The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046840	Vibrio cholerae strain F9993 chromosome 1, complete sequence	3082401	102916	145166	3082401		Vibrio_phage(41.94%)	37	NA	NA
WP_001161489.1|102916_103084_+	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
WP_000170632.1|103076_103244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265358.1|104282_104849_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001881266.1|105010_106579_+	replication protein	NA	A7BJY2	Enterobacteria_phage	32.3	2.7e-58
WP_001881265.1|106583_106868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001052672.1|106997_107690_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001161489.1|107767_107935_+	hypothetical protein	NA	E3U9J0	Vibrio_phage	100.0	2.3e-13
WP_000170634.1|107927_108512_+	DNA-binding protein	NA	E3U9I9	Vibrio_phage	100.0	6.4e-114
WP_000693566.1|109001_109340_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000743997.1|109465_110545_+	hypothetical protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_001890610.1|110522_110906_+	hypothetical protein	NA	F1CC65	Vibrio_virus	100.0	4.8e-70
WP_000493022.1|111041_111290_+	colonization factor	NA	A0A0N7F140	Vibrio_phage	100.0	8.8e-33
WP_001881237.1|111300_112584_+	hypothetical protein	NA	A0A142I701	Vibrio_phage	100.0	9.1e-222
WP_000979342.1|112580_112874_+	accessory cholera enterotoxin	NA	A0A0F6YNQ7	Vibrio_phage	100.0	3.7e-46
WP_000021616.1|112870_114070_+	zonula occludens toxin ZOT	NA	A0A142I6Z1	Vibrio_phage	100.0	5.3e-240
WP_001881225.1|114168_114945_+	cholera enterotoxin catalytic subunit CtxA	NA	A0A142I6Y0	Vibrio_phage	100.0	1.3e-151
WP_000593522.1|114941_115316_+	cholera enterotoxin binding subunit CtxB	NA	Q77DH7	Vibrio_virus	100.0	7.8e-65
WP_000693566.1|115917_116256_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_010895442.1|117437_117812_+	hypothetical protein	NA	B9V3G5	Vibrio_virus	100.0	1.2e-68
WP_000053920.1|117905_118130_+	RstC protein	NA	U5TMI6	Satellite_phage	100.0	1.1e-34
WP_000693566.1|118641_118980_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000743997.1|119105_120185_+	hypothetical protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_001890610.1|120162_120546_+	hypothetical protein	NA	F1CC65	Vibrio_virus	100.0	4.8e-70
WP_000493022.1|120681_120930_+	colonization factor	NA	A0A0N7F140	Vibrio_phage	100.0	8.8e-33
WP_001881237.1|120940_122224_+	hypothetical protein	NA	A0A142I701	Vibrio_phage	100.0	9.1e-222
WP_000979342.1|122220_122514_+	accessory cholera enterotoxin	NA	A0A0F6YNQ7	Vibrio_phage	100.0	3.7e-46
WP_000021616.1|122510_123710_+	zonula occludens toxin ZOT	NA	A0A142I6Z1	Vibrio_phage	100.0	5.3e-240
WP_001881225.1|123808_124585_+	cholera enterotoxin catalytic subunit CtxA	NA	A0A142I6Y0	Vibrio_phage	100.0	1.3e-151
WP_000593522.1|124581_124956_+	cholera enterotoxin binding subunit CtxB	NA	Q77DH7	Vibrio_virus	100.0	7.8e-65
WP_000693566.1|125557_125896_-	helix-turn-helix transcriptional regulator	NA	U5TNA1	Satellite_phage	100.0	7.3e-54
WP_000743997.1|126021_127101_+	hypothetical protein	NA	U5TQR3	Satellite_phage	100.0	2.2e-213
WP_010895442.1|127078_127453_+	hypothetical protein	NA	B9V3G5	Vibrio_virus	100.0	1.2e-68
WP_000053920.1|127546_127771_+	RstC protein	NA	U5TMI6	Satellite_phage	100.0	1.1e-34
WP_001881197.1|128138_141815_-	MARTX multifunctional-autoprocessing repeats-in-toxin holotoxin RtxA	NA	B3Y8K3	Vibrio_virus	100.0	8.4e-07
WP_001881196.1|141799_142261_-	RTX toxin-activating lysine-acyltransferase RtxC	NA	NA	NA	NA	NA
WP_000514481.1|142286_142646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149591715.1|143060_145166_+	RTX toxin T1SS ABC transporter subunit RtxB	NA	W8CYL7	Bacillus_phage	27.1	4.9e-39
>prophage 2
NZ_CP046840	Vibrio cholerae strain F9993 chromosome 1, complete sequence	3082401	883531	890724	3082401		Anguillid_herpesvirus(16.67%)	9	NA	NA
WP_001162850.1|883531_883960_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.4	1.0e-20
WP_000107237.1|884163_885453_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	34.3	1.7e-34
WP_000872176.1|885672_885867_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124187.1|885915_886254_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196560.1|886267_888118_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.1	5.3e-106
WP_001105747.1|888141_888657_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000301571.1|888705_889029_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	3.0e-25
WP_000331703.1|889089_889473_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	5.4e-53
WP_000775253.1|889509_890724_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.1e-32
>prophage 3
NZ_CP046840	Vibrio cholerae strain F9993 chromosome 1, complete sequence	3082401	1045139	1113278	3082401	protease,tRNA,integrase,transposase	Bacillus_phage(25.0%)	55	1035835:1035850	1116488:1116503
1035835:1035850	attL	TTCAGACAAAGTTGGT	NA	NA	NA	NA
WP_000627048.1|1045139_1047215_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_001167232.1|1047231_1049889_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_001090323.1|1049888_1053461_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_000605305.1|1053464_1054223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595812.1|1054219_1055389_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000687849.1|1055399_1059077_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_000645939.1|1059095_1059680_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_001080201.1|1059676_1060276_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_001153780.1|1060285_1061173_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000284109.1|1061280_1061595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000196207.1|1061668_1062577_-	DNA polymerase III subunit epsilon	NA	A0A2H4P6W5	Pseudomonas_phage	26.5	6.8e-06
WP_000182836.1|1062959_1063217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000116661.1|1063215_1063665_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	57.1	4.1e-36
WP_001883756.1|1063672_1063942_+	hypothetical protein	NA	A0A218MNF2	uncultured_virus	76.3	9.3e-28
WP_001043260.1|1066368_1067184_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1067244_1068048_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1068047_1068884_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|1068855_1069395_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|1069506_1069812_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214116.1|1069839_1071054_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	1.2e-18
WP_001447541.1|1071270_1072155_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_025989256.1|1072879_1073506_+	dCTP deaminase	NA	A0A1Y0T038	Pseudomonas_phage	48.7	1.2e-46
WP_000021290.1|1073520_1074687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356960.1|1074686_1075232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001031075.1|1075245_1075800_+	trimethoprim-resistant dihydrofolate reductase DfrA18	NA	J9PU01	Bacillus_phage	36.9	1.7e-15
WP_079993690.1|1075908_1076130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|1076160_1077654_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000985631.1|1078071_1081050_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_000348526.1|1083223_1083667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497805.1|1084131_1085106_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_001267005.1|1085108_1085378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218617.1|1085379_1086621_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A291AWU1	Escherichia_phage	39.3	3.3e-75
WP_000127614.1|1086637_1086832_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000160066.1|1087715_1089773_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.3	6.9e-14
WP_001883468.1|1089761_1090247_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000953212.1|1090207_1090615_-	DNA polymerase III subunit psi	NA	NA	NA	NA	NA
WP_001883466.1|1090725_1091277_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	32.2	1.5e-19
WP_000932672.1|1091212_1091740_-	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_001111411.1|1091972_1094027_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	NA	NA	NA	NA
WP_000421327.1|1094134_1095148_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000872504.1|1095159_1096038_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000981941.1|1096090_1097428_-	sodium-coupled multidrug efflux MATE transporter VcrM	NA	NA	NA	NA	NA
WP_001883461.1|1097474_1097894_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001883460.1|1097980_1098892_-	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_000462070.1|1099007_1101137_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000055654.1|1101499_1101769_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_000124044.1|1101910_1102849_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_001123656.1|1102848_1103247_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000192207.1|1103348_1106045_-	translation initiation factor IF-2	NA	NA	NA	NA	NA
WP_000031601.1|1106069_1107557_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000147148.1|1107575_1108031_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000495557.1|1108461_1108797_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_001281065.1|1109053_1110394_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_000913082.1|1110419_1111256_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.6	3.2e-18
WP_001883452.1|1111322_1113278_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	A0A0P0BXI2	Ostreococcus_lucimarinus_virus	44.4	2.4e-120
1116488:1116503	attR	TTCAGACAAAGTTGGT	NA	NA	NA	NA
>prophage 4
NZ_CP046840	Vibrio cholerae strain F9993 chromosome 1, complete sequence	3082401	1221809	1229072	3082401		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_001279365.1|1221809_1222697_+	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	4.1e-56
WP_001894770.1|1222964_1225553_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.0	2.2e-33
WP_000116737.1|1225645_1226653_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.2	6.0e-35
WP_000177568.1|1226726_1227662_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.7	7.8e-05
WP_000002982.1|1227661_1228288_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.1	2.0e-36
WP_001883363.1|1228280_1229072_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.6	8.4e-69
>prophage 5
NZ_CP046840	Vibrio cholerae strain F9993 chromosome 1, complete sequence	3082401	2339158	2345775	3082401		Staphylococcus_phage(66.67%)	7	NA	NA
WP_000210573.1|2339158_2340292_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.4e-64
WP_001890340.1|2340300_2341554_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	49.5	5.0e-100
WP_000543544.1|2341653_2342103_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001131994.1|2342128_2343232_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.1	1.3e-43
WP_000493874.1|2343236_2343890_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.2	1.2e-31
WP_001122865.1|2343930_2345040_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.8	6.7e-64
WP_000864130.1|2345304_2345775_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.7	6.8e-34
>prophage 6
NZ_CP046840	Vibrio cholerae strain F9993 chromosome 1, complete sequence	3082401	2400574	2466539	3082401	capsid,portal,tail,tRNA,head,terminase,integrase	Vibrio_phage(93.18%)	69	2434114:2434137	2467224:2467247
WP_000216841.1|2400574_2401999_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000731531.1|2402294_2403260_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001017843.1|2403348_2404047_-	Fe3+-citrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000279435.1|2404466_2406530_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000064348.1|2406833_2407649_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000739493.1|2415276_2416410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000759070.1|2416570_2417206_+	membrane protein	NA	NA	NA	NA	NA
WP_001881911.1|2417213_2417651_+	flagellar assembly lipoprotein FlgP	NA	NA	NA	NA	NA
WP_001881909.1|2417760_2418192_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000907265.1|2418289_2418613_-	flagellar biosynthesis anti-sigma factor FlgM	NA	NA	NA	NA	NA
WP_001881906.1|2418743_2419511_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_000145786.1|2419567_2420494_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	1.4e-35
WP_000125387.1|2420504_2421332_+	chemotaxis protein methyltransferase 1	NA	NA	NA	NA	NA
WP_001007981.1|2421551_2421947_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_000051920.1|2421951_2422368_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_000929365.1|2422385_2423093_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_000122825.1|2423121_2424426_+	flagellar hook protein FlgE	NA	NA	NA	NA	NA
WP_000373284.1|2424608_2425358_+	flagellar basal-body rod protein FlgF	NA	NA	NA	NA	NA
WP_001182097.1|2425377_2426166_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_000729679.1|2426180_2426966_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_001225051.1|2427056_2428142_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_000609516.1|2428152_2429091_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M9Y4	Brevibacillus_phage	31.9	9.5e-11
WP_000135483.1|2429270_2431145_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_000934642.1|2431157_2432351_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_001938933.1|2432448_2432610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000154827.1|2432758_2433898_+	flagellin	NA	NA	NA	NA	NA
2434114:2434137	attL	GAAAAGGGGCTTTTCTTTTTTCTG	NA	NA	NA	NA
WP_000116333.1|2434346_2435384_-|integrase	site-specific integrase	integrase	U3PIJ4	Vibrio_phage	100.0	1.5e-198
WP_000985033.1|2435383_2435797_-	hypothetical protein	NA	U3PDE6	Vibrio_phage	100.0	8.9e-70
WP_000132153.1|2435796_2436702_-	NAD-dependent DNA ligase	NA	U3PB51	Vibrio_phage	100.0	1.3e-161
WP_001881894.1|2436727_2437375_-	phage repressor protein CI	NA	A0A166YHA0	Vibrio_phage	100.0	1.1e-119
WP_000959026.1|2437520_2437733_+	hypothetical protein	NA	U3PFJ1	Vibrio_phage	100.0	6.4e-32
WP_000253093.1|2437843_2438383_+	hypothetical protein	NA	U3PIJ8	Vibrio_phage	100.0	5.5e-96
WP_001272765.1|2438395_2438830_+	hypothetical protein	NA	U3PDF0	Vibrio_phage	100.0	2.8e-74
WP_001031152.1|2438911_2439445_+	hypothetical protein	NA	U3PB56	Vibrio_phage	100.0	3.9e-86
WP_000997540.1|2439441_2439852_+	hypothetical protein	NA	U3PCE8	Vibrio_phage	100.0	1.8e-75
WP_001198814.1|2440101_2440329_+	hypothetical protein	NA	U3PIK2	Vibrio_phage	100.0	3.2e-37
WP_000099608.1|2440325_2440943_+	DNA methyltransferase	NA	U3PDF3	Vibrio_phage	100.0	1.2e-118
WP_000629095.1|2440939_2441050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000613058.1|2441046_2441631_+	hypothetical protein	NA	U3PB60	Vibrio_phage	100.0	3.2e-105
WP_001909657.1|2441627_2444213_+	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	99.9	0.0e+00
WP_000756239.1|2444222_2444759_+	DUF262 domain-containing protein	NA	U3PFK3	Vibrio_phage	100.0	4.1e-99
WP_001140408.1|2444832_2445171_-	helix-turn-helix transcriptional regulator	NA	U3PIK7	Vibrio_phage	100.0	2.8e-53
WP_001292395.1|2445408_2445654_+	hypothetical protein	NA	U3PDF9	Vibrio_phage	100.0	1.5e-37
WP_001263191.1|2445654_2445906_-	ogr/Delta-like zinc finger family protein	NA	U3PB63	Vibrio_phage	100.0	1.9e-43
WP_000729650.1|2445976_2446192_-	hypothetical protein	NA	U3PCF7	Vibrio_phage	100.0	3.1e-34
WP_001999948.1|2446175_2447222_-|portal	phage portal protein	portal	U3PFK6	Vibrio_phage	100.0	5.7e-206
WP_000331803.1|2447218_2449036_-|terminase	terminase ATPase subunit family protein	terminase	U3PIL1	Vibrio_phage	100.0	0.0e+00
WP_001127095.1|2449209_2450109_+|capsid	GPO family capsid scaffolding protein	capsid	A0A160DHM4	Vibrio_phage	100.0	4.0e-123
WP_000078361.1|2450145_2451156_+|capsid	phage major capsid protein, P2 family	capsid	U3PB67	Vibrio_phage	100.0	7.0e-193
WP_000059165.1|2451171_2451888_+|terminase	terminase endonuclease subunit	terminase	U3PCG2	Vibrio_phage	100.0	1.3e-132
WP_000493401.1|2451994_2452456_+|head	head completion/stabilization protein	head	U3PFL1	Vibrio_phage	100.0	1.5e-78
WP_000122189.1|2452452_2452941_+	hypothetical protein	NA	U3PIL4	Vibrio_phage	100.0	1.6e-89
WP_000461677.1|2452927_2453587_+	phage virion morphogenesis protein	NA	U3PDG7	Vibrio_phage	100.0	9.1e-117
WP_000312540.1|2453588_2454698_+	DUF2586 family protein	NA	U3PB71	Vibrio_phage	100.0	1.5e-209
WP_000063627.1|2454697_2455156_+	DUF2597 family protein	NA	U3PCG7	Vibrio_phage	100.0	1.3e-82
WP_000382491.1|2455170_2455380_+	TraR/DksA family transcriptional regulator	NA	U3PFL5	Vibrio_phage	100.0	2.0e-33
WP_001077689.1|2455376_2455604_+	hypothetical protein	NA	U3PIL8	Vibrio_phage	100.0	2.1e-36
WP_000705022.1|2455590_2456178_+	lysozyme	NA	U3PDH1	Vibrio_phage	100.0	2.5e-110
WP_000990572.1|2456152_2456494_+	hypothetical protein	NA	U3PB75	Vibrio_phage	100.0	1.1e-52
WP_000165786.1|2456701_2456983_+	hypothetical protein	NA	A9ZT39	Vibrio_virus	100.0	5.1e-45
WP_000343647.1|2457179_2458997_+|tail	phage tail tape measure protein	tail	U3PFL8	Vibrio_phage	100.0	0.0e+00
WP_001113003.1|2458986_2459319_+	DUF2590 family protein	NA	U3PIM1	Vibrio_phage	100.0	1.7e-55
WP_000044509.1|2459315_2460515_+	hypothetical protein	NA	U3PDH5	Vibrio_phage	100.0	1.0e-222
WP_000005870.1|2460511_2461171_+	hypothetical protein	NA	U3PB79	Vibrio_phage	100.0	8.2e-126
WP_000083759.1|2461167_2463030_+|tail	phage tail protein	tail	Q8HA58	Vibrio_phage	100.0	0.0e+00
WP_000369865.1|2463029_2463554_+	hypothetical protein	NA	U3PFM2	Vibrio_phage	100.0	1.1e-96
WP_000267787.1|2463556_2464450_+	hypothetical protein	NA	U3PIM3	Vibrio_phage	100.0	2.8e-161
WP_000457681.1|2464437_2464911_+	hypothetical protein	NA	U3PDI0	Vibrio_phage	100.0	6.6e-77
WP_000779002.1|2464907_2466539_+	hypothetical protein	NA	U3PB83	Vibrio_phage	100.0	0.0e+00
2467224:2467247	attR	GAAAAGGGGCTTTTCTTTTTTCTG	NA	NA	NA	NA
