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	38.5	4.5e-24
>prophage 12
NZ_CP037876	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S3, complete sequence	96545	93962	94987	96545		Stx2-converting_phage(100.0%)	2	NA	NA
WP_001339397.1|93962_94640_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|94639_94987_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
