The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046939	Klebsiella pneumoniae strain BD_DM_697 chromosome, complete genome	5359090	443117	477119	5359090	integrase,terminase,tail,protease,tRNA,head,capsid,portal	uncultured_Caudovirales_phage(70.59%)	31	453136:453151	470706:470721
WP_004150007.1|443117_444065_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_004174081.1|444079_444589_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
WP_002919139.1|444717_445842_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|445813_446287_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|446313_446856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|446860_447433_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_004181437.1|447436_448255_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|448251_448509_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|448484_449039_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
453136:453151	attL	AGCCCCGGTAAACGGC	NA	NA	NA	NA
WP_002919103.1|455010_455232_-	membrane protein	NA	NA	NA	NA	NA
WP_004144975.1|455524_458635_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|458647_459787_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|460165_460816_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_048288915.1|461119_462343_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	96.8	1.2e-236
WP_075917478.1|462339_463185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156246496.1|463297_463507_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	95.7	1.4e-31
WP_158191781.1|464027_464240_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	49.1	2.9e-08
WP_156246407.1|464232_464445_+	aminotransferase	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	82.5	1.5e-20
WP_032435122.1|464441_464810_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	78.7	9.4e-47
WP_156246409.1|464806_466942_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.1	1.3e-204
WP_064184075.1|467284_467620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435116.1|467668_468181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156246410.1|468458_469619_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	94.0	7.7e-204
WP_016808183.1|469670_470231_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	94.1	1.0e-97
WP_156246411.1|470232_471468_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.4	7.1e-232
470706:470721	attR	GCCGTTTACCGGGGCT	NA	NA	NA	NA
WP_063106301.1|471464_471806_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	44.3	3.7e-21
WP_025861186.1|471798_472092_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	85.6	3.8e-43
WP_064184072.1|472091_472535_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	89.1	5.2e-76
WP_032435105.1|472808_473165_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	94.1	6.7e-58
WP_156246413.1|473148_474810_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	93.5	6.1e-311
WP_064184071.1|474821_477119_+	hypothetical protein	NA	A0A286S1S3	Klebsiella_phage	45.8	1.3e-154
>prophage 2
NZ_CP046939	Klebsiella pneumoniae strain BD_DM_697 chromosome, complete genome	5359090	1244649	1290884	5359090	integrase,terminase,tail,plate,tRNA,head,capsid,lysis,portal,coat	Salmonella_phage(83.33%)	59	1242943:1242989	1279510:1279556
1242943:1242989	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1244649_1245675_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1245677_1246307_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1246429_1246672_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1246704_1247214_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1247221_1247422_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1247385_1247724_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1247791_1248025_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1248024_1248252_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1248248_1249100_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1249096_1251481_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1251643_1251832_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1251843_1252077_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1252172_1252856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1252842_1253922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1253921_1254923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1255444_1255714_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1255770_1256814_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1256813_1258577_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1258717_1259551_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1259567_1260620_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1260623_1261277_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1261372_1261837_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1261836_1262040_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1262043_1262259_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1262239_1262749_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1262753_1263137_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1263133_1263562_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|1263657_1264080_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1264072_1264519_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1264541_1265408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1265502_1266075_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1266071_1266434_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1266420_1267329_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1267321_1267993_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1267994_1269944_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1269953_1271072_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1271123_1272197_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1272345_1273518_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1273527_1274043_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1274095_1274395_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1274409_1274529_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1274521_1277152_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1277148_1277634_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1277630_1278725_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1278791_1279010_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1279037_1279415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1280018_1280501_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1279510:1279556	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1280611_1281088_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1281077_1281368_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1281434_1281776_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1281923_1283585_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1283671_1284550_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1284674_1285265_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1285384_1286671_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1286690_1287482_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1287645_1289010_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1289269_1289518_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1289536_1290085_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1290116_1290884_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP046939	Klebsiella pneumoniae strain BD_DM_697 chromosome, complete genome	5359090	1730740	1737645	5359090	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1730740_1731604_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_023307294.1|1731614_1732388_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1732628_1733522_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1733767_1735129_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1735447_1736170_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1736166_1737645_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 4
NZ_CP046939	Klebsiella pneumoniae strain BD_DM_697 chromosome, complete genome	5359090	2723197	2734084	5359090		Escherichia_phage(87.5%)	9	NA	NA
WP_004179756.1|2723197_2726305_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2726359_2727625_+	MFS transporter	NA	NA	NA	NA	NA
WP_004179755.1|2727655_2728744_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176262.1|2728830_2729091_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|2729388_2730249_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|2730269_2731031_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2731291_2732194_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004179748.1|2732205_2733471_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002210516.1|2733463_2734084_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP046939	Klebsiella pneumoniae strain BD_DM_697 chromosome, complete genome	5359090	2770523	2851780	5359090	integrase,terminase,portal,protease,holin,head,capsid,tail	Klebsiella_phage(47.92%)	91	2799779:2799795	2833043:2833059
WP_085806752.1|2770523_2771261_+|protease	serine protease	protease	NA	NA	NA	NA
WP_004224649.1|2771274_2771391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903683.1|2771434_2771764_-	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_004179723.1|2771750_2772113_-	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903679.1|2772555_2773590_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004176297.1|2773814_2775470_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_004143107.1|2775469_2776312_+	2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase	NA	NA	NA	NA	NA
WP_004143106.1|2776329_2776629_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143105.1|2776621_2777455_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004224637.1|2777454_2778255_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004148291.1|2778391_2779351_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004152239.1|2779354_2779972_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004179720.1|2779971_2780874_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_002903632.1|2780863_2781790_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020324604.1|2781947_2783603_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004179719.1|2783867_2784788_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_004179716.1|2784951_2785308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004179714.1|2785463_2787080_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004176303.1|2787076_2787796_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_004179712.1|2787776_2788727_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_004179710.1|2788794_2791572_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.2	1.1e-65
WP_004148278.1|2792214_2793726_+	anion permease	NA	NA	NA	NA	NA
WP_004152246.1|2793780_2795433_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_004179708.1|2795595_2797212_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004143067.1|2798256_2798646_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_004179700.1|2798638_2799403_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_004179694.1|2799392_2800745_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
2799779:2799795	attL	CCCACTCCGCCTGCCAG	NA	NA	NA	NA
WP_004179693.1|2800754_2801957_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_004151559.1|2801967_2802624_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_002903522.1|2802634_2803321_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004151560.1|2803490_2804297_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143055.1|2804293_2804857_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_002903460.1|2804958_2805867_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004179692.1|2806033_2807344_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004176321.1|2807343_2808789_+	amidohydrolase	NA	NA	NA	NA	NA
WP_017879817.1|2808908_2810027_+	transporter	NA	NA	NA	NA	NA
WP_004146386.1|2810155_2811256_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	2.9e-115
WP_148720230.1|2812627_2812975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156246451.1|2812967_2813414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156246452.1|2813455_2814286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156246454.1|2816388_2819466_-	kinase	NA	A0A286S259	Klebsiella_phage	62.4	0.0e+00
WP_004177128.1|2819462_2819843_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_004177130.1|2819855_2820332_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_004177132.1|2820318_2820792_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004177134.1|2820813_2824392_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	62.6	2.5e-245
WP_004177136.1|2824454_2824976_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	1.7e-09
WP_004177139.1|2825050_2825356_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_029603010.1|2825358_2825763_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.2	3.2e-32
WP_004177142.1|2825793_2826498_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	1.5e-80
WP_004177145.1|2826554_2826902_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	60.2	8.9e-31
WP_004177147.1|2826898_2827348_-	hypothetical protein	NA	Q9MCS9	Enterobacteria_phage	83.2	3.9e-63
WP_032423080.1|2827344_2827683_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	8.3e-42
WP_004177149.1|2827694_2828021_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	69.4	6.2e-42
WP_032442228.1|2828020_2828254_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	68.1	1.5e-10
WP_004177151.1|2828296_2829514_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.1	1.6e-196
WP_029603008.1|2829523_2830372_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	1.0e-128
WP_029603007.1|2830384_2831692_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.1	9.3e-214
WP_032423081.1|2831691_2833434_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.0	6.3e-141
2833043:2833059	attR	CCCACTCCGCCTGCCAG	NA	NA	NA	NA
WP_004177162.1|2833387_2833852_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_156246456.1|2834031_2834373_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	1.3e-47
WP_156246458.1|2834531_2834777_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	61.5	8.8e-17
WP_049124265.1|2835101_2835374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004177174.1|2835506_2835791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032409976.1|2835881_2836076_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	6.9e-25
WP_049257432.1|2836026_2836302_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	49.4	4.1e-15
WP_065519814.1|2836298_2836646_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	79.1	6.8e-39
WP_004177182.1|2836642_2837182_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	2.0e-101
WP_031280382.1|2837178_2837478_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_071717307.1|2838004_2838328_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_049123629.1|2838774_2839557_-	molecular chaperone	NA	F1C595	Cronobacter_phage	79.1	5.0e-114
WP_023317656.1|2839553_2840030_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	98.7	2.6e-89
WP_049257405.1|2840026_2840989_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_074422736.1|2840990_2842649_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|2843223_2843445_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|2843542_2844211_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|2844380_2844695_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|2844687_2844876_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|2845045_2845411_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_029602968.1|2845403_2845658_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	91.7	6.1e-37
WP_004177208.1|2845629_2845848_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_049257403.1|2845844_2846267_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.2	7.7e-53
WP_009309071.1|2846266_2846461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304718.1|2846457_2847285_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	9.3e-111
WP_032422926.1|2847389_2847908_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.3	5.0e-94
WP_040244130.1|2847913_2848630_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	97.9	6.8e-126
WP_023313037.1|2848626_2849190_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.2	2.2e-26
WP_040244128.1|2849186_2849411_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	3.1e-29
WP_029602963.1|2849407_2849809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023313034.1|2849942_2850203_+	hypothetical protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_002903398.1|2850813_2850972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004176326.1|2851264_2851780_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
>prophage 6
NZ_CP046939	Klebsiella pneumoniae strain BD_DM_697 chromosome, complete genome	5359090	3176439	3222109	5359090	integrase,terminase,portal,plate,tRNA,head,capsid,tail	Enterobacteria_phage(54.29%)	54	3181663:3181684	3218371:3218392
WP_004179374.1|3176439_3176940_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3177056_3177503_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3177486_3178278_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004148041.1|3178379_3179564_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004179371.1|3179595_3180288_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3180433_3180943_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3180929_3181286_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004179368.1|3181275_3181515_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3181663:3181684	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004213128.1|3181779_3182031_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_020324077.1|3182074_3183214_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
WP_020324084.1|3183368_3184541_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
WP_004216461.1|3184540_3185056_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
WP_004131585.1|3185101_3185419_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_032440702.1|3185418_3185577_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
WP_020324072.1|3185563_3188539_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
WP_032408799.1|3188554_3189046_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
WP_020324073.1|3189290_3190649_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
WP_020324070.1|3190802_3191900_-|tail	tail fiber protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
WP_020324108.1|3191899_3192112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806131.1|3192108_3195135_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
WP_020324110.1|3195124_3196048_-|plate	baseplate J-like protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
WP_020324083.1|3196049_3196400_-	lysozyme	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
WP_009486481.1|3196396_3196984_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
WP_020324118.1|3196980_3197616_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
WP_020324102.1|3197612_3198080_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
WP_157833084.1|3198080_3198416_-	peptidase	NA	B6SD31	Bacteriophage	33.3	4.3e-06
WP_020324098.1|3198602_3199148_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
WP_020324103.1|3199144_3199429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131559.1|3199419_3199620_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
WP_020324071.1|3199619_3200135_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
WP_020324091.1|3200239_3201106_-|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
WP_020324085.1|3201155_3202190_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_020324109.1|3202200_3203040_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
WP_020324092.1|3203196_3204924_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
WP_044816202.1|3204917_3205979_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
WP_020324074.1|3208128_3209136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324106.1|3209128_3211075_-	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
WP_020324090.1|3211332_3213480_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
WP_020324116.1|3213517_3214453_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
WP_032408797.1|3214685_3215252_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
WP_020324115.1|3215248_3215473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324111.1|3215550_3215814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020324119.1|3215829_3216207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004216643.1|3216222_3216441_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
WP_020806130.1|3216461_3216740_-	regulatory protein Cox	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
WP_004213095.1|3216860_3217160_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_004216842.1|3217275_3218259_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
WP_004176549.1|3218523_3219537_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3218371:3218392	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|3219594_3219696_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004213093.1|3219695_3219770_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3219887_3220013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190891.1|3220072_3220336_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_020324076.1|3220466_3221105_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_008807690.1|3221194_3222109_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
>prophage 7
NZ_CP046939	Klebsiella pneumoniae strain BD_DM_697 chromosome, complete genome	5359090	3501268	3510731	5359090	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_020323882.1|3501268_3502990_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
WP_002898014.1|3503034_3503736_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3504089_3504308_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3504427_3506707_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3506737_3507055_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3507380_3507602_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3507678_3509619_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3509615_3510731_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
NZ_CP046939	Klebsiella pneumoniae strain BD_DM_697 chromosome, complete genome	5359090	3974289	4020828	5359090	head,integrase,terminase,tRNA	Enterobacteria_phage(24.14%)	70	3970224:3970269	4017900:4017945
3970224:3970269	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_077267857.1|3974289_3975333_-	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	41.5	4.4e-17
WP_004196823.1|3975334_3975922_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	3.8e-34
WP_156246482.1|3975914_3977147_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	51.2	1.8e-105
WP_001518114.1|3977154_3977511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064143289.1|3977573_3977861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086059675.1|3977958_3978987_-	hypothetical protein	NA	A0A0P0ZBT0	Stx2-converting_phage	69.8	8.9e-87
WP_064484068.1|3979003_3979171_-	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
WP_077266083.1|3979296_3979650_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_064143291.1|3979663_3980452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064143292.1|3980451_3981039_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	37.2	6.6e-26
WP_047671872.1|3981028_3981898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725008.1|3981894_3982200_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	48.5	3.6e-20
WP_029497460.1|3982201_3983041_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.9	4.5e-28
WP_156246484.1|3983044_3985057_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	57.1	2.3e-38
WP_047671971.1|3985258_3985735_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	30.5	8.5e-08
WP_088607471.1|3985787_3986042_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	76.2	1.4e-20
WP_043875683.1|3986044_3986800_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.8	2.8e-61
WP_023304864.1|3986980_3987424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103113570.1|3987423_3988905_-	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	34.6	2.3e-59
WP_103113571.1|3988908_3989460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048279608.1|3989441_3989810_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	9.5e-07
WP_064190368.1|3989806_3990370_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	33.3	3.0e-20
WP_040218276.1|3990372_3990816_-	DUF4054 domain-containing protein	NA	E2GLV0	Acinetobacter_phage	41.7	1.3e-13
WP_040218278.1|3990815_3991142_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.6	4.8e-10
WP_009308036.1|3991143_3992181_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.3	6.5e-85
WP_040218280.1|3992180_3992663_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	49.7	1.7e-32
WP_087749015.1|3992664_3993834_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.3	5.8e-58
WP_103113572.1|3993837_3994536_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	5.4e-59
WP_117054210.1|3994588_3996109_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.4	5.2e-107
WP_088607467.1|3996109_3997786_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.3	3.9e-249
WP_019725076.1|3997787_3998273_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	79.5	4.1e-66
WP_086625994.1|3998304_3998940_-	hypothetical protein	NA	I6S676	Salmonella_phage	81.6	9.4e-103
WP_107326673.1|3999398_3999788_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	50.0	1.6e-25
WP_080876462.1|3999784_4000288_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	1.3e-75
WP_029884058.1|4000290_4000605_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	4.9e-44
WP_086625988.1|4001236_4001926_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	4.2e-64
WP_086625986.1|4001922_4002063_-	YlcG family protein	NA	NA	NA	NA	NA
WP_064147578.1|4002059_4002284_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	60.3	1.7e-22
WP_086625984.1|4002280_4002862_-	protein NinG	NA	E7C9S3	Salmonella_phage	50.2	4.9e-42
WP_086625982.1|4002854_4003025_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	75.0	1.5e-15
WP_004884220.1|4003024_4003480_-	dLP12 prophage	NA	K7P7B8	Enterobacteria_phage	69.5	1.0e-55
WP_032418538.1|4003739_4003979_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
WP_080831306.1|4003971_4004277_-	hypothetical protein	NA	K7PJS3	Enterobacterial_phage	61.0	1.4e-27
WP_116431168.1|4004273_4004660_-	hypothetical protein	NA	V5UT79	Shigella_phage	38.0	5.6e-10
WP_117054208.1|4004832_4005609_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	50.6	5.1e-34
WP_086625976.1|4005605_4006100_-	hypothetical protein	NA	A0A2H4J4Q4	uncultured_Caudovirales_phage	58.5	1.1e-45
WP_088607465.1|4006096_4006633_-	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	49.7	7.1e-27
WP_004151295.1|4006629_4006923_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_040182092.1|4006919_4007768_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.8	1.2e-89
WP_156246486.1|4007764_4008625_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	6.0e-60
WP_001548453.1|4008710_4008932_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|4008972_4009200_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_047671980.1|4009311_4010010_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	6.2e-108
WP_012542633.1|4010155_4010560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032717012.1|4011263_4011458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064162984.1|4011545_4012547_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	90.4	4.2e-65
WP_048986756.1|4012554_4012839_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_117054207.1|4012854_4013700_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.3	4.5e-68
WP_064162982.1|4013696_4014377_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.0	7.4e-122
WP_072056946.1|4014373_4014532_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	58.8	1.9e-09
WP_064162981.1|4014528_4015056_+	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.6	3.8e-57
WP_064162980.1|4015052_4015823_+	hypothetical protein	NA	D5LH17	Escherichia_phage	52.8	9.4e-65
WP_064162979.1|4015819_4016038_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	45.6	1.7e-08
WP_064162978.1|4016090_4016258_+	conjugal transfer protein TraR	NA	A0A0K2FI84	Escherichia_phage	56.9	2.7e-09
WP_040186416.1|4016257_4016497_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	43.6	4.6e-10
WP_004223135.1|4016509_4016845_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_065807573.1|4016721_4017885_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.1	2.9e-203
WP_004143017.1|4018316_4019183_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4017900:4017945	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4019184_4019397_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4019442_4020828_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP046940	Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed1	153682	784	56456	153682	integrase,transposase	Escherichia_phage(33.33%)	37	24923:24982	55697:56520
WP_001389365.1|784_1549_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|1691_1958_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|2178_2652_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|4262_4967_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014386481.1|5839_6484_-	quinolone resistance pentapeptide repeat protein QnrB1	NA	NA	NA	NA	NA
WP_001553819.1|8891_11789_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|11883_12489_+	DNA invertase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|13265_13658_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|13795_14680_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|14711_15911_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|16016_16667_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|16698_16941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|18562_19267_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|19410_19965_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|20095_20926_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|21557_22262_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|22368_23229_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_002063889.1|23241_23784_+	AAA family ATPase	NA	NA	NA	NA	NA
24923:24982	attL	ATTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACA	NA	NA	NA	NA
WP_001067855.1|24977_25682_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_065305459.1|29084_29960_+	TEM family class A beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	9.4e-154
WP_015065549.1|30327_30636_+	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.4	1.7e-17
WP_015065550.1|30739_31291_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.7	1.8e-17
WP_014386216.1|31904_31982_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_158192018.1|32086_32527_+	replication protein	NA	NA	NA	NA	NA
WP_158192026.1|38922_39558_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|39589_39832_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001161490.1|42857_43418_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000454193.1|43593_43944_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|44146_45160_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|45326_46169_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_158192027.1|46257_47049_+	AadA family aminoglycoside 3''-O-nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000095725.1|47310_48570_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_000034420.1|49768_50560_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|51028_51274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054377175.1|51311_52175_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_000018329.1|54746_55562_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|55751_56456_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
55697:56520	attR	ATTGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCC	NA	NA	NA	NA
>prophage 1
NZ_CP046941	Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed2	150240	0	71753	150240	tail,terminase,integrase	Salmonella_phage(87.72%)	65	8374:8390	43589:43605
WP_021313779.1|0_1098_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	49.7	2.1e-73
WP_014342074.1|1549_1762_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	80.0	4.3e-28
WP_021313780.1|1761_2097_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	1.0e-36
WP_040205269.1|2805_3882_-	recombinase	NA	J9Q736	Salmonella_phage	96.1	8.5e-197
WP_019704549.1|3884_4151_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
WP_023279491.1|4150_5095_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	93.0	3.1e-171
WP_023279490.1|5155_6163_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	87.6	2.3e-143
WP_023279489.1|6282_6714_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	90.9	3.1e-65
WP_023279488.1|7063_7279_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	80.0	4.5e-25
WP_032414135.1|7431_7875_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	82.3	2.2e-58
WP_023279486.1|7871_11390_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.3	0.0e+00
8374:8390	attL	GCCATGCGAGTCATCAG	NA	NA	NA	NA
WP_019704545.1|11570_12803_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	86.6	1.3e-212
WP_023279485.1|12899_15179_-	hypothetical protein	NA	J9Q7G6	Salmonella_phage	61.9	1.0e-244
WP_014342091.1|15781_16162_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032414134.1|16156_17257_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	30.0	9.4e-18
WP_052951219.1|17607_17967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_117286227.1|18031_18442_-	toxin YafO	NA	NA	NA	NA	NA
WP_156246515.1|18451_19069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026005930.1|19163_19409_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	5.3e-14
WP_114267418.1|19538_20384_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.8	8.4e-91
WP_156246517.1|20531_22070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019704538.1|22996_23413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279477.1|23560_23776_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	78.6	8.5e-24
WP_101972435.1|23878_25201_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	86.1	1.8e-228
WP_094818860.1|25200_25668_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	64.1	1.3e-48
WP_156246519.1|25747_26536_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	50.4	2.9e-69
WP_032443551.1|28037_29156_-	hypothetical protein	NA	J9Q720	Salmonella_phage	91.3	1.4e-202
WP_032440528.1|29309_30650_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
WP_023279420.1|30714_31440_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.8	2.5e-128
WP_158192028.1|31613_32537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158192029.1|32642_33377_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	26.9	1.1e-11
WP_004110193.1|33373_33736_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.2e-43
WP_021313115.1|33735_34401_-	P-loop NTPase	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
WP_023279422.1|34720_35278_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	43.2	4.0e-33
WP_023279424.1|35474_35726_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	72.3	7.6e-24
WP_023279425.1|35728_36421_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.1	9.2e-120
WP_004109805.1|36434_36758_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_044531948.1|36848_38294_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	1.0e-40
WP_158192030.1|38416_50518_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	60.7	3.1e-29
43589:43605	attR	GCCATGCGAGTCATCAG	NA	NA	NA	NA
WP_019704527.1|50534_51146_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	72.1	1.1e-76
WP_004109817.1|51133_51931_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
WP_004109820.1|51923_52622_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_004109823.1|52708_53044_-|tail	tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
WP_023279429.1|53087_57623_-	tape measure protein	NA	J9Q712	Salmonella_phage	70.0	0.0e+00
WP_004109830.1|57630_57864_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
WP_004109835.1|57980_58298_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_023279430.1|58359_59106_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	82.6	8.1e-106
WP_023279431.1|59173_59566_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	68.3	5.9e-47
WP_021313126.1|59567_60041_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|60031_60376_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_023279432.1|60473_61307_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	2.4e-130
WP_023279433.1|61306_61741_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_023279434.1|61788_62217_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	70.6	1.8e-28
WP_004109857.1|62295_63174_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.2	4.7e-153
WP_023279435.1|63200_64100_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	6.1e-124
WP_094307870.1|64122_65712_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.7	1.8e-275
WP_004109863.1|65729_66986_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|66988_67630_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|67805_68072_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109872.1|68081_68972_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_023279436.1|68968_69520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279437.1|69509_70151_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.2	2.3e-109
WP_023279438.1|70147_70816_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	91.9	6.6e-107
WP_032414131.1|70815_71496_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	89.3	1.0e-107
WP_156246523.1|71579_71753_+	hypothetical protein	NA	J9Q7I4	Salmonella_phage	86.8	5.6e-18
>prophage 2
NZ_CP046941	Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed2	150240	76020	118356	150240	protease,holin,terminase,tail,head,capsid	Klebsiella_phage(58.33%)	56	NA	NA
WP_156246528.1|76020_77538_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	43.7	2.7e-71
WP_156246530.1|78109_81178_-	kinase	NA	A0A286S259	Klebsiella_phage	97.9	0.0e+00
WP_040244194.1|81174_81555_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	97.6	9.6e-71
WP_156246532.1|81564_82047_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	96.2	2.8e-83
WP_156246533.1|82033_82513_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	98.1	1.5e-92
WP_156246534.1|82512_84960_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	66.3	5.9e-278
WP_064153924.1|85004_85472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004143895.1|85537_85801_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.8	5.9e-43
WP_001177591.1|85833_86187_-|tail	phage tail assembly protein	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_000115125.1|86230_86722_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	100.0	2.3e-88
WP_064153923.1|86778_87144_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	93.4	7.8e-62
WP_064153922.1|87140_87680_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	1.1e-91
WP_004184710.1|87672_88005_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_004143899.1|88006_88204_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	100.0	1.7e-26
WP_044067369.1|88539_88782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042346268.1|88818_89982_-|capsid	phage major capsid protein	capsid	A0A286S1R4	Klebsiella_phage	99.0	1.5e-210
WP_004216821.1|89993_90674_-|head,protease	HK97 family phage prohead protease	head,protease	A0A286S1N1	Klebsiella_phage	100.0	1.6e-124
WP_158192033.1|91960_93493_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	99.6	1.9e-295
WP_004143905.1|93502_93937_-	hypothetical protein	NA	A0A286S1P9	Klebsiella_phage	100.0	6.2e-74
WP_158192034.1|94058_94268_-	serine acetyltransferase	NA	A0A286N2R4	Klebsiella_phage	81.2	3.1e-23
WP_047663025.1|94280_94571_-	HNH endonuclease	NA	A0A286N2R3	Klebsiella_phage	96.9	2.0e-52
WP_064153921.1|94639_95194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064153920.1|95263_95509_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	92.6	9.7e-32
WP_064279261.1|95613_95898_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	70.2	5.8e-28
WP_031591484.1|96039_96315_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	44.4	4.7e-11
WP_023304728.1|96322_96952_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	6.9e-106
WP_019705280.1|96951_97233_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_017145563.1|97219_97615_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_031280381.1|98177_98624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184721.1|98529_98787_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	100.0	1.3e-42
WP_158192035.1|98940_99723_-	antitermination protein	NA	F1C595	Cronobacter_phage	77.1	6.1e-112
WP_032439905.1|99719_100196_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	99.4	3.1e-90
WP_049245617.1|100192_101155_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.1	8.1e-183
WP_074192665.1|101156_102815_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.4	0.0e+00
WP_049245616.1|103529_103763_-	transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	63.9	2.2e-17
WP_023304723.1|103903_104578_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	78.6	8.7e-99
WP_032442236.1|105336_105561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023304721.1|105561_105927_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	97.5	5.8e-57
WP_004177208.1|106144_106363_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
WP_158192036.1|106359_106776_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	75.7	4.2e-51
WP_032422926.1|107902_108421_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.3	5.0e-94
WP_040244128.1|109691_109916_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	90.5	3.1e-29
WP_158192037.1|109912_110191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156246536.1|110828_112259_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	2.2e-256
WP_004109887.1|112261_112537_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
WP_004109889.1|112587_113025_-	hypothetical protein	NA	A0A1V0E8D6	Vibrio_phage	37.0	9.5e-14
WP_014342147.1|113180_113711_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	84.5	3.5e-71
WP_123827665.1|113720_114020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109892.1|114344_114995_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_004109904.1|115045_115249_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_023279442.1|115841_116324_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.0	3.8e-64
WP_021313141.1|116529_116811_-	ABC transporter	NA	J9Q753	Salmonella_phage	84.9	2.4e-42
WP_004109918.1|116937_117345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279444.1|117464_117776_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	67.0	2.3e-30
WP_023279445.1|117912_118125_-	hypothetical protein	NA	J9Q804	Salmonella_phage	77.9	4.4e-25
WP_023279446.1|118137_118356_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	80.6	1.1e-26
>prophage 3
NZ_CP046941	Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed2	150240	129529	149919	150240		Salmonella_phage(91.67%)	24	NA	NA
WP_021313148.1|129529_129745_-	hypothetical protein	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
WP_023279510.1|129873_130452_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	56.5	1.1e-54
WP_014342167.1|130579_130735_-	hypothetical protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
WP_019704567.1|130734_131160_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
WP_023279509.1|131460_132000_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	47.1	5.8e-29
WP_019704565.1|132157_132745_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	80.2	3.4e-91
WP_023279508.1|133317_133551_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.0	7.8e-31
WP_023279507.1|133748_134342_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.3	5.9e-99
WP_023279506.1|134526_135360_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	56.4	5.1e-64
WP_023279505.1|135485_136043_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	84.2	1.4e-86
WP_023279504.1|136052_136472_-	hypothetical protein	NA	J9Q743	Salmonella_phage	74.1	6.5e-52
WP_023279503.1|136535_137180_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	77.6	4.7e-94
WP_023279502.1|137179_137656_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	79.6	4.9e-72
WP_023279501.1|137652_138066_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	77.4	4.7e-55
WP_023279500.1|138067_139171_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
WP_023279499.1|139364_140240_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	J9Q742	Salmonella_phage	85.1	1.2e-140
WP_014342181.1|140317_141460_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
WP_023279498.1|141590_143894_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.9	0.0e+00
WP_021313773.1|143969_144539_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	89.9	1.1e-94
WP_023279497.1|144548_145295_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	61.7	2.9e-79
WP_032440510.1|145284_147201_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	84.5	2.1e-299
WP_021313776.1|147430_148516_-	exonuclease	NA	J9Q7S9	Salmonella_phage	84.8	1.1e-183
WP_021313777.1|148704_149199_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	67.1	1.0e-59
WP_023279495.1|149274_149919_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	2.2e-99
