The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP039934	Myroides sp. CJ210 chromosome, complete genome	3766904	613484	669558	3766904	protease,integrase,tRNA,transposase	Shigella_phage(16.67%)	51	613456:613515	670373:670591
613456:613515	attL	TGAACGTCCCTAAATATGGTTGACCGTTTTTAAACATTAACTTCATTATTAAATATAGTA	NA	NA	NA	NA
WP_158964142.1|613484_613706_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158961335.1|613675_614215_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	30.0	9.3e-11
WP_158961336.1|614328_614727_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158961337.1|614892_615960_-	phytase	NA	NA	NA	NA	NA
WP_158961338.1|615959_616958_-	acid phosphatase	NA	NA	NA	NA	NA
WP_158964144.1|617027_619865_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_158961339.1|620790_622182_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_158961340.1|622298_623021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158961341.1|623035_623689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158961342.1|623945_624407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158961343.1|624409_624559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158961344.1|624700_625333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158961345.1|625421_626072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158961346.1|626447_627782_-	MFS transporter	NA	NA	NA	NA	NA
WP_158961347.1|627854_628538_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_158961348.1|628555_629578_-	type IX secretion system protein PorQ	NA	NA	NA	NA	NA
WP_158961349.1|629859_632331_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	40.1	5.2e-157
WP_158961350.1|632517_633531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158961351.1|633623_634925_-	MFS transporter	NA	NA	NA	NA	NA
WP_158961352.1|634995_635805_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_158961353.1|636659_637019_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_158961354.1|638164_639037_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_158961355.1|639063_639456_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_158961356.1|639493_640225_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_158961357.1|640327_640699_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_158961358.1|640718_642683_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	45.6	5.0e-102
WP_158961359.1|642826_643399_+	lactate utilization protein B/C	NA	NA	NA	NA	NA
WP_158961360.1|643402_644191_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_158961361.1|644194_644848_+	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_158961362.1|644847_645117_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_158961363.1|645113_645881_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_158961364.1|646780_648319_-	replicative DNA helicase	NA	S0A403	Cellulophaga_phage	45.6	2.6e-98
WP_158961365.1|648467_649421_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_158961366.1|649485_650379_-	EamA family transporter	NA	NA	NA	NA	NA
WP_158961367.1|650365_651439_-	LptF/LptG family permease	NA	NA	NA	NA	NA
WP_158961368.1|651476_652607_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.4	2.4e-77
WP_158961369.1|652682_653696_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_158961370.1|653692_654835_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_158961371.1|655624_656665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158961372.1|657016_657541_+	DUF4252 domain-containing protein	NA	NA	NA	NA	NA
WP_158961373.1|657930_658323_-	VOC family protein	NA	NA	NA	NA	NA
WP_158961374.1|658398_658938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158961375.1|659014_659419_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_158961376.1|659464_660298_-	DUF3808 domain-containing protein	NA	NA	NA	NA	NA
WP_158961377.1|660397_663262_-	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.3	1.3e-21
WP_158964146.1|663254_663650_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_158961378.1|664262_664913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158961379.1|664922_665372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158961380.1|665589_667512_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_158961381.1|667853_668903_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_158961336.1|669159_669558_+|transposase	transposase	transposase	NA	NA	NA	NA
670373:670591	attR	TACTATATTTAATAATGAAGTTAATGTTTAAAAACGGTCAACCATATTTAGGGACGTTCACTGCGCTCCGATTTCCCCTCTCTTCTCTCTTCTCTCTATTCTTAACAGCAACCAGAATTAGGATCACAACAAGAACTTGCCGTTTCTGGTAAATCTTCTGGTTTGATCCCACAGGCATCTTCAGCCAAACAAGCCGTTAAAGTGTTGACCAAGATAAAA	NA	NA	NA	NA
>prophage 2
NZ_CP039934	Myroides sp. CJ210 chromosome, complete genome	3766904	1167755	1174465	3766904		Bacillus_phage(33.33%)	7	NA	NA
WP_158961785.1|1167755_1168451_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	45.3	5.2e-14
WP_158961786.1|1168678_1170037_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.2	3.9e-21
WP_158961787.1|1170026_1170728_-	response regulator	NA	W8CYM9	Bacillus_phage	35.1	1.1e-30
WP_158961788.1|1170827_1171151_-	single-stranded DNA-binding protein	NA	A0A2I6UGD9	Salinibacter_virus	39.3	1.2e-16
WP_158961789.1|1171285_1172812_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_158961790.1|1172994_1173870_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.4	2.4e-16
WP_158964177.1|1173856_1174465_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A1V0SJ11	Klosneuvirus	46.6	8.6e-21
>prophage 3
NZ_CP039934	Myroides sp. CJ210 chromosome, complete genome	3766904	2189208	2196441	3766904		Cellulophaga_phage(85.71%)	11	NA	NA
WP_158962573.1|2189208_2189631_+	hypothetical protein	NA	S0A3Z9	Cellulophaga_phage	45.5	1.6e-21
WP_158962574.1|2189633_2190341_+	hypothetical protein	NA	S0A4I7	Cellulophaga_phage	33.9	1.9e-24
WP_158962575.1|2190416_2190647_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158962576.1|2190711_2191365_+	hypothetical protein	NA	S0A194	Cellulophaga_phage	38.0	1.9e-26
WP_158962577.1|2191367_2192843_+	AAA family ATPase	NA	S0A403	Cellulophaga_phage	50.1	6.5e-131
WP_158962578.1|2193004_2193280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158962579.1|2193315_2193591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158962580.1|2193571_2193883_+	HNH endonuclease	NA	A0A1Q1PW15	Staphylococcus_phage	43.0	8.9e-06
WP_158962581.1|2193990_2194491_+	hypothetical protein	NA	S0A0N0	Cellulophaga_phage	44.9	1.5e-26
WP_158962582.1|2194501_2194729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158962583.1|2194725_2196441_+	hypothetical protein	NA	S0A2U5	Cellulophaga_phage	49.1	6.1e-157
