The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	0	1890	2443663		Indivirus(100.0%)	2	NA	NA
WP_001830968.1|360_1008_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_001831097.1|1014_1890_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.1	2.4e-16
>prophage 2
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	6715	8323	2443663		Klosneuvirus(100.0%)	1	NA	NA
WP_001830940.1|6715_8323_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.5	9.5e-51
>prophage 3
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	15932	23229	2443663	lysis,protease	Yellowstone_lake_phycodnavirus(25.0%)	10	NA	NA
WP_002439697.1|15932_17198_+	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	24.0	1.3e-10
WP_002439699.1|17329_18079_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002470646.1|18087_18960_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.7	4.0e-27
WP_002439702.1|18937_19348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158171488.1|19353_19935_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001831260.1|20292_20493_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	2.5e-17
WP_002439708.1|20673_20982_-	DUF1033 family protein	NA	NA	NA	NA	NA
WP_001831190.1|21140_21410_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002476740.1|21449_22076_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_002485276.1|22098_23229_+	TelA-like protein	NA	A0A291I9K4	Lactobacillus_phage	25.8	9.4e-29
>prophage 4
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	26736	27528	2443663		Halovirus(100.0%)	1	NA	NA
WP_002469511.1|26736_27528_-	MoxR family ATPase	NA	R4TG24	Halovirus	28.9	3.1e-10
>prophage 5
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	35146	50717	2443663	transposase	Staphylococcus_phage(37.5%)	21	NA	NA
WP_001830971.1|35146_35806_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.0	8.7e-35
WP_080034937.1|35978_36089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104832469.1|36461_37640_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	9.7e-61
WP_002486216.1|38047_38662_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002467698.1|38674_39748_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_002494459.1|39765_40269_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080034938.1|40304_40421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001831212.1|40604_42080_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.3	2.4e-24
WP_002494460.1|42424_42649_-	YozE family protein	NA	NA	NA	NA	NA
WP_158171489.1|42648_43149_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002439748.1|43161_43590_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002489428.1|43582_44110_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002470634.1|44212_45061_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	99.2	7.9e-65
WP_001830952.1|45070_45556_-	trimethoprim-resistant dihydrofolate reductase DfrC	NA	A0A0N9S8H6	Staphylococcus_phage	98.1	9.1e-90
WP_000282655.1|45597_46554_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	100.0	1.1e-190
WP_002439753.1|46867_47530_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	1.6e-28
WP_002439754.1|47545_48595_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002457670.1|48806_49244_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_047500344.1|49295_49556_-	scaffolding protein	NA	NA	NA	NA	NA
WP_002439757.1|49567_49762_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001831106.1|50012_50717_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	26.0	8.4e-12
>prophage 6
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	90044	91925	2443663		Bacillus_phage(100.0%)	3	NA	NA
WP_001831285.1|90044_90611_-	DUF1273 domain-containing protein	NA	U5J9F7	Bacillus_phage	22.5	1.2e-05
WP_158171490.1|90622_90955_-	DUF1798 family protein	NA	NA	NA	NA	NA
WP_002476769.1|91298_91925_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	34.3	5.0e-24
>prophage 7
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	95328	102414	2443663	tRNA	Temperate_phage(25.0%)	5	NA	NA
WP_001831014.1|95328_96015_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	36.5	1.5e-08
WP_002439780.1|96107_97400_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	3.5e-56
WP_001831318.1|97520_100229_-	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	31.5	1.1e-43
WP_001831050.1|100253_101225_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_001831104.1|101211_102414_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	40.3	2.1e-34
>prophage 8
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	111285	114874	2443663		Anguillid_herpesvirus(33.33%)	5	NA	NA
WP_002456508.1|111285_111765_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.1	4.0e-29
WP_011082690.1|111874_112894_-	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	26.4	3.2e-12
WP_001831089.1|112835_113561_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001831003.1|113553_114132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043863.1|114601_114874_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
>prophage 9
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	123815	136334	2443663		Bacillus_phage(42.86%)	15	NA	NA
WP_001831100.1|123815_125195_-	ATP-dependent DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	33.5	1.3e-56
WP_001831191.1|125181_126144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001831262.1|126252_126501_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	52.0	6.8e-17
WP_002439978.1|126592_126697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001830988.1|126905_127445_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_001831150.1|128036_129803_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	33.7	1.2e-33
WP_001831066.1|129786_130512_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.2	8.3e-47
WP_001830978.1|130645_131383_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_001830975.1|131375_131918_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.5	2.3e-09
WP_023567498.1|131910_132711_-	segregation protein A	NA	NA	NA	NA	NA
WP_001831156.1|132739_133264_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_001831286.1|133316_134204_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.8	1.3e-38
WP_001831103.1|134246_134696_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_001831173.1|134800_135343_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_001831310.1|135425_136334_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	33.9	2.6e-05
>prophage 10
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	139684	141169	2443663		Cyanophage(100.0%)	1	NA	NA
WP_001831167.1|139684_141169_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.4	6.9e-80
>prophage 11
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	144338	145745	2443663		Synechococcus_phage(100.0%)	1	NA	NA
WP_002440000.1|144338_145745_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	29.8	2.2e-27
>prophage 12
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	152279	162906	2443663		Klosneuvirus(50.0%)	11	NA	NA
WP_001830939.1|152279_153701_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	1.7e-40
WP_001830981.1|153960_155637_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002456185.1|155652_156105_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002456496.1|156419_157301_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	27.6	1.5e-10
WP_001830935.1|157278_157509_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_001831186.1|157501_158839_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SIT1	Klosneuvirus	36.0	6.0e-43
WP_001831090.1|158853_159243_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_002456495.1|159318_159681_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002440022.1|159692_161051_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_001831211.1|161050_161518_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_001831058.1|161775_162906_-	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	8.2e-25
>prophage 13
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	170905	173753	2443663		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_001831087.1|170905_172414_-	glycine dehydrogenase subunit 2	NA	E3ST28	Prochlorococcus_phage	41.8	1.8e-80
WP_002456181.1|172406_173753_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	37.8	5.3e-63
>prophage 14
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	179285	179909	2443663		Streptococcus_phage(100.0%)	1	NA	NA
WP_001831016.1|179285_179909_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	39.3	7.7e-33
>prophage 15
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	186344	200403	2443663	tRNA	Bacillus_thuringiensis_phage(14.29%)	13	NA	NA
WP_001831217.1|186344_186944_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	55.2	2.4e-60
WP_001831164.1|187356_187776_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_049324132.1|187778_188627_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_011082700.1|188660_189452_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	7.7e-22
WP_002456488.1|189660_190551_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.2	2.3e-22
WP_001832762.1|190560_191907_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	33.7	2.9e-53
WP_001831093.1|191941_193042_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002486240.1|193031_193721_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002440071.1|193875_194982_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	37.6	1.1e-37
WP_049324130.1|195252_197049_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.8	3.9e-53
WP_001831146.1|197222_198041_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_010959185.1|198052_198676_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002456487.1|199011_200403_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	29.0	3.2e-47
>prophage 16
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	203448	204396	2443663		Erwinia_phage(100.0%)	1	NA	NA
WP_001831049.1|203448_204396_-	PhoH family protein	NA	W8D063	Erwinia_phage	49.0	8.9e-49
>prophage 17
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	211289	214385	2443663		Catovirus(50.0%)	2	NA	NA
WP_001830934.1|211289_212411_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.2	1.4e-29
WP_001831007.1|212555_214385_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.7	3.6e-139
>prophage 18
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	217421	223607	2443663		Streptococcus_phage(33.33%)	5	NA	NA
WP_001831284.1|217421_219245_-	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	23.5	2.6e-20
WP_001831221.1|219537_219789_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_049324129.1|219906_220881_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_049324128.1|220925_223142_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	30.4	9.1e-28
WP_002440103.1|223145_223607_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.2	2.3e-34
>prophage 19
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	236358	273350	2443663	transposase,tRNA	uncultured_Mediterranean_phage(23.53%)	31	NA	NA
WP_001832700.1|236358_236841_-|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	6.4e-19
WP_001830881.1|237138_237615_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_001830824.1|237645_238269_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.5	8.2e-35
WP_001830748.1|238268_239537_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.9	5.2e-36
WP_049324088.1|239554_240478_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_001830827.1|240480_241116_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	29.3	7.4e-07
WP_001830855.1|241544_241853_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_001830837.1|241867_242296_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001830883.1|242297_242558_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_001830814.1|242621_245252_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.2	6.7e-62
WP_001830904.1|245580_248013_-	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	26.6	1.1e-47
WP_001832695.1|248014_248683_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001830892.1|248845_249964_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001830848.1|249963_251106_-	cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	28.0	1.5e-26
WP_001830781.1|251348_252344_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001830746.1|252543_252687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001830806.1|252872_253295_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_002456478.1|253371_254652_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	51.1	2.4e-105
WP_001830777.1|254845_255622_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_001830852.1|256235_258002_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	22.4	3.4e-17
WP_001830876.1|258004_259279_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001830843.1|259650_260526_-	SH3 domain-containing protein	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	6.2e-12
WP_001830766.1|260522_260975_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001832683.1|260988_263178_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	38.0	4.1e-12
WP_001832698.1|263698_264217_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	2.1e-28
WP_158171492.1|264235_266509_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.6	1.3e-66
WP_001830863.1|267252_269544_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	36.6	7.0e-31
WP_001830800.1|269882_270143_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	44.3	5.7e-06
WP_001830840.1|270158_271298_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.3e-83
WP_002456475.1|271318_272383_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001830787.1|272345_273350_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 20
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	282665	285296	2443663	tRNA	Catovirus(100.0%)	1	NA	NA
WP_001830862.1|282665_285296_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.9	7.5e-154
>prophage 21
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	294795	306288	2443663	protease,tRNA	Bacillus_virus(20.0%)	10	NA	NA
WP_001830765.1|294795_296058_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	7.7e-141
WP_001830810.1|296344_297646_-	trigger factor	NA	NA	NA	NA	NA
WP_001830807.1|297806_298730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001830874.1|298746_299358_-	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	34.4	8.1e-19
WP_001830839.1|299775_300132_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001830767.1|300183_300384_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001830789.1|300411_300939_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.8	1.4e-11
WP_001830900.1|301146_302649_-	amino acid permease	NA	NA	NA	NA	NA
WP_002440177.1|303077_305015_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.7	2.3e-115
WP_001830772.1|305367_306288_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	31.2	3.4e-29
>prophage 22
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	311143	318948	2443663		Bacillus_virus(20.0%)	5	NA	NA
WP_158171493.1|311143_312016_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	38.9	1.0e-43
WP_002440182.1|312031_314662_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.4	1.0e-46
WP_001830867.1|314956_316654_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	36.7	6.1e-32
WP_001830897.1|316653_317364_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	29.5	1.4e-06
WP_158171494.1|317679_318948_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	55.6	9.2e-09
>prophage 23
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	322260	324018	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001830831.1|322260_324018_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	84.4	2.7e-35
>prophage 24
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	328620	331818	2443663		Streptomyces_phage(100.0%)	1	NA	NA
WP_047500445.1|328620_331818_-	DNA polymerase III subunit alpha	NA	A0A0K1Y9G6	Streptomyces_phage	29.9	7.0e-130
>prophage 25
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	339061	339217	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047500450.1|339061_339217_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	79.6	1.2e-14
>prophage 26
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	349455	353595	2443663		Only_Syngen_Nebraska_virus(50.0%)	4	NA	NA
WP_001832720.1|349455_350202_-	glycerophosphoryl diester phosphodiesterase	NA	A0A1J0F961	Only_Syngen_Nebraska_virus	31.6	2.6e-19
WP_001830816.1|350279_350720_+	SACOL1771 family peroxiredoxin	NA	NA	NA	NA	NA
WP_001830752.1|350846_352010_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_001830903.1|351999_353595_+	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	63.6	8.7e-73
>prophage 27
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	357479	360174	2443663	protease,tRNA	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_002456457.1|357479_358718_+|protease	serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	27.9	2.4e-09
WP_001830858.1|358908_360174_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	9.6e-83
>prophage 28
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	369631	374635	2443663		Mycobacterium_phage(50.0%)	3	NA	NA
WP_002456455.1|369631_373141_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	46.4	1.0e-81
WP_001830779.1|373161_373758_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_001832670.1|373780_374635_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	85.4	2.8e-62
>prophage 29
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	384213	434108	2443663	transposase,integrase,tRNA	Staphylococcus_phage(81.82%)	42	377080:377096	436917:436933
377080:377096	attL	TACTCATTAAGCTCAAT	NA	NA	NA	NA
WP_001830813.1|384213_385476_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	76.0	1.8e-41
WP_049324023.1|385847_396926_-	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	25.5	4.6e-27
WP_001830891.1|397330_397642_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	71.8	4.1e-35
WP_002493961.1|397667_400082_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	87.4	0.0e+00
WP_002456450.1|400373_401588_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	83.5	3.0e-182
WP_002456449.1|401694_402648_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	84.0	9.5e-67
WP_002456448.1|402644_403208_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	65.9	6.2e-66
WP_001830809.1|403441_403843_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001830886.1|404332_405160_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002456447.1|405403_406405_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	70.0	1.5e-131
WP_002456446.1|406661_407123_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	84.2	1.2e-59
WP_002456445.1|407135_408317_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	76.1	2.5e-178
WP_002467848.1|408329_408962_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	77.6	1.1e-87
WP_002469499.1|408968_410012_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	66.8	8.9e-135
WP_077755929.1|410448_411942_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	65.6	2.5e-13
WP_001830727.1|412280_413132_-	autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	35.6	1.0e-32
WP_002456441.1|413509_413725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010959195.1|413757_413877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002456440.1|413932_414412_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	42.3	3.5e-25
WP_001830734.1|414417_414861_+	competence protein ComK	NA	NA	NA	NA	NA
WP_002456439.1|414847_415291_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	42.2	9.0e-20
WP_001830731.1|415430_416144_-	transaldolase	NA	M1PR54	Cyanophage	37.4	4.1e-22
WP_002446728.1|416420_416729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001830726.1|416765_417131_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	57.0	4.1e-34
WP_001830729.1|417127_417481_+	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	32.5	8.5e-05
WP_104832439.1|418000_419179_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.0	3.7e-60
WP_002469577.1|419408_419564_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	79.6	5.2e-15
WP_002456435.1|419848_420685_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	68.6	6.1e-110
WP_002456434.1|420864_421773_-	hypothetical protein	NA	A0A2H4PQQ8	Staphylococcus_phage	80.6	1.8e-102
WP_002469576.1|421875_423075_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	85.1	9.2e-192
WP_002469572.1|423444_425037_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	83.6	1.6e-268
WP_002456431.1|425267_426053_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	71.3	2.0e-99
WP_010959198.1|426039_426516_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	58.1	3.3e-44
WP_001829824.1|426574_426826_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	81.9	1.9e-35
WP_002456429.1|427812_429237_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	63.9	6.6e-173
WP_002456428.1|430246_430393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002456427.1|430487_431153_+	hypothetical protein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	41.8	7.0e-08
WP_002456426.1|431314_431602_+	hypothetical protein	NA	A0A2H4JGN1	uncultured_Caudovirales_phage	50.0	5.5e-18
WP_002456425.1|431891_432047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002456424.1|432128_432863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002456423.1|433242_433455_-	hypothetical protein	NA	A0A2H4JCA1	uncultured_Caudovirales_phage	72.9	7.3e-20
WP_002456422.1|433613_434108_+|integrase	site-specific integrase	integrase	B7T092	Staphylococcus_virus	76.1	3.8e-67
436917:436933	attR	TACTCATTAAGCTCAAT	NA	NA	NA	NA
>prophage 30
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	442914	443655	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001829855.1|442914_443655_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.0e-25
>prophage 31
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	452322	455410	2443663		Streptococcus_phage(50.0%)	4	NA	NA
WP_001829805.1|452322_452667_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	30.6	5.8e-06
WP_002485606.1|452739_453870_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_001829807.1|454051_454516_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001829810.1|454786_455410_-	response regulator transcription factor	NA	A0A1V0SGR9	Hokovirus	28.2	5.2e-05
>prophage 32
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	462776	467972	2443663	protease	Staphylococcus_phage(66.67%)	5	NA	NA
WP_001829854.1|462776_462932_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	75.0	2.2e-13
WP_002470779.1|463428_464157_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.5	2.8e-34
WP_002440300.1|464143_465601_-	ABC transporter substrate-binding protein/permease	NA	NA	NA	NA	NA
WP_002456347.1|465839_466898_-	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_001829860.1|467123_467972_-|protease	serine protease	protease	A0A2H4PQN3	Staphylococcus_phage	31.9	3.5e-20
>prophage 33
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	481367	485038	2443663		Bacillus_phage(50.0%)	3	NA	NA
WP_001830383.1|481367_483104_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.4	7.3e-49
WP_001830384.1|483345_483888_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_002484898.1|483994_485038_-	A/G-specific adenine glycosylase	NA	G3CB03	Aeropyrum_pernix_spindle-shaped_virus	28.9	2.1e-22
>prophage 34
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	498292	498922	2443663		Bacillus_phage(100.0%)	1	NA	NA
WP_001830439.1|498292_498922_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	27.4	1.1e-05
>prophage 35
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	507208	512260	2443663		Staphylococcus_phage(33.33%)	5	NA	NA
WP_001830405.1|507208_507763_+	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	42.0	2.3e-33
WP_001830390.1|507793_508864_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011082746.1|509173_509722_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_023567462.1|509859_511278_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	41.6	1.0e-101
WP_002484891.1|511309_512260_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.1	1.8e-17
>prophage 36
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	519149	529639	2443663		Bacillus_virus(40.0%)	9	NA	NA
WP_002484896.1|519149_521147_-	NAD-dependent DNA ligase LigA	NA	A0A0A8J9A9	Ralstonia_phage	37.3	1.2e-111
WP_002457083.1|521150_523340_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.1	1.0e-132
WP_001830396.1|523336_524029_-	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_001830443.1|524352_524655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002440416.1|524779_526075_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	2.1e-16
WP_011082748.1|526486_526678_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_001830398.1|526649_527276_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_001832476.1|527349_528177_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	51.2	1.2e-62
WP_001830368.1|528169_529639_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.2	4.1e-109
>prophage 37
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	540476	542046	2443663		Salmonella_phage(50.0%)	2	NA	NA
WP_000733622.1|540476_541322_+	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	33.9	4.4e-31
WP_001798151.1|541626_542046_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	53.5	3.1e-30
>prophage 38
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	545903	547055	2443663	integrase	Streptococcus_pyogenes_phage(100.0%)	1	539441:539455	547623:547637
539441:539455	attL	AATTAATTTTGACTG	NA	NA	NA	NA
WP_080052711.1|545903_547055_-|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	31.6	1.8e-11
WP_080052711.1|545903_547055_-|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	31.6	1.8e-11
547623:547637	attR	AATTAATTTTGACTG	NA	NA	NA	NA
>prophage 39
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	552811	555259	2443663		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001830444.1|552811_553684_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	34.3	1.7e-25
WP_002457073.1|553704_554364_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_002457072.1|554344_555259_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	1.2e-18
>prophage 40
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	559698	561658	2443663		uncultured_virus(100.0%)	2	NA	NA
WP_001830447.1|559698_561318_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.0	4.4e-157
WP_001830378.1|561373_561658_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	43.0	1.5e-12
>prophage 41
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	568047	573868	2443663		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_001829999.1|568047_568764_+	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	33.9	1.1e-27
WP_002468351.1|568831_569791_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_077755919.1|569797_571270_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.9	4.6e-20
WP_010959213.1|571435_571528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002457062.1|571529_572483_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_001830014.1|572617_573868_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.7	4.3e-35
>prophage 42
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	577111	582109	2443663	tRNA	Bodo_saltans_virus(33.33%)	3	NA	NA
WP_010959251.1|577111_579046_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	27.2	2.4e-48
WP_010959252.1|579387_581004_+	AAA family ATPase	NA	A0A1B1IS82	uncultured_Mediterranean_phage	26.2	3.7e-18
WP_001830015.1|581086_582109_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.9	4.4e-62
>prophage 43
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	585790	590454	2443663		Yellowstone_lake_phycodnavirus(50.0%)	4	NA	NA
WP_158171497.1|585790_587542_+	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.9	2.5e-65
WP_001830009.1|587541_587775_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_001830020.1|587891_588896_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_158171498.1|588918_590454_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	29.5	5.7e-13
>prophage 44
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	603935	607296	2443663		Bacillus_phage(50.0%)	5	NA	NA
WP_002440602.1|603935_604706_-	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.7	4.1e-20
WP_001829903.1|604680_605160_-	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001829952.1|605161_605488_-	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001829902.1|605587_606589_-	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001829891.1|606933_607296_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	33.6	6.5e-08
>prophage 45
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	611888	613418	2443663		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_002457112.1|611888_613418_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.2	9.9e-58
>prophage 46
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	620487	621141	2443663		Moumouvirus(100.0%)	1	NA	NA
WP_001829983.1|620487_621141_+	HD domain-containing protein	NA	H2ED17	Moumouvirus	30.6	1.0e-11
>prophage 47
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	626467	626863	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001829977.1|626467_626863_-	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	32.7	1.6e-12
>prophage 48
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	637046	644892	2443663		Catovirus(25.0%)	10	NA	NA
WP_002495575.1|637046_638195_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.8	2.6e-26
WP_001829916.1|638216_638846_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002468313.1|638874_640113_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.0	1.8e-102
WP_002484530.1|640137_640662_-	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_002457126.1|640771_641191_-	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_001829923.1|641187_642231_-	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	37.9	7.3e-44
WP_002474604.1|642206_642344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002440566.1|642393_643230_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001829940.1|643216_644293_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_001829979.1|644292_644892_-	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.4	4.3e-33
>prophage 49
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	652475	654083	2443663		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001829895.1|652475_654083_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	4.4e-149
>prophage 50
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	662859	666343	2443663		Geobacillus_virus(50.0%)	4	NA	NA
WP_002440546.1|662859_664161_-	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.6	1.2e-133
WP_002495579.1|664193_664856_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_002440540.1|665062_665773_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_002484525.1|665896_666343_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	46.0	5.7e-30
>prophage 51
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	671703	672675	2443663		Indivirus(100.0%)	1	NA	NA
WP_011082760.1|671703_672675_+	CDF family zinc efflux transporter CzrB	NA	A0A1V0SED0	Indivirus	27.3	3.5e-24
>prophage 52
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	676607	678413	2443663		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_001829889.1|676607_678413_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	40.3	1.7e-101
>prophage 53
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	698591	699557	2443663		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001829779.1|698591_699557_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	29.3	2.9e-15
>prophage 54
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	720466	732294	2443663	integrase,terminase	Staphylococcus_phage(42.86%)	16	717614:717638	732296:732320
717614:717638	attL	AATAACGTATTCAAAACGTATTCAA	NA	NA	NA	NA
WP_012085746.1|720466_721117_-	hypothetical protein	NA	Q0H269	Geobacillus_phage	37.4	2.4e-21
WP_064206533.1|721289_721784_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	64.4	8.2e-54
WP_064601113.1|721843_722530_-	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	30.8	6.9e-27
WP_064206596.1|722549_723083_-	hypothetical protein	NA	A0A2H4JD56	uncultured_Caudovirales_phage	31.2	6.4e-12
WP_064206597.1|723095_723434_-	hypothetical protein	NA	A0A1W6JQF3	Staphylococcus_phage	59.4	5.1e-31
WP_064206137.1|723772_724414_-	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	78.9	9.5e-95
WP_002489657.1|724415_724679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032604072.1|724675_725023_-	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	76.5	3.6e-40
WP_002489660.1|725295_727548_-	DNA primase	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	72.1	0.0e+00
WP_002489659.1|727642_727942_-	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	84.8	3.1e-32
WP_002489663.1|727941_728499_-	hypothetical protein	NA	A0A1W6JPA6	Staphylococcus_phage	66.2	7.4e-19
WP_002489654.1|728675_728945_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002489671.1|728947_729166_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	50.8	1.0e-08
WP_002489665.1|729350_730022_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JH10	uncultured_Caudovirales_phage	36.8	2.0e-26
WP_002489655.1|730451_731012_+	hypothetical protein	NA	I6TJR6	Staphylococcus_virus	94.9	2.0e-24
WP_064206138.1|731157_732294_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	41.7	3.6e-73
732296:732320	attR	AATAACGTATTCAAAACGTATTCAA	NA	NA	NA	NA
>prophage 55
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	737202	742584	2443663	tRNA	Orpheovirus(33.33%)	7	NA	NA
WP_001829706.1|737202_737943_+	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.8	1.8e-17
WP_095694446.1|738204_738603_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002469355.1|738616_739054_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002456990.1|739314_740118_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002456989.1|740121_740928_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_002456988.1|740917_741778_-	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	22.1	4.3e-10
WP_002469356.1|741774_742584_-	energy-coupling factor transporter ATPase	NA	G3M9Y6	Bacillus_virus	27.0	4.2e-15
>prophage 56
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	757644	758979	2443663		Moraxella_phage(100.0%)	1	NA	NA
WP_001829757.1|757644_758979_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.2	8.7e-50
>prophage 57
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	765274	768430	2443663		Leptospira_phage(100.0%)	1	NA	NA
WP_001829753.1|765274_768430_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	1.4e-66
>prophage 58
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	773618	774797	2443663	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_104832469.1|773618_774797_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	9.7e-61
>prophage 59
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	782165	782786	2443663		Bacillus_virus(100.0%)	1	NA	NA
WP_002438505.1|782165_782786_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	36.1	7.9e-22
>prophage 60
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	806707	810085	2443663		Catovirus(50.0%)	3	NA	NA
WP_001832639.1|806707_807661_+	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	31.0	1.2e-32
WP_002438467.1|807801_808926_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_001832638.1|809308_810085_-	autolysin	NA	H9A0W8	Staphylococcus_phage	39.4	8.4e-37
>prophage 61
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	827291	828855	2443663	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_104832459.1|827291_828470_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	3.3e-61
WP_002477532.1|828699_828855_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	79.6	8.8e-15
>prophage 62
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	833077	833959	2443663		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_002456633.1|833077_833959_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.2	4.4e-58
>prophage 63
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	857692	858901	2443663		Salmonella_phage(100.0%)	1	NA	NA
WP_158171503.1|857692_858901_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	27.0	2.2e-31
>prophage 64
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	862506	865033	2443663		Planktothrix_phage(50.0%)	3	NA	NA
WP_001831526.1|862506_863175_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	4.2e-37
WP_001831464.1|863174_864227_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001831555.1|864358_865033_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	47.9	2.2e-54
>prophage 65
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	874222	876388	2443663		Catovirus(100.0%)	1	NA	NA
WP_001831435.1|874222_876388_-	bifunctional glycosyltransferase family 2 protein/CDP-glycerol:glycerophosphate glycerophosphotransferase	NA	A0A1V0SAH6	Catovirus	38.7	4.3e-06
>prophage 66
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	898380	899934	2443663		Escherichia_phage(100.0%)	1	NA	NA
WP_002438317.1|898380_899934_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 67
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	910596	910752	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001831613.1|910596_910752_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	71.4	1.3e-10
>prophage 68
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	916687	917715	2443663		Staphylococcus_phage(50.0%)	2	NA	NA
WP_002477074.1|916687_916843_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	75.5	2.6e-14
WP_002502566.1|916983_917715_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.7e-23
>prophage 69
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	924002	925154	2443663		Streptococcus_phage(100.0%)	1	NA	NA
WP_001831597.1|924002_925154_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.8	3.7e-49
>prophage 70
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	933093	934611	2443663		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001831582.1|933093_934611_+	serine hydrolase FLP	NA	A0A2P1K0A5	Mycobacterium_phage	23.0	6.1e-07
>prophage 71
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	938910	978891	2443663	transposase,holin,protease	Bacillus_phage(22.22%)	33	NA	NA
WP_001831559.1|938910_940686_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.9	2.6e-65
WP_002438253.1|940666_941425_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_002456655.1|941559_942018_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_002438249.1|942021_942723_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_002456656.1|942904_943600_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002456657.1|943599_944493_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001831629.1|944560_945196_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001831407.1|945198_946455_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	53.8	2.7e-21
WP_002438246.1|946944_947997_+	2,3-butanediol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	21.2	3.4e-09
WP_002438244.1|948596_950276_+	APC family permease	NA	NA	NA	NA	NA
WP_079993657.1|950580_951948_+	carboxylesterase/lipase family protein	NA	NA	NA	NA	NA
WP_002456659.1|952030_953209_-	MFS transporter	NA	NA	NA	NA	NA
WP_002469550.1|953347_954124_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_002438239.1|954116_954788_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	36.0	2.0e-18
WP_071813272.1|955074_955341_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002456661.1|955385_956204_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002456662.1|956312_957890_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_002456663.1|957942_958410_-	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
WP_002456664.1|958593_959670_+	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_002456665.1|959686_959875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002438224.1|960037_960856_-	SDR family oxidoreductase	NA	A0A0G2Y924	Acanthamoeba_polyphaga_mimivirus	35.1	1.5e-07
WP_002456666.1|961168_962701_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002456043.1|962763_964929_+	RNA degradosome polyphosphate kinase	NA	NA	NA	NA	NA
WP_002438217.1|965095_966352_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_002456667.1|966440_967133_-	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	27.6	9.2e-11
WP_002456668.1|967471_967621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001831457.1|967902_968094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002469554.1|968244_971103_-	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	26.3	1.6e-24
WP_079993659.1|971104_971512_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001105987.1|972970_973645_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.6	6.8e-128
WP_158171506.1|973682_974858_-	plasmid recombination enzyme	NA	NA	NA	NA	NA
WP_000492283.1|975043_976423_-	tetracycline efflux MFS transporter Tet(K)	NA	NA	NA	NA	NA
WP_001105987.1|978216_978891_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.6	6.8e-128
>prophage 72
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	985783	986545	2443663		Cedratvirus(100.0%)	1	NA	NA
WP_001833013.1|985783_986545_-	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.7	1.2e-19
>prophage 73
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	990515	1001106	2443663		Acanthamoeba_polyphaga_mimivirus(20.0%)	10	NA	NA
WP_002438830.1|990515_991565_-	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	23.3	4.9e-16
WP_001832177.1|991843_992911_-	membrane protein	NA	NA	NA	NA	NA
WP_001832127.1|993135_993636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001832050.1|993955_994753_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	31.2	9.2e-15
WP_001832123.1|995111_995945_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.3	1.3e-43
WP_002493541.1|996481_997711_-	nucleoside permease	NA	NA	NA	NA	NA
WP_001832157.1|997996_999724_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	40.4	9.7e-102
WP_002438823.1|1000217_1000367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002438821.1|1000455_1000566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001833002.1|1000707_1001106_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	2.9e-17
>prophage 74
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1008342	1009089	2443663		Indivirus(100.0%)	1	NA	NA
WP_001832084.1|1008342_1009089_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	32.7	4.4e-11
>prophage 75
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1024630	1025407	2443663		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001832174.1|1024630_1025407_-	alpha/beta hydrolase	NA	A0A1D8EVD1	Mycobacterium_phage	28.2	8.4e-05
>prophage 76
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1036147	1037170	2443663		Tupanvirus(100.0%)	1	NA	NA
WP_002438761.1|1036147_1037170_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.9	5.5e-36
>prophage 77
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1042199	1047535	2443663		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_002438750.1|1042199_1043498_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	30.9	5.5e-25
WP_002438748.1|1043589_1044066_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002484561.1|1044682_1045621_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002468721.1|1045776_1046199_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011082607.1|1046167_1047535_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	1.4e-106
>prophage 78
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1056959	1060287	2443663		Staphylococcus_phage(50.0%)	5	NA	NA
WP_002470762.1|1056959_1057115_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	83.7	3.6e-16
WP_001832531.1|1057268_1058759_-	APC family permease	NA	NA	NA	NA	NA
WP_002494334.1|1058874_1059243_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_002498044.1|1059267_1059636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002456854.1|1059636_1060287_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	43.4	4.7e-41
>prophage 79
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1072299	1073252	2443663		Staphylococcus_phage(100.0%)	3	NA	NA
WP_011082600.1|1072299_1072476_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	58.2	4.1e-08
WP_158171545.1|1072503_1073052_+	hypothetical protein	NA	A0A2H4PQU3	Staphylococcus_phage	71.7	3.8e-68
WP_107506572.1|1073051_1073252_+	protein-tyrosine-phosphatase	NA	A0A2H4PQT9	Staphylococcus_phage	72.3	2.1e-21
>prophage 80
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1081950	1082613	2443663		Enterococcus_phage(100.0%)	1	NA	NA
WP_001832291.1|1081950_1082613_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	33.9	2.3e-19
>prophage 81
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1093004	1093955	2443663		Klosneuvirus(100.0%)	1	NA	NA
WP_002438698.1|1093004_1093955_-	ornithine cyclodeaminase family protein	NA	A0A1V0SL93	Klosneuvirus	29.4	3.1e-17
>prophage 82
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1097986	1109127	2443663		Streptococcus_phage(33.33%)	6	NA	NA
WP_158171509.1|1097986_1100068_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.6	3.8e-68
WP_001137495.1|1100187_1100658_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001833079.1|1100728_1101142_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001832275.1|1101232_1101493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002467908.1|1101820_1105444_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.7	6.2e-66
WP_001833083.1|1105575_1109127_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	8.0e-50
>prophage 83
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1112985	1117774	2443663	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001832303.1|1112985_1113534_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	32.9	6.6e-12
WP_002438679.1|1113544_1113727_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001832285.1|1113789_1113933_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002445734.1|1114056_1114632_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_001832317.1|1114701_1115229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002445733.1|1115225_1115993_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_002445732.1|1115982_1116381_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_002445731.1|1116373_1117774_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.6	1.2e-57
>prophage 84
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1123600	1126054	2443663	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_001832300.1|1123600_1126054_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	41.2	1.6e-134
>prophage 85
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1129756	1134274	2443663	transposase	Streptococcus_phage(100.0%)	4	NA	NA
WP_158171546.1|1129756_1130935_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.0	2.8e-60
WP_011082818.1|1131365_1131923_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_001830030.1|1131925_1132813_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_002469332.1|1132909_1134274_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.7	9.9e-17
>prophage 86
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1146116	1155198	2443663	tRNA	Tupanvirus(20.0%)	8	NA	NA
WP_001833056.1|1146116_1147604_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.8	5.8e-95
WP_001832213.1|1147939_1148419_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001832204.1|1148419_1148785_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_002457105.1|1148762_1149581_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.5	6.8e-21
WP_001832242.1|1149876_1150809_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	63.9	3.2e-107
WP_001832190.1|1151145_1152027_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001832199.1|1152281_1154384_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	H8ZJI5	Ostreococcus_tauri_virus	48.8	4.9e-108
WP_001832216.1|1154658_1155198_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	1.0e-12
>prophage 87
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1165831	1168296	2443663		Hokovirus(50.0%)	2	NA	NA
WP_001832233.1|1165831_1166797_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	36.7	2.6e-48
WP_001832214.1|1166940_1168296_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	31.4	4.4e-25
>prophage 88
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1174559	1182018	2443663	tRNA	Streptococcus_phage(50.0%)	9	NA	NA
WP_002457101.1|1174559_1176530_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.1	3.4e-95
WP_001832235.1|1176739_1177579_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.8	6.0e-57
WP_001832208.1|1177580_1177829_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_002457100.1|1177821_1178547_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_001832238.1|1178642_1178990_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_001832240.1|1179006_1179810_-	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_001832202.1|1179811_1180738_-	DNA polymerase III subunit delta'	NA	A0A292GC45	Xanthomonas_phage	31.9	1.8e-06
WP_001832200.1|1181043_1181373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001832211.1|1181406_1182018_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	4.1e-47
>prophage 89
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1191105	1192812	2443663		Streptococcus_virus(100.0%)	1	NA	NA
WP_001829412.1|1191105_1192812_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	41.2	1.1e-54
>prophage 90
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1209183	1215577	2443663		Oenococcus_phage(33.33%)	6	NA	NA
WP_001829380.1|1209183_1210158_-	autolysin/adhesin Aae	NA	Q6A204	Oenococcus_phage	41.8	6.2e-21
WP_002456836.1|1210682_1211528_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_001829353.1|1211571_1212231_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001832450.1|1212233_1213259_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	1.4e-31
WP_001829386.1|1213505_1214651_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_151361989.1|1214665_1215577_-	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	40.6	3.4e-45
>prophage 91
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1225984	1226248	2443663		Staphylococcus_virus(100.0%)	1	NA	NA
WP_001832458.1|1225984_1226248_+	hypothetical protein	NA	Q4ZCB7	Staphylococcus_virus	46.2	1.3e-10
>prophage 92
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1231842	1237976	2443663	integrase	Staphylococcus_phage(50.0%)	7	1224110:1224125	1238190:1238205
1224110:1224125	attL	TTGCAATAATTAATAA	NA	NA	NA	NA
WP_001829365.1|1231842_1232397_+	hypothetical protein	NA	A0A1J0MFV9	Staphylococcus_phage	53.6	2.9e-07
WP_001832449.1|1232498_1232702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829342.1|1232857_1233106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002484807.1|1233125_1233653_+|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	58.0	1.5e-50
WP_002437151.1|1233655_1234561_+	Abi family protein	NA	NA	NA	NA	NA
WP_002468031.1|1234801_1236343_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	3.6e-23
WP_001829407.1|1236509_1237976_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.8	3.7e-94
1238190:1238205	attR	TTGCAATAATTAATAA	NA	NA	NA	NA
>prophage 93
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1247207	1248731	2443663		Enterococcus_phage(100.0%)	1	NA	NA
WP_002437172.1|1247207_1248731_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.4	7.1e-40
>prophage 94
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1253777	1262507	2443663		Pandoravirus(40.0%)	10	NA	NA
WP_001831333.1|1253777_1254287_-	single-stranded DNA-binding protein	NA	A0A2H4JCF2	uncultured_Caudovirales_phage	90.5	4.8e-65
WP_001831345.1|1254309_1254606_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002455908.1|1254990_1255800_+	lysozyme	NA	NA	NA	NA	NA
WP_001831355.1|1255873_1256065_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	83.3	4.4e-24
WP_001831336.1|1256297_1257395_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001831361.1|1257406_1257610_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_001832526.1|1257630_1258506_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002455909.1|1258660_1259503_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	28.7	9.5e-10
WP_001831348.1|1260231_1261335_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	25.8	1.0e-11
WP_002455910.1|1261331_1262507_+	PLP-dependent transferase	NA	A0A0B5JD48	Pandoravirus	26.2	1.8e-14
>prophage 95
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1271002	1271845	2443663		Tupanvirus(100.0%)	1	NA	NA
WP_002437236.1|1271002_1271845_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	25.5	4.1e-05
>prophage 96
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1287884	1288643	2443663		Planktothrix_phage(100.0%)	1	NA	NA
WP_002489334.1|1287884_1288643_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.2e-34
>prophage 97
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1295053	1301216	2443663		Bacillus_virus(66.67%)	9	NA	NA
WP_001831756.1|1295053_1295740_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	1.4e-22
WP_001831820.1|1295736_1296855_-	RND transporter	NA	NA	NA	NA	NA
WP_002455925.1|1297092_1297722_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_002455926.1|1297912_1298482_-	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	31.8	2.5e-06
WP_002437284.1|1298701_1299241_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001831775.1|1299206_1299602_-	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001831810.1|1299617_1299977_-	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001831764.1|1299954_1300116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001831794.1|1300376_1301216_-	nucleoid occlusion protein	NA	A0A1C9EHY8	Gordonia_phage	33.1	4.7e-09
>prophage 98
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1311424	1320948	2443663	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_001831817.1|1311424_1313356_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	46.0	3.2e-146
WP_002489326.1|1313392_1316074_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.5	1.3e-121
WP_002447640.1|1316466_1317300_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002468932.1|1318126_1319413_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	52.2	7.0e-89
WP_032603162.1|1319943_1320948_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	52.6	7.2e-81
>prophage 99
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1327351	1337460	2443663		Bacillus_phage(40.0%)	8	NA	NA
WP_049323991.1|1327351_1328761_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.6	1.7e-112
WP_002491697.1|1329039_1330323_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.8	1.0e-68
WP_010959370.1|1331233_1331326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001831816.1|1331369_1332071_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	6.0e-42
WP_002495479.1|1332083_1333916_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.4	2.1e-30
WP_079994921.1|1333899_1335246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002447629.1|1335246_1336038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002447628.1|1336659_1337460_+	MBL fold metallo-hydrolase	NA	A0A2H4J3R0	uncultured_Caudovirales_phage	36.4	2.9e-40
>prophage 100
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1342112	1350190	2443663		Enterobacteria_phage(33.33%)	4	NA	NA
WP_002495472.1|1342112_1344062_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	31.0	3.9e-67
WP_002495471.1|1344063_1347033_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	29.2	1.8e-92
WP_002495470.1|1347042_1348332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145376404.1|1348315_1350190_+	helicase	NA	A0A249XXD7	Clostridium_phage	22.1	2.6e-07
>prophage 101
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1354954	1361151	2443663		Staphylococcus_phage(75.0%)	6	NA	NA
WP_080351691.1|1354954_1356976_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.1	2.6e-66
WP_049324007.1|1356990_1358424_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_049324008.1|1358443_1358926_+	YdhK family protein	NA	NA	NA	NA	NA
WP_049324009.1|1359132_1359528_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	84.7	2.5e-61
WP_049324010.1|1359544_1360834_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	80.2	2.0e-184
WP_002467638.1|1360836_1361151_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	59.6	6.2e-31
>prophage 102
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1369318	1372805	2443663	transposase	Staphylococcus_phage(66.67%)	4	NA	NA
WP_086045745.1|1369318_1369399_-	hypothetical protein	NA	A0A0N9SIX5	Staphylococcus_phage	96.2	1.0e-06
WP_001549972.1|1369359_1370169_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	94.8	6.4e-56
WP_000776433.1|1370682_1371180_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000857159.1|1371677_1372805_+	zinc-binding dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	30.9	6.9e-16
>prophage 103
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1385933	1387112	2443663	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_105165739.1|1385933_1387112_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.5	1.5e-61
>prophage 104
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1391306	1392702	2443663		Indivirus(50.0%)	2	NA	NA
WP_000073898.1|1391306_1392074_+	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	25.0	1.7e-05
WP_000912324.1|1392066_1392702_+	ATP-binding cassette domain-containing protein	NA	A0A1J0FA64	Only_Syngen_Nebraska_virus	26.7	7.4e-07
>prophage 105
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1404547	1407039	2443663	transposase	Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_002437663.1|1404547_1405315_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.4	1.0e-18
WP_099835063.1|1405897_1407039_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	97.1	2.0e-71
>prophage 106
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1410112	1414571	2443663		Enterobacteria_phage(50.0%)	4	NA	NA
WP_002437672.1|1410112_1411651_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	26.6	5.2e-14
WP_002437673.1|1411647_1412622_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002437674.1|1412814_1413156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002455963.1|1413719_1414571_+	trypsin-like peptidase domain-containing protein	NA	A0A2H4PQP1	Staphylococcus_phage	29.3	6.4e-06
>prophage 107
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1423866	1425000	2443663		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_002487803.1|1423866_1425000_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	27.6	9.4e-21
>prophage 108
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1436864	1443046	2443663		Lactobacillus_phage(50.0%)	4	NA	NA
WP_002437728.1|1436864_1439882_+	NADH-dependent flavin oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	57.4	8.7e-199
WP_002437731.1|1439910_1441287_+	MFS transporter	NA	NA	NA	NA	NA
WP_001830577.1|1441455_1442229_+	acetoin reductase	NA	NA	NA	NA	NA
WP_001830566.1|1442356_1443046_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	8.5e-25
>prophage 109
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1450089	1455836	2443663		Bacillus_virus(33.33%)	4	NA	NA
WP_001830532.1|1450089_1450905_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.6e-09
WP_001830579.1|1450897_1451647_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	27.6	1.8e-07
WP_001830562.1|1451658_1452849_+	MFS transporter	NA	NA	NA	NA	NA
WP_001830559.1|1453589_1455836_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	44.2	1.1e-182
>prophage 110
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1463301	1465121	2443663	holin	Mycoplasma_phage(50.0%)	2	NA	NA
WP_002485974.1|1463301_1464489_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.9e-19
WP_001830452.1|1464485_1465121_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	25.6	1.9e-07
>prophage 111
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1480880	1481777	2443663		Lactobacillus_phage(100.0%)	1	NA	NA
WP_002485969.1|1480880_1481777_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	6.1e-07
>prophage 112
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1485998	1493201	2443663		Tupanvirus(100.0%)	1	NA	NA
WP_103433692.1|1485998_1493201_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.8	3.5e-153
>prophage 113
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1504519	1512279	2443663		Erysipelothrix_phage(25.0%)	7	NA	NA
WP_002437815.1|1504519_1505929_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	1.2e-33
WP_001830565.1|1505970_1506924_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	E3SJ83	Synechococcus_phage	28.7	2.1e-13
WP_001830482.1|1506994_1508035_+	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_001830479.1|1508048_1509326_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_001830507.1|1509577_1509733_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	81.6	4.7e-16
WP_001829442.1|1510009_1510522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002504012.1|1510686_1512279_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	21.2	2.8e-18
>prophage 114
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1527752	1528388	2443663		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_001829420.1|1527752_1528388_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	26.9	7.4e-15
>prophage 115
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1543295	1544069	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002470388.1|1543295_1544069_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	1.1e-12
>prophage 116
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1569121	1569277	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001831859.1|1569121_1569277_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	70.8	2.0e-11
>prophage 117
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1573041	1575009	2443663		Clostridium_phage(100.0%)	1	NA	NA
WP_001831881.1|1573041_1575009_-	amidase domain-containing protein	NA	A0A0A7RUS8	Clostridium_phage	36.3	4.0e-11
>prophage 118
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1599175	1611765	2443663	transposase	uncultured_Caudovirales_phage(40.0%)	12	NA	NA
WP_001831857.1|1599175_1600342_+	CapA family protein	NA	A0A2H4JG01	uncultured_Caudovirales_phage	49.9	3.0e-107
WP_001831872.1|1600370_1600496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002456741.1|1600688_1602338_-	alpha-keto acid decarboxylase family protein	NA	NA	NA	NA	NA
WP_001831825.1|1602509_1602956_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001832528.1|1603171_1603654_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	35.4	1.1e-18
WP_002456739.1|1604811_1605390_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	1.1e-41
WP_002455809.1|1605857_1606445_-	resolvase	NA	NA	NA	NA	NA
WP_002455808.1|1606513_1607965_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	50.7	8.7e-120
WP_000282781.1|1607977_1608391_+	universal stress protein	NA	NA	NA	NA	NA
WP_002494655.1|1609382_1609478_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_002437969.1|1609910_1610012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001830672.1|1610427_1611765_+	hypothetical protein	NA	A0A0D3MVF0	Staphylococcus_phage	46.1	1.2e-46
>prophage 119
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1620316	1621066	2443663		Planktothrix_phage(100.0%)	1	NA	NA
WP_002456717.1|1620316_1621066_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	4.7e-29
>prophage 120
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1624296	1625889	2443663		Aeromonas_phage(100.0%)	1	NA	NA
WP_002456714.1|1624296_1625889_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.2	1.7e-44
>prophage 121
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1633353	1634085	2443663		Bacillus_phage(100.0%)	1	NA	NA
WP_002438006.1|1633353_1634085_+	phosphoadenylyl-sulfate reductase	NA	M4W6M9	Bacillus_phage	23.5	8.2e-10
>prophage 122
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1640395	1661218	2443663	holin	Enterococcus_phage(25.0%)	16	NA	NA
WP_002438012.1|1640395_1641574_+	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.9	3.2e-48
WP_002438013.1|1641589_1642189_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	44.6	1.3e-26
WP_002438015.1|1642512_1642818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002486291.1|1643136_1644987_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	65.4	2.3e-242
WP_002438021.1|1644983_1645520_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.4	3.7e-36
WP_001830664.1|1645883_1647182_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_002438025.1|1647260_1647368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001830660.1|1647602_1649225_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	22.6	4.6e-21
WP_002438029.1|1649271_1649838_-	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001830602.1|1650306_1651797_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001830593.1|1651956_1653675_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	33.1	4.5e-59
WP_001830632.1|1653996_1655172_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001830634.1|1655618_1655837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001830617.1|1655864_1656311_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001830656.1|1656647_1658243_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.2	1.4e-75
WP_001830624.1|1658590_1661218_+	pyruvate, phosphate dikinase	NA	A0A2I7RQW7	Vibrio_phage	40.5	4.6e-87
>prophage 123
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1665196	1666087	2443663		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001830665.1|1665196_1666087_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	7.2e-08
>prophage 124
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1671137	1672475	2443663		Klosneuvirus(100.0%)	1	NA	NA
WP_001830675.1|1671137_1672475_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.1	2.5e-20
>prophage 125
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1681149	1681968	2443663		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001830671.1|1681149_1681968_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	M4QNT1	Ostreococcus_lucimarinus_virus	36.0	2.1e-38
>prophage 126
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1687238	1687394	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001830677.1|1687238_1687394_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	77.6	2.6e-14
>prophage 127
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1695159	1698180	2443663		Staphylococcus_phage(50.0%)	2	NA	NA
WP_002438072.1|1695159_1695867_+	transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	41.1	2.1e-31
WP_002438073.1|1696371_1698180_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	30.1	1.1e-34
>prophage 128
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1702441	1706341	2443663		uncultured_virus(50.0%)	3	NA	NA
WP_001832365.1|1702441_1704826_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.5	7.3e-124
WP_001832327.1|1705062_1705269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001832349.1|1705471_1706341_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	41.8	3.9e-51
>prophage 129
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1712057	1712576	2443663		Streptococcus_phage(100.0%)	1	NA	NA
WP_001832355.1|1712057_1712576_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	39.1	3.9e-22
>prophage 130
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1720989	1727892	2443663	protease	Vibrio_phage(33.33%)	6	NA	NA
WP_002484492.1|1720989_1723017_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.3	2.1e-07
WP_002486307.1|1723364_1724132_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002484496.1|1724196_1725249_-	zinc-dependent alcohol dehydrogenase family protein	NA	E3SJ82	Synechococcus_phage	26.7	1.9e-15
WP_001832372.1|1725471_1725798_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002438114.1|1725965_1726829_+	YitT family protein	NA	NA	NA	NA	NA
WP_001832376.1|1726911_1727892_+	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	23.7	2.4e-12
>prophage 131
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1742100	1742256	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_002469549.1|1742100_1742256_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	75.5	3.7e-13
>prophage 132
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1745442	1746435	2443663		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_002456690.1|1745442_1746435_-	D-lactate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	30.7	2.3e-39
>prophage 133
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1778862	1785519	2443663	transposase	Streptococcus_phage(33.33%)	6	NA	NA
WP_002456674.1|1778862_1779729_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.9	1.7e-78
WP_002456673.1|1779942_1781583_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.5	1.1e-97
WP_001105987.1|1782213_1782888_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.6	6.8e-128
WP_002501998.1|1783150_1784008_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	32.6	4.2e-29
WP_001105987.1|1784085_1784760_-|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.6	6.8e-128
WP_000635275.1|1784907_1785519_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	32.8	8.9e-18
>prophage 134
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1801830	1802307	2443663		Pandoravirus(100.0%)	1	NA	NA
WP_001832058.1|1801830_1802307_+	cupin domain-containing protein	NA	A0A291ATU0	Pandoravirus	37.5	1.7e-16
>prophage 135
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1811339	1811906	2443663		Enterococcus_phage(100.0%)	1	NA	NA
WP_001832158.1|1811339_1811906_-	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.2	4.7e-21
>prophage 136
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1815015	1818401	2443663		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_077755981.1|1815015_1816710_+	ABC transporter ATP-binding protein/permease	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.7	1.9e-17
WP_002438857.1|1816706_1818401_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	23.6	2.2e-13
>prophage 137
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1823504	1824878	2443663		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_001830324.1|1823504_1824878_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	37.0	1.9e-47
>prophage 138
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1835982	1846518	2443663		Staphylococcus_phage(22.22%)	15	NA	NA
WP_001830355.1|1835982_1836822_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	43.0	1.2e-60
WP_011082622.1|1836963_1837056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001830351.1|1837024_1838131_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	43.2	6.3e-62
WP_002438881.1|1838200_1839166_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	1.8e-17
WP_001830352.1|1839255_1839945_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	3.4e-34
WP_158171524.1|1839919_1840393_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_001830329.1|1840443_1840881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010959136.1|1841286_1841385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001830315.1|1841476_1841632_-	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	75.5	9.8e-14
WP_001830331.1|1841981_1842581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001830330.1|1842683_1843397_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	44.8	1.6e-55
WP_001830341.1|1843397_1843817_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_001830328.1|1843821_1844493_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	55.7	4.1e-64
WP_001830349.1|1844789_1845377_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_001830323.1|1845366_1846518_+	anthranilate synthase component I family protein	NA	A0A0B5J984	Pandoravirus	39.6	7.5e-26
>prophage 139
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1849676	1863287	2443663	transposase	Streptococcus_phage(28.57%)	9	NA	NA
WP_001830354.1|1849676_1851617_+	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	38.5	3.0e-107
WP_104832450.1|1852292_1853471_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	5.7e-61
WP_100481766.1|1853694_1853793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829605.1|1854069_1854885_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_002438889.1|1855011_1856895_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.2	4.4e-55
WP_086886647.1|1856905_1858687_+	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	37.1	1.0e-77
WP_002438891.1|1858886_1859861_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	6.0e-24
WP_001829653.1|1861569_1862625_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.8	1.6e-22
WP_001832599.1|1862747_1863287_+	5'-3'-deoxyribonucleotidase	NA	A0A0A0PKY7	Bacillus_phage	40.7	1.1e-30
>prophage 140
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1867939	1878372	2443663		uncultured_Caudovirales_phage(66.67%)	10	NA	NA
WP_002438897.1|1867939_1869445_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.0	5.5e-61
WP_001832596.1|1869728_1870229_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	70.1	1.1e-50
WP_001829684.1|1870242_1871118_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001829589.1|1871871_1872270_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	100.0	2.0e-71
WP_001829582.1|1872232_1874338_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	100.0	0.0e+00
WP_158171525.1|1874456_1875425_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	99.7	1.1e-184
WP_002456931.1|1875399_1875663_+	hypothetical protein	NA	A0A2H4IYB4	uncultured_Caudovirales_phage	100.0	5.5e-17
WP_158171526.1|1875678_1876656_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	99.7	5.9e-165
WP_158171527.1|1876636_1877596_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	98.0	1.7e-15
WP_001829596.1|1877592_1878372_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.6	5.1e-18
>prophage 141
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1889805	1892864	2443663		Streptococcus_phage(100.0%)	3	NA	NA
WP_001829639.1|1889805_1890447_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	2.1e-38
WP_001829661.1|1890591_1891458_+	DegV family protein	NA	NA	NA	NA	NA
WP_158171548.1|1891574_1892864_+	DEAD/DEAH box helicase family protein	NA	A0A1X9I5S6	Streptococcus_phage	35.4	6.4e-50
>prophage 142
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1899012	1899813	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001829621.1|1899012_1899813_+	CHAP domain-containing protein	NA	A0A173GBC8	Staphylococcus_phage	44.6	5.6e-12
>prophage 143
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1903551	1906386	2443663		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001829652.1|1903551_1906386_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	58.2	0.0e+00
>prophage 144
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1910521	1915518	2443663		Streptococcus_phage(40.0%)	5	NA	NA
WP_002438914.1|1910521_1911454_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	48.6	4.2e-83
WP_001829594.1|1911629_1912538_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	33.6	3.6e-07
WP_001829626.1|1912537_1913533_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	39.8	2.6e-51
WP_002438915.1|1913661_1914606_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	2.4e-54
WP_001829659.1|1914933_1915518_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.7	3.1e-52
>prophage 145
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1925169	1935000	2443663		Staphylococcus_phage(40.0%)	11	NA	NA
WP_001829595.1|1925169_1926474_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.3	4.3e-195
WP_001829646.1|1926639_1927098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829669.1|1927166_1927400_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_001829672.1|1927700_1928441_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002438919.1|1928475_1930854_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.6	6.2e-91
WP_001829588.1|1930878_1931349_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	88.5	1.4e-71
WP_002438942.1|1931898_1932129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001829655.1|1932738_1932918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001832592.1|1933061_1933604_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	54.5	1.8e-25
WP_001829642.1|1934338_1934509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829658.1|1934766_1935000_-	hypothetical protein	NA	Q4ZCB8	Staphylococcus_virus	64.9	1.0e-22
>prophage 146
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1940415	1944921	2443663		Indivirus(33.33%)	6	NA	NA
WP_001829688.1|1940415_1941357_+	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	1.1e-11
WP_095658922.1|1941754_1941829_-	epsilon family phenol-soluble modulin	NA	NA	NA	NA	NA
WP_001829681.1|1942722_1942923_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.2	2.0e-19
WP_001829613.1|1943543_1943768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001829635.1|1943791_1944076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002438959.1|1944174_1944921_-	poly-gamma-glutamate hydrolase family protein	NA	A0A2H4IZ42	uncultured_Caudovirales_phage	42.2	6.6e-39
>prophage 147
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1949709	1955740	2443663		Streptococcus_phage(50.0%)	11	NA	NA
WP_001829648.1|1949709_1949865_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	79.6	3.0e-15
WP_002457221.1|1950048_1950471_-	Organic hydroperoxide resistance protein-like 1	NA	NA	NA	NA	NA
WP_001831974.1|1950631_1951348_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	3.7e-15
WP_001831981.1|1951428_1951971_+	nitroreductase	NA	NA	NA	NA	NA
WP_001831907.1|1952153_1952477_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001831965.1|1952619_1952973_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	45.9	1.6e-19
WP_002438979.1|1953146_1953527_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_010959149.1|1953680_1953773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001831968.1|1953786_1954173_+	topiosmerase	NA	NA	NA	NA	NA
WP_001831936.1|1954165_1954462_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002456122.1|1954714_1955740_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.4e-26
>prophage 148
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1959302	1962775	2443663		Brazilian_cedratvirus(50.0%)	3	NA	NA
WP_001831944.1|1959302_1960064_+	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	8.5e-10
WP_002438995.1|1960158_1961466_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_002438997.1|1961533_1962775_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.0	4.1e-110
>prophage 149
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1969014	1969863	2443663		Golden_Marseillevirus(100.0%)	1	NA	NA
WP_001831962.1|1969014_1969863_+	DUF72 domain-containing protein	NA	A0A1D6Y809	Golden_Marseillevirus	25.9	5.4e-13
>prophage 150
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1976925	1979594	2443663		Tupanvirus(50.0%)	2	NA	NA
WP_001831977.1|1976925_1978383_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	27.5	2.1e-41
WP_002439035.1|1978379_1979594_+	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	28.0	4.5e-21
>prophage 151
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1983854	1987493	2443663		Lake_Baikal_phage(50.0%)	3	NA	NA
WP_001832002.1|1983854_1984214_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	1.2e-14
WP_001831966.1|1984483_1985692_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002439046.1|1986011_1987493_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	34.5	6.3e-49
>prophage 152
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	1997313	1997907	2443663		Aureococcus_anophage(100.0%)	1	NA	NA
WP_001831922.1|1997313_1997907_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	6.6e-26
>prophage 153
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2001080	2066632	2443663	transposase,tRNA	Streptococcus_phage(33.33%)	58	NA	NA
WP_158171549.1|2001080_2002259_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	1.3e-60
WP_002467857.1|2002783_2003974_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.4	5.6e-32
WP_001831995.1|2004082_2005327_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_002467855.1|2005518_2006568_-	glycerophosphodiester phosphodiesterase	NA	A0A173GBD0	Staphylococcus_phage	39.6	1.5e-36
WP_001831901.1|2006717_2008109_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_001832499.1|2008098_2009304_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_049391140.1|2009650_2010982_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001831991.1|2011299_2011875_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_158171529.1|2011878_2012400_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001831955.1|2012418_2012994_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001831905.1|2013114_2016594_+	helicase-exonuclease AddAB subunit AddB	NA	NA	NA	NA	NA
WP_077756014.1|2016562_2020237_+	helicase-exonuclease AddAB subunit AddA	NA	S5M596	Bacillus_phage	21.9	4.4e-19
WP_001831933.1|2020435_2021341_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001831989.1|2021698_2022100_+	YisL family protein	NA	NA	NA	NA	NA
WP_104832452.1|2022442_2023621_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	7.4e-61
WP_001830033.1|2024000_2024156_+	hypothetical protein	NA	A0A146ICT8	Staphylococcus_phage	77.6	2.6e-14
WP_001829263.1|2024365_2025682_-	CoA-disulfide reductase	NA	NA	NA	NA	NA
WP_001829328.1|2025759_2026581_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001829290.1|2026693_2027002_+	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_001829283.1|2027396_2029220_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	30.7	9.5e-31
WP_002486293.1|2029428_2032038_+	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.0	1.6e-119
WP_104832450.1|2032339_2033518_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	5.7e-61
WP_001829320.1|2033776_2033971_-	YjzD family protein	NA	NA	NA	NA	NA
WP_001829261.1|2034252_2035194_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_001829324.1|2035205_2036450_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002486011.1|2036520_2036892_-	DUF3899 domain-containing protein	NA	NA	NA	NA	NA
WP_001829338.1|2037133_2038060_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001829251.1|2038059_2039130_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001829326.1|2039144_2040224_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	2.4e-18
WP_001829319.1|2040216_2041155_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_001829253.1|2041181_2042825_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001829285.1|2042882_2043872_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001829294.1|2044162_2044558_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_104832459.1|2044850_2046029_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	3.3e-61
WP_001829308.1|2046472_2047195_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_002456629.1|2047284_2048271_+	transcription factor	NA	NA	NA	NA	NA
WP_001829279.1|2048321_2050130_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	26.9	3.7e-51
WP_001829256.1|2050593_2051391_-	DsbA family protein	NA	NA	NA	NA	NA
WP_002456103.1|2051413_2051779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002456102.1|2051860_2052451_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_001829330.1|2052734_2053082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001829266.1|2053098_2053734_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_001829306.1|2053747_2054557_+	NAD kinase	NA	NA	NA	NA	NA
WP_001829311.1|2054553_2055408_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_001829287.1|2055432_2056818_+	magnesium transporter	NA	NA	NA	NA	NA
WP_001832661.1|2056827_2058672_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_001829337.1|2059381_2060005_+	DUF443 domain-containing protein	NA	NA	NA	NA	NA
WP_001829295.1|2060065_2060329_+	DUF4176 domain-containing protein	NA	A0A1X9I6T6	Streptococcus_phage	41.4	1.5e-09
WP_107362610.1|2060439_2060535_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001829258.1|2060601_2060805_-|transposase	transposase	transposase	A0A0N7GFG6	Staphylococcus_phage	80.0	3.3e-09
WP_107362609.1|2060896_2061301_+	glucose-6-phosphate dehydrogenase	NA	E3SKF6	Synechococcus_phage	31.3	1.9e-08
WP_071813278.1|2061335_2061401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077431490.1|2061407_2061557_+	hypothetical protein	NA	M4SJ15	Cyanophage	51.0	3.5e-08
WP_002439130.1|2061633_2061879_+	glucose-6-phosphate dehydrogenase	NA	E3SJC5	Synechococcus_phage	38.6	2.6e-05
WP_002469315.1|2061887_2062265_+	glucose-6-phosphate 1-dehydrogenase	NA	NA	NA	NA	NA
WP_079993594.1|2062629_2064642_+	ATP-binding cassette domain-containing protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	36.1	7.6e-106
WP_001829305.1|2065971_2066187_+	recombinase	NA	NA	NA	NA	NA
WP_001829249.1|2066260_2066632_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
>prophage 154
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2075601	2080247	2443663		Streptococcus_phage(33.33%)	3	NA	NA
WP_002446117.1|2075601_2077164_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	26.9	1.7e-36
WP_002439148.1|2077472_2078279_+	TerC family protein	NA	S5MAL1	Bacillus_phage	37.7	3.9e-29
WP_001829335.1|2078489_2080247_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	24.3	4.6e-06
>prophage 155
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2090526	2090742	2443663		Enterococcus_phage(100.0%)	1	NA	NA
WP_001831694.1|2090526_2090742_-	NINE protein	NA	A0A060AN66	Enterococcus_phage	40.4	1.6e-06
>prophage 156
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2101348	2105353	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_158171530.1|2101348_2105353_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFI1	Staphylococcus_phage	49.2	2.6e-57
>prophage 157
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2109152	2110355	2443663		Mycobacterium_phage(100.0%)	1	NA	NA
WP_001833073.1|2109152_2110355_+	serine hydrolase	NA	G8IDB2	Mycobacterium_phage	22.8	8.2e-07
>prophage 158
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2116828	2131460	2443663		Synechococcus_phage(22.22%)	14	NA	NA
WP_001831669.1|2116828_2117689_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.2	1.4e-37
WP_158171532.1|2117893_2118376_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.3	8.9e-21
WP_158171533.1|2118362_2119490_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001831723.1|2119490_2120195_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	H8ZMN3	Synechococcus_phage	42.5	1.6e-47
WP_001831728.1|2120194_2120455_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001831727.1|2120456_2121128_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_158171534.1|2121120_2123310_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	8.7e-140
WP_001831721.1|2123288_2124773_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.9	9.4e-45
WP_001831685.1|2124765_2125797_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.4	2.1e-64
WP_001831672.1|2125796_2126363_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.0	6.1e-29
WP_001831692.1|2126379_2127858_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.1	4.9e-78
WP_001831701.1|2127883_2129125_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_002439322.1|2129257_2130097_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001831678.1|2130056_2131460_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.8	8.1e-14
>prophage 159
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2136642	2137815	2443663		Streptococcus_phage(100.0%)	1	NA	NA
WP_001831690.1|2136642_2137815_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.5	2.9e-73
>prophage 160
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2147665	2148217	2443663		Synechococcus_phage(100.0%)	1	NA	NA
WP_001831696.1|2147665_2148217_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	44.8	4.9e-15
>prophage 161
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2152726	2156497	2443663		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_001831650.1|2152726_2154133_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	3.8e-48
WP_001833064.1|2154434_2154713_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_002439334.1|2154851_2155391_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002456615.1|2155402_2156497_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	43.0	2.4e-37
>prophage 162
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2165383	2168698	2443663	transposase	Erysipelothrix_phage(50.0%)	2	NA	NA
WP_001831737.1|2165383_2167231_+	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.2	3.4e-20
WP_104832469.1|2167519_2168698_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.2	9.7e-61
>prophage 163
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2181514	2184408	2443663		Paramecium_bursaria_Chlorella_virus(50.0%)	6	NA	NA
WP_049324124.1|2181514_2182441_-	glycerophosphodiester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	27.7	6.5e-12
WP_010959165.1|2182470_2182590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002439362.1|2182661_2182913_+	DUF2129 domain-containing protein	NA	NA	NA	NA	NA
WP_001830114.1|2182922_2183312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001830140.1|2183378_2183921_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_001830072.1|2183922_2184408_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.5	1.1e-26
>prophage 164
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2191251	2192310	2443663	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_002494949.1|2191251_2192310_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.1	1.4e-29
>prophage 165
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2196812	2201453	2443663		Bodo_saltans_virus(33.33%)	3	NA	NA
WP_002494952.1|2196812_2198522_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	23.0	5.2e-15
WP_002502998.1|2198531_2200880_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	38.9	5.1e-13
WP_001830148.1|2201138_2201453_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	47.6	2.3e-25
>prophage 166
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2208057	2208645	2443663		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_049324029.1|2208057_2208645_+	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	26.9	5.6e-09
>prophage 167
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2229248	2231999	2443663	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_049323982.1|2229248_2231999_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.5	2.1e-90
>prophage 168
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2236590	2241201	2443663		Enterobacteria_phage(33.33%)	4	NA	NA
WP_001830174.1|2236590_2237898_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.9	5.2e-55
WP_001830068.1|2237923_2238805_+	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	31.3	2.3e-30
WP_001830129.1|2238822_2240100_+	dihydroorotase	NA	NA	NA	NA	NA
WP_001830071.1|2240100_2241201_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.0	5.1e-64
>prophage 169
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2245094	2245706	2443663		Pandoravirus(100.0%)	1	NA	NA
WP_001830179.1|2245094_2245706_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	32.8	6.8e-26
>prophage 170
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2248911	2255827	2443663	tRNA	Abalone_herpesvirus(25.0%)	7	NA	NA
WP_001830096.1|2248911_2249535_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	35.3	4.2e-23
WP_002456586.1|2249534_2249747_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001830125.1|2250273_2251473_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.0	5.6e-40
WP_002500038.1|2251472_2253881_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_001830141.1|2253988_2254192_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	44.4	1.2e-08
WP_001830064.1|2254413_2254902_+	peptide deformylase	NA	NA	NA	NA	NA
WP_047500278.1|2254894_2255827_+|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	29.5	1.6e-10
>prophage 171
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2258974	2260978	2443663		Moumouvirus(100.0%)	1	NA	NA
WP_001833032.1|2258974_2260978_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	M1PCM5	Moumouvirus	35.7	1.8e-22
>prophage 172
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2270993	2273041	2443663		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_001830161.1|2270993_2271728_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.7	2.2e-18
WP_001830184.1|2271955_2272189_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_002456575.1|2272303_2273041_+	ribonuclease III	NA	G8DDA3	Micromonas_pusilla_virus	31.8	4.5e-24
>prophage 173
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2289268	2290039	2443663		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_001829514.1|2289268_2290039_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	41.2	3.3e-25
>prophage 174
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2294103	2300638	2443663	protease,tRNA	Indivirus(33.33%)	5	NA	NA
WP_001829508.1|2294103_2296173_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.3	1.5e-104
WP_001832560.1|2296197_2297505_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002456225.1|2297729_2298620_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	29.3	4.2e-24
WP_001829498.1|2298623_2299166_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001829474.1|2299234_2300638_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.3	2.9e-27
>prophage 175
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2305266	2306037	2443663		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001832561.1|2305266_2306037_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	43.0	6.6e-26
>prophage 176
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2310314	2321996	2443663	tRNA	Streptococcus_phage(33.33%)	9	NA	NA
WP_002456566.1|2310314_2314625_+	PolC-type DNA polymerase III	NA	A0A1X9I5C8	Streptococcus_phage	40.1	8.5e-22
WP_002439519.1|2314803_2315271_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002456565.1|2315291_2316515_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001829465.1|2316532_2316817_+	YlxR family protein	NA	NA	NA	NA	NA
WP_002439520.1|2316816_2317134_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_158171542.1|2317138_2319301_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	3.0e-23
WP_001829509.1|2319603_2319954_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_002456563.1|2320091_2321009_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_001832563.1|2321024_2321996_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	32.1	6.0e-08
>prophage 177
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2326928	2332629	2443663		Mycobacterium_phage(33.33%)	4	NA	NA
WP_002439534.1|2326928_2329322_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.7	4.3e-84
WP_002439536.1|2329324_2330038_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011082669.1|2330158_2331340_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	28.9	3.0e-38
WP_001832569.1|2331339_2332629_+	insulinase family protein	NA	M1NN74	Moumouvirus	24.2	7.9e-16
>prophage 178
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2337094	2338144	2443663		Bacillus_phage(100.0%)	1	NA	NA
WP_002439552.1|2337094_2338144_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	68.8	3.2e-124
>prophage 179
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2344516	2345134	2443663		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001832558.1|2344516_2345134_+	poly-gamma-glutamate hydrolase family protein	NA	A0A2H4J3M4	uncultured_Caudovirales_phage	44.6	1.9e-39
>prophage 180
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2348450	2353024	2443663		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_001832553.1|2348450_2351072_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.3	3.8e-41
WP_002456559.1|2351086_2353024_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.6	1.1e-61
>prophage 181
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2360847	2361324	2443663		Fowlpox_virus(100.0%)	1	NA	NA
WP_002456556.1|2360847_2361324_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	43.7	1.1e-26
>prophage 182
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2366397	2369279	2443663		Staphylococcus_phage(66.67%)	6	NA	NA
WP_002456553.1|2366397_2367045_+	hypothetical protein	NA	A0A1J0MFV1	Staphylococcus_phage	63.3	4.6e-73
WP_002456552.1|2367087_2367441_+	hypothetical protein	NA	A0A1J0MF61	Staphylococcus_phage	47.0	2.2e-21
WP_002456551.1|2367442_2367637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002456550.1|2367797_2367965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002468913.1|2367961_2368345_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002456548.1|2368595_2369279_-	hypothetical protein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	50.0	2.4e-11
>prophage 183
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2372583	2376947	2443663		Anomala_cuprea_entomopoxvirus(50.0%)	6	NA	NA
WP_077756130.1|2372583_2373468_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.5	6.4e-25
WP_002469377.1|2373464_2374196_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002456544.1|2374195_2375290_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002439610.1|2375286_2375889_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001829458.1|2376057_2376246_-	membrane protein	NA	NA	NA	NA	NA
WP_023567251.1|2376401_2376947_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	47.7	2.8e-23
>prophage 184
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2387895	2393228	2443663		Tupanvirus(25.0%)	6	NA	NA
WP_001831169.1|2387895_2389410_+	catalase	NA	A0A2K9L0T1	Tupanvirus	42.8	7.5e-90
WP_001831295.1|2389499_2389649_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001831302.1|2389814_2390084_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001832645.1|2390237_2391215_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	89.2	5.2e-169
WP_002439636.1|2391228_2392254_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	35.9	1.5e-17
WP_001831182.1|2392607_2393228_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	7.7e-17
>prophage 185
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2397462	2398587	2443663		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001830960.1|2397462_2398587_+	exonuclease SbcCD subunit D	NA	Q4Z9B9	Staphylococcus_phage	25.0	1.0e-11
>prophage 186
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2402299	2403940	2443663		Vibrio_phage(100.0%)	1	NA	NA
WP_001831122.1|2402299_2403940_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.2	1.6e-21
>prophage 187
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2409058	2413458	2443663		Bacillus_virus(100.0%)	2	NA	NA
WP_047500320.1|2409058_2411059_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.2	6.6e-118
WP_002439655.1|2411055_2413458_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	33.8	1.3e-104
>prophage 188
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2423012	2424275	2443663		Bacillus_phage(100.0%)	1	NA	NA
WP_001831129.1|2423012_2424275_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	45.0	1.5e-96
>prophage 189
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2427496	2429061	2443663		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001831157.1|2427496_2428063_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	34.7	1.3e-23
WP_001830976.1|2428065_2429061_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	31.1	3.7e-29
>prophage 190
NZ_CP043841	Staphylococcus epidermidis strain NCCP 16829 chromosome, complete genome	2443663	2438071	2439549	2443663		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_001831327.1|2438071_2438770_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.4	2.4e-14
WP_001831134.1|2438772_2439549_-	ABC transporter ATP-binding protein	NA	A0A2H4UUX5	Bodo_saltans_virus	23.9	4.0e-07
