The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044305	Escherichia coli strain C27A chromosome, complete genome	4682770	1751	130695	4682770	integrase,transposase,tRNA,protease,tail,plate,lysis,terminase,portal	Enterobacteria_phage(43.75%)	115	20720:20735	132170:132185
WP_000635537.1|1751_2174_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|2187_2898_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001140187.1|9567_10143_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|15902_16706_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|16702_17617_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|17857_18658_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|18661_19285_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|19332_20691_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
20720:20735	attL	ACCAATCATAACGGCG	NA	NA	NA	NA
WP_001052715.1|20762_21518_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|21551_22274_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|22270_22738_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|22802_23534_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_157701331.1|24075_24855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157701203.1|26191_26383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157701204.1|26425_26908_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001087741.1|26931_28284_-	membrane protein	NA	NA	NA	NA	NA
WP_122545204.1|28294_31729_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|31837_33250_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|33254_33998_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_157701205.1|33994_36703_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.2	1.2e-74
WP_000343289.1|36711_37473_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246442.1|37477_38809_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|38811_39336_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113719.1|39332_40613_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|40637_41720_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|41683_43534_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|43537_43951_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|43957_45433_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|45483_45708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|45742_46243_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|46944_47463_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103354.1|47672_49814_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_000508724.1|49889_54122_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_000420818.1|54898_56035_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001118036.1|56075_56846_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|56999_57473_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000284050.1|60000_60579_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000615983.1|62386_62665_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|62667_62928_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056849.1|63135_63885_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000006255.1|64060_64558_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_157701332.1|66532_67216_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_000554758.1|68372_68666_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|68668_69067_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_001059892.1|69076_69529_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|69834_70101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|70033_70570_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|70626_72084_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_157701206.1|74198_74600_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000051887.1|78522_79686_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_071830316.1|79562_79913_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	96.6	1.3e-58
WP_000488407.1|79884_80163_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|80210_80429_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_135561019.1|80527_80809_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	7.9e-46
WP_000129285.1|80819_81377_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682319.1|81369_81531_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	9.1e-23
WP_000186811.1|81527_82208_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	4.6e-132
WP_000100847.1|82204_82990_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|82995_83292_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_001309317.1|83367_83658_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	83.8	5.0e-27
WP_000866321.1|84051_84429_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_157701333.1|84406_85465_-	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	41.9	1.4e-63
WP_000858975.1|85549_86239_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|86343_86574_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|86643_87183_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001376316.1|87269_88199_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	68.4	6.1e-111
WP_157701207.1|88195_88897_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.4	2.1e-127
WP_001373314.1|88893_89067_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	87.3	4.6e-20
WP_001224618.1|89213_89708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379697.1|90353_90554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141579.1|90662_90764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135561017.1|90760_91216_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224914.1|91215_91386_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|91378_91669_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099516.1|91665_92028_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	94.0	2.3e-58
WP_032145910.1|92024_92165_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001204780.1|92250_92634_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737263.1|92822_93905_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	78.7	4.4e-161
WP_000839596.1|94486_94702_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|94701_95199_+	lysozyme	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|95195_95663_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_021512737.1|95650_95803_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	4.7e-21
WP_000349509.1|96478_96970_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_025670557.1|96969_99072_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_001072975.1|99068_99281_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_052249886.1|99280_100750_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	3.1e-282
WP_157701334.1|100640_101615_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.3	2.0e-149
WP_000839179.1|101692_102097_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|102093_102441_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_157701208.1|102489_103872_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	75.6	8.3e-205
WP_023140705.1|105157_105481_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	8.5e-52
WP_001283153.1|105473_105749_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_023140704.1|105760_106339_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001079419.1|106335_106737_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_021560209.1|106747_107491_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	99.2	2.3e-132
WP_001300035.1|107551_107938_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|107946_108276_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_039023165.1|108247_111313_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_039023164.1|111312_111642_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	1.7e-60
WP_001152385.1|111651_112350_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_032151194.1|112355_113099_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_032158484.1|112996_113644_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	6.2e-110
WP_039023163.1|113704_117202_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.0	0.0e+00
WP_001230375.1|117271_117871_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	98.5	5.7e-110
WP_086708942.1|117935_121694_+	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	93.4	0.0e+00
WP_072240810.1|121748_121877_+|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_039023230.1|122554_123436_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000371964.1|123413_123995_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_039023231.1|124689_124887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039023233.1|125387_126230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191833.1|126871_128086_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	2.8e-132
WP_020802548.1|128154_128745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045339018.1|128912_129110_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_020802552.1|129581_129827_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_021312336.1|129819_130695_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
132170:132185	attR	ACCAATCATAACGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP044305	Escherichia coli strain C27A chromosome, complete genome	4682770	760589	840899	4682770	head,integrase,tRNA,protease,tail,capsid,plate,lysis,terminase,holin,portal	Escherichia_phage(50.94%)	78	765884:765901	833468:833485
WP_000520781.1|760589_760910_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|760940_763217_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|763901_764120_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|764404_765109_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202175.1|765150_766872_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
765884:765901	attL	TGGGTATCAGGAAAGGTG	NA	NA	NA	NA
WP_001043592.1|766872_768639_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	1.8e-23
WP_000537418.1|768761_769727_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|770271_770766_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077038.1|770900_774890_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|775048_775660_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|775670_777014_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|777104_778397_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|778635_781080_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|781090_781708_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534637.1|781709_782573_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165879.1|782607_783234_-	hydrolase	NA	NA	NA	NA	NA
WP_000109259.1|783547_784696_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918523.1|784905_786336_+	amino acid permease	NA	NA	NA	NA	NA
WP_001242684.1|786336_787245_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190363.1|787344_787935_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_000067979.1|788016_788814_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023390.1|788845_789841_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_001389238.1|789934_790234_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_001389237.1|790342_790699_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_000217681.1|790876_791377_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.0e-91
WP_000557703.1|791440_791665_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277897.1|791664_791967_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_021533450.1|791966_792191_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	95.9	9.4e-34
WP_000027664.1|792187_792463_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_053264580.1|792452_794720_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.5	0.0e+00
WP_000038168.1|796454_797489_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	4.2e-201
WP_000156861.1|797488_799261_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001406872.1|799434_800289_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.9	2.5e-135
WP_100481247.1|800347_801421_+|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.2	7.4e-201
WP_016239051.1|801424_802168_+|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.6	1.2e-125
WP_000988636.1|802267_802777_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000846409.1|802776_802980_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|802983_803265_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|803264_803762_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_134232756.1|803776_804202_+	protein lysA	NA	U5N096	Enterobacteria_phage	97.9	1.9e-59
WP_021536418.1|804189_804615_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	9.4e-67
WP_001440152.1|804586_804760_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917156.1|804722_805190_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001001774.1|805182_805635_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_157701220.1|805701_806337_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	6.1e-110
WP_000127164.1|806333_806681_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121473.1|806685_807594_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_001285337.1|807586_808198_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_157701221.1|808194_809490_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	88.8	7.7e-144
WP_047149170.1|809492_809903_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	2.5e-24
WP_080154692.1|810279_810873_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	4.2e-105
WP_157701222.1|810932_812123_+|tail	phage tail protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.4e-224
WP_001251408.1|812135_812654_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|812710_812986_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|813018_813138_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_157701223.1|813130_815578_+|tail	phage tail tape measure protein	tail	A0A0F7LA40	Escherichia_phage	99.8	0.0e+00
WP_000978878.1|815592_816072_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	98.7	9.6e-84
WP_000882969.1|816071_817235_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_000468308.1|817316_817535_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|817854_820137_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|820191_821049_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001295344.1|821448_823209_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|823338_824031_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057138.1|824229_825318_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|825388_826672_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001295345.1|826840_827605_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000125016.1|827777_828461_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|828571_830245_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|830404_830689_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|830896_833161_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|833197_834946_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
833468:833485	attR	TGGGTATCAGGAAAGGTG	NA	NA	NA	NA
WP_000570539.1|834942_835929_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056538.1|835965_837198_+	winged helix DNA-binding protein YcaQ	NA	NA	NA	NA	NA
WP_000350058.1|837249_837432_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011620.1|837428_838175_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436932.1|838328_839222_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|839198_839978_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|840113_840899_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP044305	Escherichia coli strain C27A chromosome, complete genome	4682770	2638968	2652151	4682770		Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|2638968_2641530_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|2641635_2642292_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|2642342_2643110_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|2643305_2644214_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|2644210_2645473_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|2645469_2646108_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|2646112_2646889_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|2646977_2648342_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2648435_2649428_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2649490_2650630_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2650769_2651396_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2651389_2652151_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 4
NZ_CP044305	Escherichia coli strain C27A chromosome, complete genome	4682770	3031437	3040063	4682770	transposase	Escherichia_phage(87.5%)	8	NA	NA
WP_066019098.1|3031437_3032418_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	5.2e-185
WP_001327048.1|3032632_3033163_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SLP0	Escherichia_phage	100.0	8.6e-102
WP_001139856.1|3033159_3033756_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	100.0	1.7e-114
WP_000544912.1|3033810_3034587_-	dimethyl sulfoxide reductase subunit C	NA	A0A077SK59	Escherichia_phage	100.0	5.8e-131
WP_000816147.1|3034579_3035206_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	100.0	2.9e-128
WP_061424402.1|3035219_3037655_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	100.0	0.0e+00
WP_157701290.1|3038433_3038781_-	hypothetical protein	NA	A0A077SK28	Escherichia_phage	93.1	1.7e-42
WP_047928879.1|3038992_3040063_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	42.2	3.9e-69
>prophage 1
NZ_CP044306	Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence	264269	6499	62743	264269	integrase,transposase	Escherichia_phage(30.77%)	49	10808:10867	70006:70309
WP_001067855.1|6499_7204_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|7325_8231_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|8227_9466_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|9465_10050_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087525853.1|10542_10902_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A077SL39	Escherichia_phage	64.6	1.7e-13
10808:10867	attL	AGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_012477564.1|11203_11794_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|11930_12503_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_001493761.1|12539_13931_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_157701357.1|14290_14695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001516695.1|14707_15364_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001393253.1|19625_19958_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_015387340.1|20004_20880_-	class A extended-spectrum beta-lactamase CTX-M-55	NA	A0A1B0VBP7	Salmonella_phage	82.1	2.4e-125
WP_001235713.1|22865_23423_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_032623598.1|24806_26537_+	peptidoglycan synthetase FtsI	NA	NA	NA	NA	NA
WP_000557454.1|30914_31775_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|31787_32330_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|32811_33003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001330846.1|33008_33254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837927.1|33304_34432_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|34468_35173_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015057121.1|35063_36023_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
WP_032491824.1|36171_36963_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_000939727.1|37094_37916_+	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_011264039.1|38838_39078_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_157701358.1|39186_40086_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.6e-05
WP_001354008.1|40123_40369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|40838_41630_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000490638.1|42592_43258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001426317.1|43315_43696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|44341_45160_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|45156_46362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|46641_47961_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|48211_49639_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|49853_50369_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_157701367.1|50371_51283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|51488_51722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|52392_52623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120160101.1|52982_53417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|53446_53854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|53904_54222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157701359.1|54269_54434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|54600_54951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351729.1|56815_57208_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|57345_58230_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|58261_59461_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000470728.1|59539_60217_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|60248_60491_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000480968.1|60796_61633_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067858.1|62038_62743_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
70006:70309	attR	GCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTTGAATCTATCCGGCGTCTGAATGGGATTTTATTCCCGCGCCTTGATGAGTTCCGCGCCTGATGAACCTCCAGAAAATATACGGCTTCAATGAGCCTTTCCGTTTTACAGGTTCCTCAACAGGCCGGTGGGCCGTTAGTATCATCAATATCAGTATTCGCAAAACCAGATCAGTAATTCTTTAAACCGGTGTATTTCTGCCGTTATGCTACATAAGTTTGCTGTCGTGCCGTTAGGGCCCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP044306	Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence	264269	178431	185424	264269	transposase	Salmonella_phage(50.0%)	6	NA	NA
WP_001121575.1|178431_179244_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	38.5	3.0e-45
WP_000114859.1|179613_180777_+	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	32.1	1.3e-17
WP_000096324.1|181024_182716_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	31.0	2.6e-67
WP_001201739.1|183111_183495_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	36.3	4.1e-13
WP_000609174.1|183491_183839_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001000406.1|183888_185424_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	88.1	4.8e-262
