The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	976985	985717	4984391	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|976985_978104_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|978100_980047_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|980176_980398_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|980721_981042_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|981072_983349_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|983540_983999_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|984461_985717_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 2
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	1035741	1126658	4984391	tail,integrase,holin,tRNA,lysis,protease,terminase	Salmonella_phage(58.7%)	91	1038650:1038669	1102546:1102565
WP_001154025.1|1035741_1036545_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1036537_1037860_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1037840_1038545_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572724.1|1038544_1043011_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1038650:1038669	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1043355_1045197_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1045456_1046005_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1046032_1046680_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1046741_1047932_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1048116_1049208_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1049814_1051215_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1051415_1051877_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1052193_1053408_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893207.1|1053652_1055089_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191399.1|1055166_1056369_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_020899445.1|1056563_1057856_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000065276.1|1057900_1058149_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1058189_1058429_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_014344386.1|1058471_1059629_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_157355887.1|1059591_1062792_-	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	79.0	0.0e+00
WP_023139985.1|1062918_1063269_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_000917559.1|1063317_1063449_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_000981510.1|1063745_1064180_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_001555460.1|1064285_1064513_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000426364.1|1064547_1064868_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_000062943.1|1064952_1065936_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000800012.1|1065938_1066688_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_020899441.1|1066698_1067046_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	1.8e-52
WP_000065109.1|1067042_1067501_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000850457.1|1067504_1067813_+	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000208142.1|1067816_1068461_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_001536080.1|1068460_1068718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|1068772_1069750_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_022630855.1|1069761_1070358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|1070949_1071183_+	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_000763780.1|1071292_1071514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929788.1|1071598_1072201_+	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_001096542.1|1072409_1073021_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000801757.1|1073017_1073158_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097242.1|1073154_1073844_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_001534733.1|1074038_1074164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1074299_1074749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1075109_1075796_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_077248428.1|1076071_1076401_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_000984584.1|1076384_1076837_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_024143045.1|1076854_1077301_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000867564.1|1077769_1078315_+|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_020899435.1|1079435_1079768_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000725267.1|1079867_1080365_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1080481_1081015_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1081104_1081800_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1081809_1082547_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001576012.1|1082444_1083149_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000033415.1|1083220_1086571_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000178849.1|1086609_1086852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157355888.1|1086905_1089344_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.9	7.5e-92
WP_000143167.1|1089343_1089925_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1090400_1091369_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1092016_1092643_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_031603423.1|1092711_1093011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1092995_1093682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1093952_1094144_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1094570_1097183_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1097390_1098401_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1098566_1099109_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1099105_1100215_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1100313_1102422_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1102434_1104342_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1102546:1102565	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1104356_1105610_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_136612561.1|1105614_1107255_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_033567177.1|1107251_1107815_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1108070_1108238_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1108337_1108856_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1108924_1110685_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1110870_1111323_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1111394_1112447_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1112803_1113313_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1113529_1114135_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1114121_1116275_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1116293_1116740_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1116863_1118918_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1118953_1119412_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1119506_1120169_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000975203.1|1120339_1120756_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1120800_1121118_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1121175_1122387_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1122601_1123150_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1123175_1123955_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1124003_1124285_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1124281_1124611_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1124697_1125357_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1125977_1126658_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 3
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	1936032	1942841	4984391	tail,integrase	Salmonella_phage(33.33%)	11	1930895:1930917	1940610:1940632
1930895:1930917	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000275418.1|1936032_1936914_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1937386_1937575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1937639_1937807_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1938063_1938597_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1938650_1938881_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1939070_1939565_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1939624_1940479_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_000722368.1|1940852_1941206_-	YebY family protein	NA	NA	NA	NA	NA
1940610:1940632	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|1941222_1942098_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1942098_1942473_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1942610_1942841_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 4
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	2018291	2097572	4984391	tail,head,portal,capsid,integrase,transposase,holin,plate,protease,terminase	Salmonella_phage(76.81%)	105	2024829:2024844	2099195:2099210
WP_000502119.1|2018291_2018750_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659236.1|2018930_2020136_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2020214_2021702_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2021958_2023362_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2023376_2023784_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2023783_2024152_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_022630963.1|2024223_2025708_+	alpha-amylase	NA	NA	NA	NA	NA
2024829:2024844	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2025747_2026173_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2026358_2027564_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2027560_2027794_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2028058_2028445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2028564_2028879_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2029095_2030778_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2030770_2031766_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2031758_2032466_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2032465_2033836_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2033857_2034301_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2034297_2035515_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2035619_2036087_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2036091_2037096_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2037092_2037506_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2037505_2037883_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2037882_2038620_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2038629_2038899_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2038907_2039702_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2039983_2040607_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2040645_2040894_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2040968_2041196_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2041505_2042321_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2042299_2044012_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2044176_2044422_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2044438_2045350_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2045525_2046446_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2046434_2046905_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2046885_2048316_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2048389_2049085_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2049176_2049476_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2050125_2051322_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2051582_2051771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2051781_2051994_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2052448_2053717_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2053719_2054139_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2054265_2054427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2055620_2055833_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2055829_2056243_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2056290_2056404_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2056478_2056712_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2056825_2057431_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000554735.1|2057400_2058963_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_001207832.1|2058949_2059537_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785581.1|2059539_2060619_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_000605055.1|2060611_2061025_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_001273649.1|2061029_2061563_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066632.1|2061562_2062621_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_033567259.1|2062617_2063958_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001033736.1|2064017_2064467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000785381.1|2064483_2066409_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_000588852.1|2066493_2066820_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515953.1|2066816_2067173_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_157355890.1|2067172_2068669_-|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_065305283.1|2068658_2068823_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_000779213.1|2068844_2069402_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_033567257.1|2069398_2069911_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_033567256.1|2069882_2070287_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_000927721.1|2070283_2070607_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033572442.1|2070609_2070810_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_033572441.1|2070859_2072065_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033567207.1|2072079_2072730_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_000466255.1|2072707_2073949_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605609.1|2073948_2074131_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_033567282.1|2074142_2075876_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000929191.1|2075872_2076367_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135098.1|2076492_2076843_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2076893_2077226_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2077688_2078081_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2078077_2078692_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2078691_2078973_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2078959_2079346_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2079491_2079749_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2079899_2080652_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_070793644.1|2080665_2081655_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_001061452.1|2081662_2082523_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_000779148.1|2082539_2082929_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_033567232.1|2082937_2083813_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000054228.1|2083809_2084283_-	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567233.1|2084279_2085254_-	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000620702.1|2085250_2085475_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087404.1|2085471_2086614_-	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000509731.1|2086610_2087165_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2087193_2087418_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2087515_2088211_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2088416_2088755_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2088717_2088942_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2089481_2089853_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023171064.1|2089910_2090738_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
WP_000008351.1|2090874_2091414_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2091484_2092018_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2092019_2092277_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2092287_2092869_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2092872_2093442_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2093466_2093709_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2093710_2094700_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2094991_2095789_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2096160_2096451_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2097098_2097572_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2099195:2099210	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	2183566	2194072	4984391		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2183566_2184880_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2184906_2185986_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2185990_2186764_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2186760_2187753_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2187758_2188310_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2188310_2189189_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2189236_2190136_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2190135_2191221_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2191597_2192491_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2192668_2194072_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	2262380	2271551	4984391	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2262380_2264414_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2264654_2265113_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2265284_2265815_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2265871_2266339_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2266385_2267105_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2267101_2268787_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2269009_2269741_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2269800_2269908_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2269888_2270620_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2270603_2271551_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	2290958	2357347	4984391	tail,lysis,holin	Salmonella_phage(25.0%)	59	NA	NA
WP_000989296.1|2290958_2291654_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2291807_2292692_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2292868_2293588_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2293584_2293830_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2294034_2295276_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreT	NA	NA	NA	NA	NA
WP_000956095.1|2295269_2296505_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2296579_2297590_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2297605_2299126_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2299259_2300258_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2300756_2301779_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2301928_2303071_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2303085_2303754_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2304083_2304941_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2304929_2305319_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2305323_2306691_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2306907_2307795_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2307827_2309150_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2309193_2311185_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2311530_2313000_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2313189_2314053_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2314173_2315223_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2315301_2316159_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2316223_2317912_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2317928_2318867_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2318866_2319997_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2320365_2321547_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2321611_2322277_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2322278_2322401_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2322788_2323043_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2323366_2323939_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2324151_2325138_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2325167_2325887_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2326300_2326873_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2327198_2328755_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2328861_2330667_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2330676_2331771_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2331770_2332796_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2332797_2334387_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2334390_2334735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2335125_2336316_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2336343_2337039_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2337190_2338951_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2339075_2339360_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2339468_2340089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2340116_2341124_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2341303_2341531_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2341562_2343323_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2343603_2344107_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2344134_2344425_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|2346648_2347092_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2347469_2347997_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_050947418.1|2347999_2349241_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	96.3	1.2e-53
WP_001120499.1|2349833_2350163_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2350459_2351791_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2351819_2352188_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2352202_2353192_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_149493964.1|2353520_2355887_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2356055_2356259_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2356555_2357347_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	2696928	2802739	4984391	tail,head,portal,capsid,integrase,transposase,protease,tRNA,lysis,holin,terminase	Salmonella_phage(39.06%)	111	2721473:2721489	2810643:2810659
WP_000940032.1|2696928_2697660_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2697778_2698582_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2698726_2699605_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2699786_2700830_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2700833_2701652_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2701662_2702676_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2702676_2703663_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2703653_2704292_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2704417_2705695_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2705689_2706829_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2707024_2708278_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2708602_2709793_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2709974_2711519_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2711879_2713211_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2713293_2715438_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2715493_2716954_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2717002_2717341_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2717417_2718755_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2718751_2719516_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2719517_2720948_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2721473:2721489	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2721597_2725485_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2725506_2725740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2725740_2727285_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2727335_2727887_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2727911_2728547_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2728550_2729912_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2729922_2730816_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2730931_2731780_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2731818_2732736_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2732757_2733954_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2734069_2734996_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2735033_2735294_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2735405_2735786_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2735785_2736517_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_033567169.1|2736528_2737257_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2737268_2738174_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2738170_2738851_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2739124_2740099_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2740115_2741915_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2742319_2743813_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2744303_2744441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2745153_2745318_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2745897_2745963_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2746025_2746238_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2746344_2746572_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2746668_2747247_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2747236_2748061_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2748057_2750430_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2750483_2750726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2750764_2754127_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2754188_2754836_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2754733_2755471_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2755477_2756176_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2756185_2756515_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2756517_2759613_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2759584_2759923_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2759919_2760315_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077248250.1|2760365_2761112_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000033885.1|2761119_2761521_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2761629_2762760_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2762808_2763387_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2763414_2763798_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2763808_2764168_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2764225_2765254_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2765308_2765656_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2765668_2767165_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2767154_2768735_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2768731_2768935_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2768918_2770850_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2770821_2771367_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2771653_2772055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2772290_2772743_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_015701345.1|2772760_2773213_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2773196_2773526_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2773801_2774488_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2774702_2774891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2775397_2775961_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2776233_2776911_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2776907_2777048_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096553.1|2777044_2777656_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	2.7e-91
WP_000929803.1|2777864_2778467_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001574100.1|2778506_2778812_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_001217666.1|2778801_2779041_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000445792.1|2779905_2780379_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_000065105.1|2780378_2780903_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000113623.1|2780899_2781247_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2781257_2782007_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_080071924.1|2782009_2782993_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_001574095.1|2783077_2783452_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000869364.1|2783417_2783654_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001009037.1|2783783_2784188_+	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000917562.1|2784586_2784745_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2784766_2785117_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_151257998.1|2785243_2788171_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.5	0.0e+00
WP_077248255.1|2788133_2789291_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2789333_2789573_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2789613_2789898_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2789875_2791105_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2791602_2792082_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2792078_2793035_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2793034_2793685_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2793716_2794292_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2794288_2794453_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2794716_2796339_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2796323_2797061_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2797191_2798526_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2798543_2799443_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2799545_2800133_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2800194_2800578_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2800896_2801586_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2801701_2802739_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2810643:2810659	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	2829551	2885413	4984391	tRNA,transposase,integrase	Escherichia_phage(50.0%)	45	2833174:2833190	2872995:2873011
WP_000469804.1|2829551_2830319_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2830363_2830912_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2830930_2831179_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2831492_2832854_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2833019_2833811_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
2833174:2833190	attL	GTATTCTGCCCGGCGGC	NA	NA	NA	NA
WP_127172650.1|2833830_2835117_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287923.1|2835237_2835843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2835877_2836468_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2836590_2837469_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2837554_2839216_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2839364_2839703_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2839868_2840159_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2840148_2840625_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2840774_2841257_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237668.1|2841870_2853345_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|2853409_2854819_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2854815_2856996_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2857003_2858167_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001542208.1|2858767_2859832_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|2859845_2860013_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|2860059_2860653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2861042_2862236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|2862570_2863398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701821.1|2863848_2864064_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2864099_2866169_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2866589_2867873_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2867917_2868736_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|2868889_2869246_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2869340_2869625_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2869737_2870259_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2870255_2870630_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|2870626_2871607_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001067855.1|2872015_2872720_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_031603456.1|2872880_2873444_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
2872995:2873011	attR	GCCGCCGGGCAGAATAC	NA	NA	NA	NA
WP_000811366.1|2873443_2874286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2874415_2875957_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001067855.1|2876766_2877471_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|2878226_2879078_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|2879385_2880201_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|2880261_2881065_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|2881064_2881901_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|2881961_2882666_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|2882712_2883114_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|2883263_2884124_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|2884708_2885413_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 10
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	3343430	3384960	4984391	tail,head,portal,capsid,integrase,tRNA,holin,terminase	Cronobacter_phage(67.57%)	46	3338767:3338782	3382182:3382197
3338767:3338782	attL	ATGGCGGCGTAGCCAG	NA	NA	NA	NA
WP_001264394.1|3343430_3344444_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|3344671_3344887_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3345122_3346868_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3347017_3348865_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3348988_3349495_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000340945.1|3349818_3350121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680744.1|3351489_3353190_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000200789.1|3353192_3353738_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_000267957.1|3353709_3354435_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000861353.1|3354424_3354979_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000084307.1|3354991_3357226_-|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_001001828.1|3357235_3357823_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000136921.1|3357815_3359000_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001002797.1|3358996_3359326_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000811094.1|3359322_3361293_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_000411339.1|3361480_3361738_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000376373.1|3361884_3362217_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_000175560.1|3362216_3362558_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_001154425.1|3362554_3362848_-|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000166743.1|3362857_3363313_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_000220203.1|3363309_3364437_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000560080.1|3364433_3365141_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000084218.1|3365137_3365644_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000447487.1|3365640_3366129_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_001218537.1|3366189_3366891_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000550495.1|3366894_3367917_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_000018800.1|3367978_3368782_-|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_001151939.1|3368942_3370718_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000038213.1|3370714_3371776_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001552031.1|3371772_3372096_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000353141.1|3372069_3372276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170874.1|3372395_3374417_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000279404.1|3374413_3375274_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000551169.1|3375264_3375498_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000022786.1|3375565_3375967_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000996837.1|3375966_3376392_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000643375.1|3376381_3376609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|3376618_3377122_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_001247711.1|3377152_3377374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514631.1|3377517_3378099_+	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_000568372.1|3378115_3378682_+	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.8	1.3e-18
WP_001145219.1|3378685_3379723_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000627044.1|3379712_3381494_+	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_000213760.1|3381751_3382519_-	siderophore-interacting protein	NA	NA	NA	NA	NA
3382182:3382197	attR	CTGGCTACGCCGCCAT	NA	NA	NA	NA
WP_000983441.1|3382750_3383398_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478472.1|3383394_3384960_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.0e-12
>prophage 11
NZ_CP037879	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS014863 chromosome, complete genome	4984391	4420279	4511225	4984391	tail,head,portal,capsid,integrase,protease,plate,tRNA,holin,terminase	Salmonella_phage(30.14%)	107	4471801:4471816	4517220:4517235
WP_000587738.1|4420279_4421008_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4421204_4421495_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4421743_4422199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4422195_4422801_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4422805_4424551_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4424553_4425186_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4425178_4426294_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4426284_4426644_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4426807_4428355_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4428354_4429284_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4429280_4429643_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4429970_4430693_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4430702_4431746_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4431733_4431943_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4431942_4432896_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|4432895_4435250_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4435346_4435475_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4435434_4435752_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_080076069.1|4435803_4436328_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	3.6e-68
WP_000729852.1|4436327_4437755_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4437744_4437942_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4437938_4438394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4438553_4438868_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4438880_4439486_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4439488_4439776_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4440351_4440699_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136400.1|4440831_4442181_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790037.1|4442525_4444175_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|4444618_4444861_+	outer membrane protein	NA	NA	NA	NA	NA
WP_125572646.1|4444894_4445563_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000977979.1|4445559_4446297_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|4446296_4448393_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|4448535_4448946_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|4449111_4450002_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|4450016_4451561_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695417.1|4451692_4452883_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|4453244_4454354_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973645.1|4454442_4455801_+	maltoporin	NA	NA	NA	NA	NA
WP_000782504.1|4455964_4456882_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019219.1|4457062_4457560_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|4457573_4458446_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|4458544_4460965_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002902.1|4461135_4461504_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|4461612_4462221_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128116.1|4462399_4463725_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_010989093.1|4463721_4463835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|4463856_4464066_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416272.1|4464164_4464680_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039339.1|4464926_4466237_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001535325.1|4466530_4467112_+	SocA family protein	NA	A0A139ZPG5	Marinitoga_camini_virus	29.6	8.8e-07
WP_000900143.1|4467117_4467579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093914.1|4467612_4467885_-	hypothetical protein	NA	S5MQM5	Escherichia_phage	96.6	5.7e-41
WP_136612579.1|4469690_4470254_-	ead/Ea22-like family protein	NA	C6ZR30	Salmonella_phage	90.1	1.6e-37
WP_000008351.1|4470381_4470921_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023171064.1|4471057_4471885_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	4.1e-151
4471801:4471816	attL	CCAGCCCCTGAATATC	NA	NA	NA	NA
WP_000997190.1|4471942_4472314_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000981537.1|4472769_4473423_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_001231956.1|4473518_4473716_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000514174.1|4473743_4474328_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001250269.1|4474503_4474683_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104967.1|4474672_4475614_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_023171062.1|4475616_4476099_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_136612571.1|4476098_4476992_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.6	2.5e-162
WP_023171060.1|4476988_4477378_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	7.1e-69
WP_023171059.1|4477394_4478255_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	98.6	2.7e-161
WP_024147207.1|4478262_4479252_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	1.5e-192
WP_023171057.1|4479282_4480113_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	43.3	5.0e-56
WP_023171056.1|4480219_4481143_-	hypothetical protein	NA	A0A1B5FPA3	Escherichia_phage	56.4	1.6e-42
WP_023171055.1|4481293_4481680_+	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	92.2	8.9e-56
WP_000250465.1|4481666_4481948_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	51.1	8.2e-19
WP_023171053.1|4481947_4482562_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.1	1.4e-108
WP_023171052.1|4482558_4483098_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	49.3	1.3e-07
WP_000495545.1|4483140_4483518_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	2.2e-43
WP_001070544.1|4483614_4483842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024147208.1|4483976_4484321_+	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	8.8e-47
WP_023171050.1|4484453_4484918_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_077909829.1|4484871_4486614_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171048.1|4486613_4487918_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	86.6	1.9e-219
WP_136612572.1|4487931_4488780_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	2.2e-131
WP_023171046.1|4488789_4490007_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.9	4.6e-199
WP_047643298.1|4490050_4490266_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.4e-10
WP_000886224.1|4490265_4490589_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_023171044.1|4490600_4491014_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_023171043.1|4490985_4491498_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_001241332.1|4491494_4492040_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	84.7	3.6e-87
WP_000497755.1|4492061_4492226_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	96.3	8.4e-24
WP_136612573.1|4492215_4493712_+|tail	phage tail protein	tail	Q8HAC5	Salmonella_phage	98.8	3.4e-276
WP_000090998.1|4493711_4494068_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|4494067_4494337_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_022630976.1|4494478_4496311_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.9	8.8e-303
WP_001439754.1|4496392_4496905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000219913.1|4496995_4498324_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_000999499.1|4498320_4499400_+|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.7	5.3e-207
WP_022630975.1|4499399_4499948_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	1.9e-96
WP_000424732.1|4499947_4500373_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_022630974.1|4500359_4501418_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	5.2e-199
WP_072643295.1|4501408_4501993_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	7.0e-113
WP_111192319.1|4501996_4503079_+|tail	phage tail protein	tail	U5P0I1	Shigella_phage	83.8	9.8e-52
WP_136612574.1|4503085_4503493_+|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	2.4e-59
WP_000161707.1|4503689_4504412_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000639149.1|4504936_4505500_+	recombinase family protein	NA	K7PJT4	Enterobacteria_phage	79.1	3.4e-80
WP_001217553.1|4505643_4505892_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000332264.1|4505953_4507051_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_022630972.1|4507139_4508177_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891414.1|4508344_4508587_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235551.1|4508761_4509745_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918353.1|4509809_4511225_+	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
4517220:4517235	attR	CCAGCCCCTGAATATC	NA	NA	NA	NA
