The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046938	Pediococcus pentosaceus strain GDIAS001 chromosome, complete genome	1831351	90591	96288	1831351		Staphylococcus_phage(33.33%)	9	NA	NA
WP_158190273.1|90591_90951_-	helix-turn-helix domain-containing protein	NA	A0A1J0MG99	Staphylococcus_phage	70.1	1.2e-19
WP_158190274.1|91103_91313_+	DUF1870 family protein	NA	A0A0N7GFI4	Staphylococcus_phage	57.8	2.4e-15
WP_158190275.1|91359_92052_+	transcriptional regulator	NA	A0A192Y918	Salmonella_phage	35.4	8.0e-23
WP_158190276.1|92154_92427_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_158190277.1|92588_92858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190278.1|92844_93624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190279.1|93620_95084_+	DNA primase	NA	V5US55	Enterococcus_phage	29.2	1.8e-32
WP_158190280.1|95697_96060_+	DUF1492 domain-containing protein	NA	D2IYV6	Enterococcus_phage	35.5	1.8e-10
WP_002834405.1|96072_96288_+	hypothetical protein	NA	D7RWL9	Brochothrix_phage	50.8	4.2e-07
>prophage 2
NZ_CP046938	Pediococcus pentosaceus strain GDIAS001 chromosome, complete genome	1831351	478999	486617	1831351		Bacillus_phage(33.33%)	8	NA	NA
WP_158190409.1|478999_480115_+	peptide chain release factor 2	NA	B5LLF2	Mycobacterium_phage	47.1	1.9e-05
WP_002834460.1|480126_480831_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	6.9e-38
WP_099299840.1|480802_482188_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.8	2.2e-27
WP_002834458.1|482349_483231_+	phosphate ABC transporter substrate-binding protein PstS family protein	NA	H6WG65	Cyanophage	25.9	9.3e-08
WP_158190410.1|483230_484139_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_002834456.1|484139_485027_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_099299841.1|485044_485845_+	phosphate ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	42.0	3.4e-09
WP_023440049.1|485858_486617_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.5	1.7e-18
>prophage 3
NZ_CP046938	Pediococcus pentosaceus strain GDIAS001 chromosome, complete genome	1831351	774659	842185	1831351	tail,capsid,holin,integrase,head,plate,terminase,tRNA,protease,portal	Lactobacillus_phage(51.28%)	96	785637:785661	825109:825133
WP_158190514.1|774659_775349_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002833522.1|775381_775594_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_002833523.1|775611_776574_+	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002833524.1|776605_777025_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002833525.1|777078_777255_-	DUF3042 family protein	NA	NA	NA	NA	NA
WP_055126203.1|777337_778072_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	35.2	1.2e-13
WP_158190515.1|778073_779006_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_158190516.1|778989_780246_+	aluminum resistance protein	NA	NA	NA	NA	NA
WP_023440271.1|780326_780692_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002833531.1|780726_782067_+	type I glutamate--ammonia ligase	NA	M1NM71	Moumouvirus	22.8	2.5e-12
WP_002833532.1|782215_783091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002833533.1|783083_784001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002833534.1|784010_784550_+	dUTPase	NA	A0A290GJJ6	Caldibacillus_phage	26.2	9.7e-08
WP_002833535.1|784853_785081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190517.1|785220_785424_-	hypothetical protein	NA	NA	NA	NA	NA
785637:785661	attL	CTATATTAATATGATTCGGGAGAGA	NA	NA	NA	NA
WP_158190518.1|785761_786910_-|integrase	tyrosine-type recombinase/integrase	integrase	E9LUK6	Lactobacillus_phage	48.2	9.0e-88
WP_158190519.1|787047_787938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158190520.1|788002_788410_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0M7RF74	Lactobacillus_phage	32.3	6.8e-06
WP_158190521.1|788419_788767_-	helix-turn-helix domain-containing protein	NA	Q9T1J3	Lactobacillus_phage	37.2	4.1e-12
WP_158190522.1|789024_789231_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_158190523.1|789510_789774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158190974.1|790020_790746_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	50.0	3.0e-52
WP_011673226.1|790748_791093_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_158190524.1|791190_791415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190525.1|791416_791644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158190526.1|791867_792329_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_158190527.1|792328_793096_+	AAA family ATPase	NA	B4XYS4	Lactobacillus_phage	53.4	1.4e-63
WP_158190528.1|793095_793617_+	DUF669 domain-containing protein	NA	A0A059T5G4	Listeria_phage	43.3	5.6e-29
WP_158190529.1|793636_794470_+	hypothetical protein	NA	A8YQM0	Lactobacillus_phage	42.6	2.7e-41
WP_158190530.1|794453_795680_+	DNA helicase	NA	A0A0P0IXJ2	Lactobacillus_phage	37.2	2.0e-61
WP_158190531.1|795688_796105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190532.1|796101_796644_+	hypothetical protein	NA	A0A2P0ZKV6	Lactobacillus_phage	48.4	2.3e-25
WP_061812683.1|796618_796837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190533.1|796849_797077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190534.1|797073_797211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190535.1|797197_797392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190536.1|797391_797931_+	DUF1642 domain-containing protein	NA	A0A1S5SC90	Streptococcus_phage	35.2	2.3e-09
WP_158190537.1|797923_798169_+	hypothetical protein	NA	O03923	Lactobacillus_phage	43.8	8.5e-12
WP_158190538.1|798161_798374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190539.1|798385_798625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190540.1|798617_798788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190541.1|799107_799398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190975.1|799531_799771_+	hypothetical protein	NA	A8ASM5	Listeria_phage	55.2	1.1e-11
WP_158190542.1|799773_799971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190543.1|799970_800225_+	hypothetical protein	NA	A0A2K9VD68	Lactobacillus_phage	57.1	6.7e-20
WP_158190544.1|800230_800593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190545.1|800668_801112_+	RNA polymerase subunit sigma-70	NA	O03925	Lactobacillus_phage	34.8	2.2e-13
WP_158190546.1|801410_801974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190547.1|802059_802227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190548.1|802228_802684_+	HNH endonuclease	NA	B8R694	Lactobacillus_phage	39.6	2.8e-24
WP_158190549.1|802680_802980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094104463.1|803198_803663_+|terminase	phage terminase small subunit P27 family	terminase	E9LUP8	Lactobacillus_phage	62.7	1.5e-46
WP_158190550.1|803662_805537_+|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	41.3	2.6e-140
WP_158190551.1|805737_806850_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	37.6	4.0e-64
WP_158190976.1|806833_807424_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0M7RF71	Lactobacillus_phage	49.5	9.5e-41
WP_158190977.1|807436_808747_+|capsid	phage major capsid protein	capsid	D2KRA9	Lactobacillus_phage	59.3	1.7e-82
WP_158190552.1|808829_809300_+	hypothetical protein	NA	A0A1D6Z291	Staphylococcus_phage	42.9	3.4e-17
WP_158190553.1|809315_809642_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_158190554.1|809616_809976_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	41.2	8.9e-18
WP_158190978.1|809995_810391_+|tail	phage tail protein	tail	A0A286QQY0	Streptococcus_phage	53.8	3.3e-29
WP_158190555.1|810390_810780_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	30.3	1.6e-12
WP_158190556.1|810779_811388_+|tail	phage tail protein	tail	Q9AZL7	Lactococcus_phage	41.6	1.6e-35
WP_061812728.1|811521_811935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190557.1|812143_817276_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G7YZ66	Streptococcus_phage	38.1	9.3e-100
WP_158190558.1|817291_818125_+|tail	phage tail family protein	tail	A0A0M7RF73	Lactobacillus_phage	37.9	3.0e-48
WP_158190559.1|818054_819278_+	hypothetical protein	NA	A0A0M7RDS2	Lactobacillus_phage	43.6	2.1e-74
WP_158190560.1|819267_819582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190561.1|819581_819881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190562.1|819880_821707_+|plate	BppU family phage baseplate upper protein	plate	O03968	Lactobacillus_phage	40.5	5.4e-119
WP_158190563.1|821718_822459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190564.1|822458_822800_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
WP_158190565.1|822796_822949_+	XkdX family protein	NA	NA	NA	NA	NA
WP_158190566.1|822987_823389_+|holin	holin	holin	A0A097BY69	Enterococcus_phage	41.0	5.7e-21
WP_158190567.1|823372_824707_+	1,4-beta-N-acetylmuramidase	NA	A0A1X9IGI4	Lactococcus_phage	66.5	4.7e-80
WP_158190568.1|824836_824995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002833537.1|825397_825910_+	hypothetical protein	NA	NA	NA	NA	NA
825109:825133	attR	CTATATTAATATGATTCGGGAGAGA	NA	NA	NA	NA
WP_011673281.1|826243_826873_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002833539.1|827002_827311_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_011673282.1|827332_827659_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_002833541.1|827682_827970_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002833542.1|828094_828658_+	elongation factor P	NA	NA	NA	NA	NA
WP_002833543.1|828675_829104_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002833544.1|829103_829505_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_158190569.1|829630_830482_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	6.4e-38
WP_158190570.1|830482_831826_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	30.6	4.6e-43
WP_002833547.1|831825_832062_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_158190571.1|832054_832945_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_002833549.1|832958_833777_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_002833550.1|833785_834244_+	arginine repressor, DNA-binding domain protein	NA	NA	NA	NA	NA
WP_158190572.1|834255_835932_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_011673284.1|836003_836339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002833553.1|836634_837249_+	guanylate kinase	NA	A0A223FN12	Murmansk_poxvirus	32.9	1.8e-18
WP_002833554.1|837250_837460_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_158190573.1|837571_838765_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.6	4.7e-39
WP_158190574.1|838779_841200_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_158190575.1|841222_842185_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.3	5.7e-11
>prophage 4
NZ_CP046938	Pediococcus pentosaceus strain GDIAS001 chromosome, complete genome	1831351	862617	904410	1831351	tail,capsid,integrase,head,terminase,tRNA,portal	Lactobacillus_phage(46.43%)	58	854734:854750	902686:902702
854734:854750	attL	AAAACTAGCAACTGGAA	NA	NA	NA	NA
WP_158190585.1|862617_863355_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_158190586.1|863497_863857_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002833580.1|864278_864602_-	heavy metal-binding domain-containing protein	NA	M4STD1	Rhodobacter_phage	34.6	3.5e-05
WP_011673301.1|864642_864975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011673302.1|865388_865838_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_158190587.1|865851_866811_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002833584.1|866849_867089_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_158190979.1|867106_868039_+	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_158190588.1|868039_868768_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	40.3	1.4e-06
WP_002833587.1|868786_870013_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_002833588.1|870018_870456_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_002833589.1|870455_870869_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_158190589.1|870886_872254_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002833591.1|872243_873074_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_138428718.1|873087_873855_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_002833593.1|873871_874630_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_158190590.1|874768_875941_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0T6A8	Bacillus_phage	26.4	7.7e-18
WP_158190591.1|876036_876939_-	DNA adenine methylase	NA	A0A1D8KT41	Synechococcus_phage	22.4	2.8e-07
WP_158190592.1|876982_878725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158190593.1|878812_879751_-	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
WP_158190594.1|879827_880220_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTX7	Clostridium_phage	38.0	2.8e-09
WP_099299649.1|880226_880562_-	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	51.9	2.3e-12
WP_158190595.1|880710_880932_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158190596.1|880963_881206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069825579.1|881414_881738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190597.1|881738_882014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190598.1|882251_882533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190599.1|882525_883290_+	phage recombination protein Bet	NA	A8ATK8	Listeria_phage	51.1	3.6e-56
WP_158190980.1|883324_884095_+	hypothetical protein	NA	A0A0P0IZH9	Lactobacillus_phage	45.3	1.6e-56
WP_158190600.1|884105_884981_+	helix-turn-helix domain-containing protein	NA	A0A0P0I7Q1	Lactobacillus_phage	39.4	4.1e-40
WP_158190601.1|884984_885686_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	65.5	5.3e-83
WP_158190602.1|885654_885915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190603.1|885933_886449_+	single-stranded DNA-binding protein	NA	A0A191KBY9	Streptococcus_virus	67.5	5.9e-39
WP_158190604.1|886599_886917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190605.1|887079_887277_+	hypothetical protein	NA	A0A0A7S0P6	Clostridium_phage	44.7	2.8e-05
WP_158190606.1|887474_887717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190607.1|888097_888541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190608.1|888844_889465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190609.1|889784_890261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190610.1|890303_890840_+|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	69.0	1.6e-47
WP_158190611.1|890823_892095_+|terminase	PBSX family phage terminase large subunit	terminase	Q6SE84	Lactobacillus_prophage	67.5	1.2e-170
WP_158190981.1|892175_893495_+|portal	phage portal protein	portal	A0A0A1ER87	Lactobacillus_phage	56.9	5.2e-140
WP_158190612.1|893478_894444_+|head	phage head morphogenesis protein	head	A0A0P0ID43	Lactobacillus_phage	47.6	6.2e-74
WP_158190613.1|894446_894815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190614.1|894873_895119_+	hypothetical protein	NA	F0PII8	Enterococcus_phage	81.4	4.2e-19
WP_158190615.1|895221_895917_+	DUF4355 domain-containing protein	NA	A0A0A1EN85	Lactobacillus_phage	37.1	4.3e-16
WP_158190616.1|895916_896735_+|capsid	N4-gp56 family major capsid protein	capsid	B5SP31	Lactococcus_phage	72.0	4.3e-100
WP_158190982.1|896752_897019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190617.1|897030_897402_+	hypothetical protein	NA	A0A0P0IV23	Lactobacillus_phage	52.0	6.0e-25
WP_158190618.1|897406_897709_+	hypothetical protein	NA	A0A097BYD2	Leuconostoc_phage	48.0	1.4e-16
WP_158190619.1|897701_898073_+	hypothetical protein	NA	A0A0P0I3G7	Lactobacillus_phage	39.5	5.8e-12
WP_158190620.1|898073_898481_+	hypothetical protein	NA	A0A0A1EN91	Lactobacillus_phage	35.7	3.5e-18
WP_141822621.1|898498_899095_+|tail	phage major tail protein, TP901-1 family	tail	A0A0A1ELH3	Lactobacillus_phage	54.0	5.1e-50
WP_158190621.1|899172_899451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158190622.1|899530_899869_+	hypothetical protein	NA	A0A097BY80	Leuconostoc_phage	57.5	1.2e-27
WP_141822627.1|899916_900303_+	hypothetical protein	NA	A0A1B0Y2Q4	Lactobacillus_phage	52.1	2.9e-22
WP_158190623.1|900295_903646_+|tail	phage tail tape measure protein	tail	A0A097BYC3	Leuconostoc_phage	61.0	3.8e-134
902686:902702	attR	AAAACTAGCAACTGGAA	NA	NA	NA	NA
WP_158190624.1|903645_904410_+|tail	phage tail protein	tail	Q6SEC3	Lactobacillus_prophage	46.4	1.0e-55
>prophage 5
NZ_CP046938	Pediococcus pentosaceus strain GDIAS001 chromosome, complete genome	1831351	943239	949522	1831351		Megavirus(16.67%)	8	NA	NA
WP_011673326.1|943239_945099_+	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	47.2	5.3e-138
WP_002833625.1|945195_946320_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	33.2	1.3e-22
WP_158190644.1|946424_946652_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_158190645.1|946780_947251_-	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_069825315.1|947487_947970_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	35.7	1.7e-11
WP_158190646.1|947986_948208_+	DUF2829 domain-containing protein	NA	G3MBC9	Bacillus_virus	33.7	5.1e-08
WP_158190647.1|948208_948949_+	3-oxoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.9	3.7e-18
WP_158190648.1|949072_949522_+	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	57.9	5.9e-43
>prophage 6
NZ_CP046938	Pediococcus pentosaceus strain GDIAS001 chromosome, complete genome	1831351	1061193	1070811	1831351	tRNA	Staphylococcus_phage(37.5%)	9	NA	NA
WP_158190701.1|1061193_1062039_-	DegV family EDD domain-containing protein	NA	A0A0N9SI50	Staphylococcus_phage	35.2	1.4e-16
WP_023440467.1|1062275_1063013_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.3e-34
WP_158190702.1|1063009_1064461_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_158190985.1|1064582_1065059_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	40.1	2.0e-25
WP_011673474.1|1065096_1066047_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.7	3.4e-117
WP_158190703.1|1066059_1067937_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.5	2.9e-51
WP_158190704.1|1067939_1069148_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	40.0	3.5e-34
WP_158190705.1|1069401_1070286_+	DUF2179 domain-containing protein	NA	M1Q1P6	Streptococcus_phage	38.1	2.1e-52
WP_002833201.1|1070340_1070811_-	nucleoside deoxyribosyltransferase	NA	A0A1G5S9Z4	Enterococcus_phage	40.1	3.8e-16
>prophage 7
NZ_CP046938	Pediococcus pentosaceus strain GDIAS001 chromosome, complete genome	1831351	1442526	1451090	1831351		Synechococcus_phage(33.33%)	9	NA	NA
WP_099299707.1|1442526_1443108_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.2	3.9e-23
WP_158190834.1|1443104_1444154_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D8KLC2	Synechococcus_phage	40.5	1.8e-58
WP_158190835.1|1444153_1445623_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	8.1e-57
WP_158190836.1|1445607_1447815_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	9.7e-147
WP_158190837.1|1447832_1448507_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_158190838.1|1448509_1448764_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002833286.1|1448756_1449485_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	43.4	1.6e-42
WP_158190839.1|1449484_1450624_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_011673684.1|1450607_1451090_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.9	2.6e-20
>prophage 8
NZ_CP046938	Pediococcus pentosaceus strain GDIAS001 chromosome, complete genome	1831351	1460449	1469316	1831351		Streptococcus_phage(33.33%)	10	NA	NA
WP_023440679.1|1460449_1461466_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	30.6	5.6e-33
WP_002833272.1|1461465_1461801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158190844.1|1461816_1462446_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	2.6e-52
WP_002833270.1|1462610_1463210_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002833269.1|1463236_1463551_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_158190845.1|1463566_1465312_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	48.4	2.8e-56
WP_060743850.1|1465523_1466009_-	nucleoside deaminase	NA	A0A2H4PQS8	Staphylococcus_phage	31.6	1.8e-05
WP_158190846.1|1466001_1466607_-	methyltransferase	NA	NA	NA	NA	NA
WP_011673696.1|1466818_1467049_+	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	48.1	8.0e-12
WP_158190847.1|1467150_1469316_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.6	8.9e-254
>prophage 9
NZ_CP046938	Pediococcus pentosaceus strain GDIAS001 chromosome, complete genome	1831351	1687100	1697957	1831351		Bacillus_phage(28.57%)	12	NA	NA
WP_158190920.1|1687100_1688276_+	methyltransferase domain-containing protein	NA	A0A2K9L4K8	Tupanvirus	33.3	3.7e-44
WP_002834110.1|1688426_1688759_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_002834111.1|1688779_1689568_-	branched-chain amino acid ABC transporter	NA	NA	NA	NA	NA
WP_158190921.1|1689699_1690956_-	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	23.8	7.7e-08
WP_011673829.1|1691136_1692273_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.8	2.8e-25
WP_002834114.1|1692284_1692974_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.3	5.7e-37
WP_158190922.1|1693056_1693554_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	G5CRV0	Megavirus	35.6	8.3e-14
WP_011673831.1|1693685_1694828_-	guanosine monophosphate reductase	NA	A0A1V0SHK8	Klosneuvirus	34.0	2.4e-64
WP_158190923.1|1694849_1695554_-	DUF1129 family protein	NA	NA	NA	NA	NA
WP_002834120.1|1695582_1696689_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002834122.1|1696906_1697092_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_158190924.1|1697105_1697957_-	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	35.6	1.6e-12
