The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047030	Algibacter sp. L3A6 chromosome, complete genome	4618330	440168	480522	4618330	integrase,transposase	Leptospira_phage(25.0%)	34	461575:461609	487173:487207
WP_159021058.1|440168_440963_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	34.5	1.5e-33
WP_159018037.1|441132_441603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018038.1|441844_442285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018039.1|442405_442663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018040.1|442997_443570_+	DUF4738 domain-containing protein	NA	NA	NA	NA	NA
WP_159018041.1|444369_444864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018042.1|446253_447006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018043.1|447050_448022_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159018044.1|448390_448840_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159018045.1|449275_449668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018046.1|449780_450302_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159021044.1|450220_451135_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.7	3.7e-76
WP_159018047.1|452767_453079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018048.1|453198_457533_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_159018049.1|457537_458743_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_117881269.1|458745_459162_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_159018050.1|459217_461170_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.3	8.1e-105
461575:461609	attL	ACTGAATTTTCCTGAAATAGGTTGACTAAAAATTA	NA	NA	NA	NA
WP_159018051.1|461672_462407_-	SOS response-associated peptidase	NA	S5VY94	Leptospira_phage	28.7	7.2e-06
WP_159018052.1|462441_463701_-	DUF4113 domain-containing protein	NA	I6RSM4	Salmonella_phage	42.9	1.5e-91
WP_159018053.1|463701_464151_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.5	3.5e-27
WP_159018054.1|464249_465317_-	T9SS type A sorting domain-containing protein	NA	A0A2P0VMP9	Tetraselmis_virus	31.9	1.6e-17
WP_159018055.1|466274_467459_-	helicase	NA	NA	NA	NA	NA
WP_159018056.1|467462_467801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159018057.1|467820_468111_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159018058.1|468234_470286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159018059.1|470292_471510_-|integrase	tyrosine-type recombinase/integrase	integrase	H7BUI8	unidentified_phage	23.1	4.7e-10
WP_159018060.1|471873_472524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018061.1|472724_473960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018043.1|474009_474981_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159018062.1|475335_475929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018063.1|476179_476485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018064.1|476530_477316_+	GLPGLI family protein	NA	NA	NA	NA	NA
WP_159018065.1|477429_479949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159018066.1|480150_480522_+|transposase	transposase	transposase	NA	NA	NA	NA
487173:487207	attR	ACTGAATTTTCCTGAAATAGGTTGACTAAAAATTA	NA	NA	NA	NA
