The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039261	Lactobacillus johnsonii strain DC22.2 chromosome, complete genome	1904421	22353	52494	1904421	transposase	Streptococcus_phage(54.55%)	24	NA	NA
WP_052543001.1|22353_22977_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	41.1	7.7e-33
WP_158172787.1|23191_24289_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	41.0	9.3e-58
WP_158171999.1|24556_24736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087176735.1|24914_25964_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.6	4.6e-46
WP_158172788.1|27825_30771_+	LEA family epithelial adhesin	NA	NA	NA	NA	NA
WP_012845416.1|31157_31304_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158172000.1|31281_31488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158172001.1|31726_31879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065991183.1|33029_33653_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	41.1	5.9e-33
WP_087176943.1|33867_34965_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	40.7	3.5e-57
WP_012845422.1|35650_36298_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_158172002.1|37521_39441_+	tetracycline resistance ribosomal protection protein Tet(W)	NA	E4ZFJ7	Streptococcus_phage	99.5	0.0e+00
WP_082224993.1|39522_40071_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_158172003.1|40120_40810_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_004896312.1|40941_41649_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_158172004.1|41681_42521_-	DegV family EDD domain-containing protein	NA	A0A1X9I5J4	Streptococcus_phage	36.6	4.3e-47
WP_004896308.1|42640_42826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158172005.1|43035_44955_+	GTP-binding protein	NA	A0A1S5SF82	Streptococcus_phage	30.5	4.3e-66
WP_158172006.1|45393_46596_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	30.5	1.5e-40
WP_158172007.1|47592_47892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158172008.1|48254_48686_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_004898344.1|48819_50973_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.4	2.7e-61
WP_004898347.1|51025_51190_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_158172009.1|51213_52494_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.8	2.2e-42
>prophage 2
NZ_CP039261	Lactobacillus johnsonii strain DC22.2 chromosome, complete genome	1904421	492629	560044	1904421	protease,tRNA,transposase	Staphylococcus_phage(15.79%)	55	NA	NA
WP_011161609.1|492629_495278_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.4	8.0e-63
WP_003647717.1|495332_495590_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_004895672.1|495589_496021_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_004895671.1|496022_496337_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_087285107.1|496394_496937_+	CvpA family protein	NA	NA	NA	NA	NA
WP_158172177.1|496979_499346_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	52.6	2.7e-22
WP_004895668.1|499424_499736_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.7	4.2e-16
WP_004896796.1|499818_500214_-	YslB family protein	NA	NA	NA	NA	NA
WP_158172178.1|500310_501111_+	glutamate racemase	NA	NA	NA	NA	NA
WP_095183439.1|501113_501737_+	XTP/dITP diphosphatase	NA	C7C6C2	Cassava_brown_streak_virus	34.7	2.1e-14
WP_095076955.1|501896_503075_+	acetate kinase	NA	NA	NA	NA	NA
WP_095076956.1|503120_504017_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_004895662.1|504139_504571_+	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_004895661.1|504593_504926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087285101.1|505018_506125_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_087713225.1|506268_507264_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.6	4.7e-16
WP_158172179.1|507336_510174_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_158172180.1|510272_511670_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_095182766.1|511689_513072_-	glycerophosphodiester phosphodiesterase	NA	A0A076G4Q2	Staphylococcus_phage	29.2	4.5e-17
WP_004895655.1|513171_513498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158172181.1|513510_514890_+	bifunctional metallophosphatase/5'-nucleotidase	NA	S4VPC4	Pandoravirus	22.5	6.1e-06
WP_087285095.1|514889_515429_+	YutD family protein	NA	NA	NA	NA	NA
WP_087713220.1|515431_516214_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_158172798.1|516210_516819_+	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_004895650.1|516826_517477_-	membrane protein	NA	NA	NA	NA	NA
WP_158172182.1|517503_518460_-	FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	30.1	3.8e-15
WP_087713218.1|518559_518931_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_087285419.1|524952_526161_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.2	9.4e-136
WP_158172183.1|526150_527608_+	MFS transporter	NA	NA	NA	NA	NA
WP_117285382.1|527691_529093_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.6	2.9e-40
WP_158172799.1|529147_529855_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_012845756.1|530096_532511_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	67.2	0.0e+00
WP_087284936.1|532612_534271_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_095183588.1|535492_536239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158172184.1|536281_537127_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_087713201.1|537179_538106_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	28.9	3.9e-17
WP_012845762.1|538385_540062_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	31.4	5.6e-70
WP_004895615.1|540173_541091_+	class II fructose-bisphosphate aldolase family protein	NA	NA	NA	NA	NA
WP_158172185.1|541157_541469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080545348.1|542623_542875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012845770.1|542894_543110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087284945.1|543539_544076_+	hypoxanthine phosphoribosyltransferase	NA	A0A2K9L634	Tupanvirus	26.8	8.7e-09
WP_012845772.1|544088_544760_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_012845774.1|545684_547019_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.1	1.7e-61
WP_087284950.1|547118_547583_+|transposase	IS200/IS605-like element ISLjo5 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	43.1	1.3e-29
WP_012845776.1|547625_548084_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_158172186.1|549451_550447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087284952.1|550514_551081_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_087713194.1|551080_552019_+	AEC family transporter	NA	NA	NA	NA	NA
WP_158172187.1|552034_552838_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004895578.1|552860_553613_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	31.8	1.3e-29
WP_158172188.1|553816_555295_+	MFS transporter	NA	NA	NA	NA	NA
WP_158172189.1|555401_556853_+	MFS transporter	NA	NA	NA	NA	NA
WP_087284957.1|557116_558343_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.9	2.4e-94
WP_065991183.1|559420_560044_+|transposase	IS607 family transposase	transposase	A0A1V0SJI5	Klosneuvirus	41.1	5.9e-33
>prophage 3
NZ_CP039261	Lactobacillus johnsonii strain DC22.2 chromosome, complete genome	1904421	735820	743053	1904421		Pacmanvirus(16.67%)	8	NA	NA
WP_158172241.1|735820_736240_+	NUDIX domain-containing protein	NA	A0A1X6WFB1	Pacmanvirus	31.2	1.3e-07
WP_069169036.1|736223_736862_+	uracil-DNA glycosylase	NA	A0A218MKQ4	uncultured_virus	38.7	1.4e-08
WP_011162245.1|736898_737522_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	56.3	3.2e-15
WP_087284686.1|737659_737908_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003649044.1|737980_738202_+	YneF family protein	NA	NA	NA	NA	NA
WP_158172242.1|738278_740045_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	30.1	8.5e-53
WP_012845952.1|740034_741828_+	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	24.0	1.3e-11
WP_158172243.1|741871_743053_-	methyltransferase domain-containing protein	NA	A0A2I2L5L3	Orpheovirus	34.9	3.0e-46
>prophage 4
NZ_CP039261	Lactobacillus johnsonii strain DC22.2 chromosome, complete genome	1904421	926289	1010459	1904421	protease,transposase,integrase	Staphylococcus_phage(21.05%)	59	976324:976347	978580:978603
WP_117285382.1|926289_927691_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.6	2.9e-40
WP_158172317.1|927773_930161_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_087712995.1|930171_930783_-	Holliday junction resolvase RecU	NA	NA	NA	NA	NA
WP_012846148.1|930850_931414_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_012846149.1|931618_932056_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
WP_158172318.1|932521_933646_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_158172319.1|933651_934884_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_158172320.1|934971_936072_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_087712991.1|936158_937082_-	DegV family protein	NA	NA	NA	NA	NA
WP_012846154.1|937214_937565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158172321.1|937561_939235_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_004894860.1|939234_939699_+	signal peptidase II	NA	NA	NA	NA	NA
WP_095076490.1|939713_940628_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.7	1.3e-09
WP_012846158.1|940631_941687_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_087712987.1|941690_944855_+	carbamoyl phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_158172322.1|944927_946619_-	DUF814 domain-containing protein	NA	Q84500	Paramecium_bursaria_Chlorella_virus	40.2	1.5e-09
WP_012846161.1|946807_947218_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004897328.1|947333_948221_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	42.2	1.2e-10
WP_158172323.1|948305_949418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012846166.1|950434_951505_-	tyrosine recombinase XerS	NA	Q8W5Y3	Listeria_phage	23.2	4.0e-05
WP_004897332.1|952811_953507_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_004894833.1|953573_954161_-	peptidylprolyl isomerase	NA	A0A2H4UTF4	Bodo_saltans_virus	42.6	7.7e-27
WP_069168440.1|954506_955730_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.7	4.5e-93
WP_004894829.1|957747_958683_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_095183648.1|959994_962475_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.4	5.7e-95
WP_004897336.1|962491_964450_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.3	1.9e-117
WP_158172324.1|964549_965206_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_012846174.1|965310_965925_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_012846180.1|967869_968100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158172325.1|968298_969561_-	AAA family ATPase	NA	A0A127AWE7	Bacillus_phage	36.3	2.0e-64
WP_158172326.1|969635_970292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158172327.1|970293_970785_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158172328.1|972727_975751_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	22.4	9.2e-15
WP_158172329.1|975857_976955_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	30.3	7.0e-29
976324:976347	attL	TCACGCTTCAGCAACGAAAATTGA	NA	NA	NA	NA
WP_158172330.1|976992_977928_-|integrase	tyrosine-type recombinase/integrase	integrase	A8ATM2	Listeria_phage	49.0	6.7e-81
WP_158172331.1|977998_979162_-	hypothetical protein	NA	A0A2H4PQP5	Staphylococcus_phage	26.7	2.1e-23
978580:978603	attR	TCAATTTTCGTTGCTGAAGCGTGA	NA	NA	NA	NA
WP_095182483.1|979154_980810_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	46.4	1.4e-113
WP_095076931.1|980945_981788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012846197.1|981788_983885_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_158172803.1|986633_986720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158172332.1|986739_987048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095076927.1|988025_988520_+	thiol peroxidase	NA	NA	NA	NA	NA
WP_012846203.1|988653_988986_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_158172333.1|989053_989506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158172334.1|989723_990806_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_158172335.1|991025_993548_-	AAA family ATPase	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.3	4.7e-137
WP_158172336.1|993782_994883_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_158172337.1|996296_996866_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_158172804.1|996974_997715_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004897363.1|999293_999617_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_011161981.1|999616_1001020_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004897365.1|1001012_1001471_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_158172338.1|1001457_1002696_-	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.0e-105
WP_158172339.1|1002676_1003882_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_158172340.1|1003890_1004685_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	26.5	4.4e-09
WP_069168479.1|1005140_1006199_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_012845668.1|1008179_1009382_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	30.5	1.5e-40
WP_158172341.1|1009816_1010164_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005725993.1|1010228_1010459_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP039261	Lactobacillus johnsonii strain DC22.2 chromosome, complete genome	1904421	1039843	1050204	1904421	protease,tRNA	Erwinia_phage(16.67%)	9	NA	NA
WP_004894575.1|1039843_1041238_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IB03	Erwinia_phage	26.3	1.6e-30
WP_004894572.1|1041248_1041773_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_158172346.1|1041777_1042701_-	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	28.9	2.4e-22
WP_158172347.1|1042703_1044020_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_158172348.1|1044117_1046199_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	36.7	3.2e-99
WP_158172349.1|1046264_1047110_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.2	3.7e-30
WP_158172350.1|1047162_1047915_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	37.2	2.1e-24
WP_158172351.1|1047911_1048751_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_158172352.1|1048752_1050204_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	27.4	1.6e-09
>prophage 6
NZ_CP039261	Lactobacillus johnsonii strain DC22.2 chromosome, complete genome	1904421	1100088	1132850	1904421	protease,transposase,integrase	Lactobacillus_phage(28.57%)	31	1099646:1099661	1122038:1122053
1099646:1099661	attL	AGGATTTAAAAAAGAT	NA	NA	NA	NA
WP_158172367.1|1100088_1100886_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_158172807.1|1100914_1101547_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_158172368.1|1102518_1103340_-	cell wall protein	NA	NA	NA	NA	NA
WP_004894431.1|1103562_1103943_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_158172369.1|1104032_1104434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158172370.1|1104722_1105772_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.3	2.3e-45
WP_158172371.1|1105838_1106498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158172372.1|1106527_1106968_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_158172373.1|1107119_1107965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158172374.1|1108029_1108800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143445803.1|1109519_1109633_+	type I toxin-antitoxin system Fst family toxin	NA	Q65YV5	Lactobacillus_phage	84.8	3.4e-08
WP_158172375.1|1110212_1110617_-	hypothetical protein	NA	Q20DD0	Lactobacillus_phage	83.6	9.6e-61
WP_158172376.1|1110613_1111048_-	HK97 gp10 family phage protein	NA	A9D9U1	Lactobacillus_prophage	94.4	5.6e-75
WP_158172377.1|1111044_1111407_-	hypothetical protein	NA	A9D9T8	Lactobacillus_prophage	95.0	1.0e-61
WP_158172378.1|1111403_1111796_-	hypothetical protein	NA	A9D9T5	Lactobacillus_prophage	92.3	2.0e-63
WP_158172808.1|1111804_1111984_-	hypothetical protein	NA	X2CY65	Lactobacillus_phage	79.7	1.1e-16
WP_069168440.1|1112367_1113591_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.7	4.5e-93
WP_158172379.1|1113933_1114281_-	hypothetical protein	NA	Q9AYW8	Lactococcus_phage	41.1	3.8e-13
WP_158172380.1|1114371_1114563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012846301.1|1116328_1117429_+|integrase	site-specific integrase	integrase	X2CYE9	Lactobacillus_phage	68.7	2.2e-147
WP_158172381.1|1117914_1118793_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	A0A0A8WJ41	Clostridium_phage	28.3	8.3e-09
WP_087712926.1|1118798_1119737_-	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_087712925.1|1119739_1120387_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_087712924.1|1120398_1121109_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
WP_087712923.1|1121089_1122211_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
1122038:1122053	attR	ATCTTTTTTAAATCCT	NA	NA	NA	NA
WP_157662328.1|1122213_1122801_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
WP_158172382.1|1122829_1124515_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
WP_087712920.1|1124507_1127258_-	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	22.3	1.2e-05
WP_158172383.1|1129466_1130384_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_087285405.1|1130597_1131023_-	restriction endonuclease	NA	G3M9Z4	Bacillus_virus	33.0	9.3e-06
WP_023599651.1|1131800_1132850_+|transposase	IS30-like element ISLjo1 family transposase	transposase	H7BWC8	unidentified_phage	35.1	7.1e-47
>prophage 7
NZ_CP039261	Lactobacillus johnsonii strain DC22.2 chromosome, complete genome	1904421	1144784	1151785	1904421	transposase	Enterobacteria_phage(50.0%)	7	NA	NA
WP_087176735.1|1144784_1145834_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	34.6	4.6e-46
WP_158172388.1|1145821_1147381_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_158172389.1|1147693_1148680_-	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	37.2	1.7e-26
WP_004897504.1|1148696_1149305_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	51.9	1.7e-45
WP_158172390.1|1149335_1150220_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.9	2.2e-94
WP_158172391.1|1150226_1151264_-	dTDP-glucose 4,6-dehydratase	NA	A0A291LAD7	Escherichia_phage	46.5	1.0e-85
WP_158172392.1|1151383_1151785_-	hypothetical protein	NA	A0A2D1GPE1	Lactobacillus_phage	29.7	8.8e-06
>prophage 8
NZ_CP039261	Lactobacillus johnsonii strain DC22.2 chromosome, complete genome	1904421	1834967	1886584	1904421	protease,transposase	Moraxella_phage(17.65%)	45	NA	NA
WP_129206530.1|1834967_1835510_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_007124969.1|1835467_1835635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158172764.1|1835774_1836464_+|transposase	IS607 family transposase	transposase	I7JC24	Campylobacter_virus	30.0	3.8e-17
WP_087176943.1|1836678_1837776_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	40.7	3.5e-57
WP_087284543.1|1838915_1839563_-	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_158172765.1|1839581_1840505_-	DUF979 family protein	NA	NA	NA	NA	NA
WP_087712572.1|1840507_1841182_-	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_158172826.1|1841806_1842229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095182594.1|1842955_1844410_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_012846787.1|1844458_1844968_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_158172766.1|1844984_1845632_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_158172767.1|1845711_1846833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087284559.1|1846846_1849186_+	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	36.8	1.3e-32
WP_012846791.1|1849349_1850741_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_087712566.1|1850740_1851763_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_158172768.1|1851781_1853599_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	22.0	3.8e-16
WP_158172769.1|1853595_1855341_+	thiol reductant ABC exporter subunit CydC	NA	A0A1V0SE00	Indivirus	33.0	1.8e-23
WP_158172770.1|1855360_1856287_+	prenyltransferase	NA	NA	NA	NA	NA
WP_087284571.1|1856352_1857645_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_158172771.1|1857934_1858867_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_158172772.1|1858961_1860032_+	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	38.7	3.3e-60
WP_041822357.1|1860096_1861125_-	serine hydrolase	NA	A0A1J0GRK9	Mycobacterium_phage	22.3	2.9e-05
WP_158172773.1|1862278_1863184_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_158172774.1|1864083_1864923_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	26.9	9.1e-21
WP_087712555.1|1865049_1865769_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_041822360.1|1865989_1866640_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	48.0	3.7e-54
WP_158172775.1|1866661_1867336_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	52.2	2.4e-56
WP_158172776.1|1867393_1868632_-	lactate oxidase	NA	NA	NA	NA	NA
WP_003650577.1|1868871_1870182_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	5.0e-42
WP_158172777.1|1870268_1871003_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_095182583.1|1871306_1872617_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.4	2.3e-42
WP_144772624.1|1872627_1872927_+	phosphoribosyl-ATP pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_158172827.1|1873192_1874506_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.8	2.6e-46
WP_158172778.1|1874613_1875099_+	helix-turn-helix domain-containing protein	NA	A0A090D830	Clostridium_phage	39.8	5.1e-08
WP_087712551.1|1875163_1875577_+	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	36.1	7.1e-11
WP_004898229.1|1875660_1876206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158172779.1|1876227_1876785_-	beta-carotene 15,15'-monooxygenase	NA	NA	NA	NA	NA
WP_158172780.1|1876942_1877377_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_012846822.1|1877389_1877767_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_012846823.1|1877785_1878073_+	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_158172781.1|1878072_1879998_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.2	3.4e-95
WP_012846825.1|1880056_1881517_-	APC family permease	NA	NA	NA	NA	NA
WP_095076576.1|1881759_1883859_+	putative ornithine decarboxylase	NA	NA	NA	NA	NA
WP_087284620.1|1883862_1885131_+	aluminum resistance protein	NA	NA	NA	NA	NA
WP_069168440.1|1885360_1886584_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	47.7	4.5e-93
