The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	274438	296160	4816454	transposase,integrase	Bacillus_phage(28.57%)	17	262891:262905	286917:286931
262891:262905	attL	ATTGATAAAGCAATC	NA	NA	NA	NA
WP_000090707.1|274438_275281_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085947771.1|275751_276913_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_099975594.1|277032_278652_+|integrase	integrase core domain protein	integrase	NA	NA	NA	NA
WP_001049180.1|278651_280100_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|280140_281697_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262420.1|281708_282635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|282987_283287_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|283850_285677_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647571.1|285845_286196_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|286342_286774_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_001377740.1|287018_288500_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
286917:286931	attR	ATTGATAAAGCAATC	NA	NA	NA	NA
WP_000697968.1|288492_289173_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475506.1|289362_290748_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|290775_291129_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_001317493.1|292339_293122_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255956.1|293118_294141_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_104989427.1|294621_296160_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	97.1	2.0e-292
>prophage 2
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	1086746	1099929	4816454		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|1086746_1087508_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|1087501_1088128_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1088267_1089407_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1089469_1090462_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1090555_1091920_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1092008_1092785_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1092789_1093428_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1093424_1094687_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1094683_1095592_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1095787_1096555_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|1096605_1097262_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1097367_1099929_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 3
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	1710287	1719729	4816454		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1710287_1711214_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1711218_1711950_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1711930_1712038_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1712097_1712829_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1713050_1714736_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1714732_1715452_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1715498_1715969_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1716009_1716471_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001374182.1|1716595_1718596_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292773.1|1718592_1719729_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	1845890	1865388	4816454	transposase,lysis,integrase,holin	Enterobacteria_phage(53.33%)	23	1844352:1844365	1855932:1855945
1844352:1844365	attL	TACTGCTGCGCCAG	NA	NA	NA	NA
WP_104989426.1|1845890_1846094_+	DUF4102 domain-containing protein	NA	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.9e-33
WP_072163397.1|1846172_1847069_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.7	1.9e-173
WP_000132739.1|1847049_1847241_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_053908461.1|1847345_1847525_-	Eag protein	NA	K7PL40	Enterobacteria_phage	98.3	7.3e-29
WP_053908465.1|1848115_1848739_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.0	2.0e-113
WP_000783734.1|1849172_1849496_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|1849479_1849956_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_053908467.1|1849952_1850390_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	1.4e-68
WP_053908469.1|1850985_1851354_+	hypothetical protein	NA	K7PH35	Enterobacteria_phage	97.6	1.5e-60
WP_000807788.1|1851457_1851700_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000113732.1|1851702_1852143_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000255956.1|1852623_1853646_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001317493.1|1853642_1854425_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001323397.1|1856693_1856852_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
1855932:1855945	attR	CTGGCGCAGCAGTA	NA	NA	NA	NA
WP_001514886.1|1857787_1858162_+	toxin YeeV	NA	NA	NA	NA	NA
WP_157297534.1|1858158_1858368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295631.1|1858679_1859051_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_032181276.1|1859504_1859687_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_000450409.1|1859787_1860117_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_032181141.1|1860288_1861347_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105385.1|1861545_1862019_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001383231.1|1862137_1863304_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	2.2e-227
WP_157297545.1|1864282_1865388_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.8e-51
>prophage 5
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	2348467	2380642	4816454	tail,integrase,lysis	Enterobacteria_phage(37.5%)	39	2343757:2343773	2374273:2374289
2343757:2343773	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000041556.1|2348467_2350894_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|2351092_2351398_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2351505_2352216_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2352218_2352779_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2352813_2353155_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2353289_2353616_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2353821_2355036_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2355047_2356067_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001389342.1|2356124_2356253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876976.1|2356254_2357535_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001296941.1|2357569_2357806_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_001474311.1|2357893_2360365_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001090200.1|2360457_2360649_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2360645_2360834_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001474216.1|2361321_2361897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001421419.1|2361898_2362054_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000362155.1|2362319_2362739_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|2362839_2363121_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_001478187.1|2363104_2363530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001475341.1|2363601_2364672_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	6.5e-64
WP_000379313.1|2365365_2366391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2366768_2366876_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001013636.1|2366920_2367133_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_001332495.1|2367591_2367870_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001483581.1|2367871_2368921_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.2e-109
WP_000904112.1|2368933_2369308_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762866.1|2369304_2370126_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.2e-78
WP_029380182.1|2371024_2371153_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	96.4	4.7e-06
WP_000506936.1|2371519_2371948_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2372119_2372494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839561.1|2372745_2372961_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	95.8	5.9e-33
WP_001421378.1|2372965_2373277_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	66.7	5.9e-26
WP_001092966.1|2373273_2373807_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
WP_001071776.1|2373803_2374301_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2374273:2374289	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_001356335.1|2374664_2374877_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.6e-22
WP_071526745.1|2374887_2375076_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2375223_2375379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000548593.1|2376019_2376226_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_157297536.1|2377282_2380642_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	36.4	1.1e-11
>prophage 6
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	2782647	2793425	4816454	integrase	Enterobacteria_phage(40.0%)	11	2780620:2780643	2792128:2792151
2780620:2780643	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|2782647_2784603_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|2786967_2787507_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|2787689_2788001_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|2787997_2788678_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|2788674_2788833_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2788829_2789894_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2790047_2790266_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2790313_2790553_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|2790692_2790929_+	excisionase	NA	NA	NA	NA	NA
WP_000741339.1|2790918_2792061_+|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|2792174_2793425_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2792128:2792151	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 7
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	3107801	3116571	4816454	integrase	Salmonella_phage(90.0%)	12	3107471:3107484	3116613:3116626
3107471:3107484	attL	AAAACAATAAGTTA	NA	NA	NA	NA
WP_001376441.1|3107801_3107990_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_001376443.1|3108148_3110542_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	93.7	0.0e+00
WP_001544405.1|3110538_3111396_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	9.5e-159
WP_000752610.1|3111392_3111620_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_001244224.1|3111619_3111853_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|3111920_3112262_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956192.1|3112379_3112676_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000460892.1|3112683_3113193_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000188448.1|3113225_3113447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001680871.1|3113592_3114471_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	1.7e-30
WP_001678408.1|3114482_3115427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157297540.1|3115518_3116571_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.4e-106
3116613:3116626	attR	TAACTTATTGTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	3197415	3206593	4816454	tail,lysis	Enterobacteria_phage(50.0%)	13	NA	NA
WP_001356070.1|3197415_3198705_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.4e-19
WP_000767389.1|3198763_3199240_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001753290.1|3199985_3201317_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_072163407.1|3201390_3201567_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.5	9.4e-21
WP_153274581.1|3201546_3201687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239881.1|3201716_3202385_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|3203275_3203836_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|3204224_3204458_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3204514_3204925_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3205276_3205429_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3205457_3205664_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001372488.1|3205880_3206378_-	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3206377_3206593_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
>prophage 9
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	3209791	3227356	4816454	transposase,integrase	Enterobacteria_phage(44.0%)	31	3201723:3201737	3234108:3234122
3201723:3201737	attL	AAATTAATGAAAAAA	NA	NA	NA	NA
WP_000780581.1|3209791_3210316_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3210471_3210849_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3210934_3211075_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3211071_3211434_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3211430_3211721_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3211713_3211884_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3211883_3212339_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3212335_3212437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3212529_3212982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3212978_3213539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3214023_3214317_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|3214313_3215015_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_001415152.1|3215011_3215941_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.2e-109
WP_001182899.1|3216027_3216567_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|3216636_3216867_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3216971_3217661_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|3217783_3218533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3218529_3219357_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3219865_3220072_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3220147_3220444_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000255956.1|3220844_3221867_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001317493.1|3221863_3222646_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_001372450.1|3223191_3223872_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3223868_3224051_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3224023_3224215_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3224225_3224507_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3224605_3224827_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|3225037_3225640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3225882_3226050_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3226089_3226308_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_087526121.1|3226285_3227356_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.4	4.3e-201
3234108:3234122	attR	TTTTTTCATTAATTT	NA	NA	NA	NA
>prophage 10
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	3712393	3734630	4816454	tail,integrase	Shigella_phage(50.0%)	20	3711951:3712010	3730715:3730774
3711951:3712010	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_063118745.1|3712393_3716848_-	hypothetical protein	NA	A0A2H4PQV1	Staphylococcus_phage	32.4	1.1e-43
WP_063118744.1|3717385_3717970_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	97.9	1.5e-107
WP_119890158.1|3717969_3721248_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
WP_001233090.1|3721312_3721912_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_074151168.1|3723552_3723732_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	1.7e-14
WP_001434539.1|3723907_3724459_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_000205494.1|3724496_3724697_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3724794_3725421_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000549623.1|3725668_3725875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3725846_3726281_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000135682.1|3726749_3727112_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001700344.1|3727177_3728002_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008200.1|3728129_3728666_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3728656_3729019_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3729018_3729324_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_123010001.1|3729239_3729674_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	99.3	1.4e-78
WP_063118753.1|3729550_3730714_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	9.1e-229
WP_000893260.1|3730918_3732172_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
3730715:3730774	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3732183_3733287_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3733574_3734630_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 11
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	3972086	4078349	4816454	tRNA,lysis,capsid,integrase,head,tail,portal,terminase	Enterobacteria_phage(42.19%)	104	4066563:4066577	4079527:4079541
WP_001286857.1|3972086_3974903_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
WP_000767329.1|3974945_3975887_-	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_001295417.1|3975894_3976113_-	DUF2575 domain-containing protein	NA	NA	NA	NA	NA
WP_001274021.1|3976215_3976479_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000062888.1|3980970_3981876_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_000681360.1|3981935_3983102_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|3983630_3983840_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|3983943_3985074_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516131.1|3985162_3987079_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	9.0e-149
WP_000843559.1|3987455_3987860_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|3987885_3988599_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|3988747_3989314_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|3989348_3989936_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130185.1|3990050_3991004_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001112597.1|3991282_3992713_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000906183.1|3992782_3993559_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_000738723.1|3993711_3994008_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000781063.1|3994221_3995508_-	threonine synthase	NA	NA	NA	NA	NA
WP_000241660.1|3995508_3996441_-	homoserine kinase	NA	NA	NA	NA	NA
WP_001753208.1|3996442_3998905_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_001386572.1|3998985_3999051_-	thr operon leader peptide	NA	NA	NA	NA	NA
WP_157297541.1|3999264_3999951_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001303782.1|4000350_4000491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001194358.1|4000586_4001303_+	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_000920307.1|4001361_4002714_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001188666.1|4004194_4004884_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_000875487.1|4004896_4005370_-	protein CreA	NA	NA	NA	NA	NA
WP_000371666.1|4005580_4006450_+	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000942344.1|4006446_4007094_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_001346116.1|4007145_4007658_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000068679.1|4007700_4008027_-	trp operon repressor	NA	NA	NA	NA	NA
WP_000409451.1|4008116_4010054_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000046749.1|4010264_4011932_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|4012238_4013471_-	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_001029698.1|4013491_4014874_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_001132956.1|4014922_4015891_-	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_000124615.1|4015996_4016641_+	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_000105889.1|4016668_4017685_+	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000224877.1|4018140_4018860_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000816471.1|4018939_4020163_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_000477811.1|4020214_4021537_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_001295412.1|4021663_4022443_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001143253.1|4022700_4024251_+	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001088379.1|4024222_4025086_+	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000563058.1|4025400_4026183_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001299799.1|4026179_4027253_-	patatin family protein	NA	NA	NA	NA	NA
WP_000490275.1|4027374_4027536_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|4027662_4028268_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000202566.1|4028660_4030247_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_048943363.1|4030466_4030727_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.1	3.1e-36
WP_005025120.1|4031086_4032691_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_048943362.1|4033135_4033720_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.3e-103
WP_157297542.1|4033719_4037070_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	39.1	7.3e-13
WP_032202908.1|4037134_4037734_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.2e-109
WP_048943357.1|4037800_4041283_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.7	0.0e+00
WP_000090892.1|4041342_4041975_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_048943354.1|4041911_4042655_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.8e-145
WP_001152502.1|4042660_4043359_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847345.1|4043358_4043688_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_048943353.1|4043684_4046246_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.3	0.0e+00
WP_000459457.1|4046238_4046673_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001357868.1|4046654_4047077_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_048943399.1|4047092_4047833_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_000683111.1|4047840_4048236_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_048943351.1|4048232_4048811_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.9e-80
WP_000752996.1|4048822_4049176_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_048943350.1|4049187_4049583_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.4e-56
WP_048943349.1|4049624_4050650_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	9.0e-188
WP_001338090.1|4050705_4051038_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_048943348.1|4051047_4052367_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	3.8e-231
WP_032358757.1|4052347_4053949_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|4053945_4054152_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027268.1|4054148_4056074_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453611.1|4056048_4056594_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001663509.1|4056982_4057216_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|4057272_4057683_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|4058034_4058187_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|4058215_4058422_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_122654012.1|4058425_4058617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048943344.1|4058638_4059172_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.3e-99
WP_000370550.1|4059277_4059550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001468348.1|4059515_4059860_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	96.4	4.4e-38
WP_000839596.1|4059864_4060080_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4060147_4061200_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|4061350_4061554_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001047110.1|4061807_4062560_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_001433852.1|4062573_4063563_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_001061397.1|4063570_4064368_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_000767103.1|4064387_4064777_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	98.4	1.0e-67
WP_000210170.1|4064773_4065100_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001442792.1|4065096_4065750_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_074400546.1|4065749_4066244_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	93.9	1.7e-83
WP_000104941.1|4066240_4067182_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
4066563:4066577	attL	TCGTACAGGGCAATG	NA	NA	NA	NA
WP_001250269.1|4067171_4067351_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000526668.1|4067526_4068084_-	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
WP_001191669.1|4068076_4068337_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_001020632.1|4068434_4069127_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|4069829_4070192_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081316.1|4070257_4071082_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008209.1|4071209_4071746_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
WP_001242723.1|4071736_4072099_+	phage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
WP_000206803.1|4072098_4072719_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_157297543.1|4073115_4076943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218277.1|4077125_4078349_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
4079527:4079541	attR	TCGTACAGGGCAATG	NA	NA	NA	NA
>prophage 12
NZ_CP041031	Escherichia coli strain PT109 chromosome, complete genome	4816454	4167261	4173820	4816454	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|4167261_4168218_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4168218_4168986_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4169543_4169801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4170852_4172004_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4171923_4172274_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4172374_4172947_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4172995_4173820_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 1
NZ_CP041032	Escherichia coli strain PT109 plasmid pLB_CTX-M-15_PT109, complete sequence	126409	10495	60650	126409	integrase,transposase	Escherichia_phage(38.89%)	48	NA	NA
WP_000255956.1|10495_11518_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_024193849.1|12597_12972_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	9.8e-60
WP_001067855.1|12996_13701_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|13822_14728_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|14724_15963_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|15962_16547_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|17039_17804_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|18030_18336_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|18346_19552_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|19707_19911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|20038_20878_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|20871_21219_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|21424_22213_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|22343_22817_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|22974_23988_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|24190_24541_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|24854_25559_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000839179.1|25627_26032_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_094259714.1|26060_27184_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	96.4	8.7e-136
WP_000371882.1|27285_27546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194541.1|27542_28112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142452.1|28131_28479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080732.1|28607_28943_+	colicin transporter	NA	NA	NA	NA	NA
WP_001224623.1|31412_32288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000981091.1|32295_33072_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_001100763.1|33240_35502_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001020413.1|35570_36746_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_032143699.1|38331_38703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189123.1|39011_40520_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001336919.1|41085_41655_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.2	6.4e-26
WP_000734115.1|43030_43783_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000090196.1|44024_44897_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000872613.1|45027_46251_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032152933.1|46436_47210_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_053908471.1|47275_47977_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_000039982.1|48042_49149_-	alkene reductase	NA	NA	NA	NA	NA
WP_002431133.1|49362_49692_+	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
WP_000888080.1|49721_50060_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_000210409.1|50064_50646_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000108589.1|50787_51345_-	OsmC family protein	NA	NA	NA	NA	NA
WP_001067855.1|52061_52766_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_050011420.1|52756_53119_+|transposase	IS1380 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	3.8e-40
WP_000239590.1|53374_54250_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|54296_54629_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|56950_57655_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|58286_59117_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|59247_59802_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|59945_60650_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
