The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047037	Rhodobacter sphaeroides strain 2.4.1 substr. H2 chromosome 1, complete sequence	3188040	216364	245728	3188040	capsid,tail,transposase,portal,head,terminase	Paracoccus_phage(30.77%)	25	NA	NA
WP_080588209.1|216364_216589_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011336890.1|219340_220177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011336892.1|221214_221859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011336893.1|222072_222555_-	hypothetical protein	NA	F8TVB7	EBPR_siphovirus	47.0	7.1e-10
WP_011336894.1|222567_223377_-	hypothetical protein	NA	A0A0B5A5A2	Paracoccus_phage	50.2	3.8e-64
WP_011336895.1|223430_224237_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	56.6	9.8e-81
WP_011336897.1|225649_226039_+	response regulator	NA	NA	NA	NA	NA
WP_011336898.1|226109_226427_-	hypothetical protein	NA	I3UM16	Rhodobacter_phage	58.9	2.1e-23
WP_162482714.1|226560_226899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337195.1|226902_227220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337196.1|227226_228711_-	hypothetical protein	NA	G8DH61	Emiliania_huxleyi_virus	32.5	1.6e-12
WP_023003549.1|234760_235006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337201.1|235462_235906_-	hypothetical protein	NA	A0A2P1N076	Streptomyces_phage	33.3	1.8e-07
WP_011336907.1|235915_236296_-	DUF3168 domain-containing protein	NA	A0A0U2BX31	Paracoccus_phage	55.6	2.0e-28
WP_011336908.1|236299_236467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011336909.1|236463_236937_-	hypothetical protein	NA	A0A0U2C0P4	Paracoccus_phage	51.9	1.1e-26
WP_011336910.1|236933_237266_-|head,tail	head-tail adaptor protein	head,tail	A0A0U2BXJ0	Paracoccus_phage	44.5	2.0e-16
WP_011336911.1|237262_237769_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_011336912.1|237773_238064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011336913.1|238197_239532_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	37.4	7.1e-52
WP_011336914.1|239785_240529_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_011336915.1|240539_241499_-	S49 family peptidase	NA	I3ULZ8	Rhodobacter_phage	36.2	3.0e-20
WP_011336916.1|241495_242764_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	25.8	6.6e-23
WP_011336917.1|242877_243750_-	EamA family transporter	NA	NA	NA	NA	NA
WP_011336918.1|244069_245728_-|terminase	terminase	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	32.3	1.7e-79
>prophage 2
NZ_CP047037	Rhodobacter sphaeroides strain 2.4.1 substr. H2 chromosome 1, complete sequence	3188040	630617	665312	3188040	tail,protease,portal,head,terminase	Paracoccus_phage(27.27%)	29	NA	NA
WP_011337174.1|630617_631352_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011337175.1|631367_631664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023003546.1|631670_632348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337177.1|632489_632687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017140100.1|632781_633435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011337179.1|633903_634356_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011337180.1|634594_635347_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011337182.1|635705_636560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011337187.1|641141_642353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011337188.1|642349_644155_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_011337189.1|644147_644666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011337190.1|644820_645318_-	hypothetical protein	NA	F8TVB7	EBPR_siphovirus	47.0	5.6e-10
WP_011337191.1|645330_646140_-	hypothetical protein	NA	A0A0B5A5A2	Paracoccus_phage	50.0	4.9e-64
WP_011337192.1|646194_647001_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	57.8	1.6e-83
WP_011337193.1|647305_648211_+	DMT family transporter	NA	NA	NA	NA	NA
WP_011336898.1|648281_648599_-	hypothetical protein	NA	I3UM16	Rhodobacter_phage	58.9	2.1e-23
WP_011337195.1|649075_649393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147176079.1|649399_650215_-	hypothetical protein	NA	A0A0S3UG21	Pseudomonas_phage	30.8	2.6e-12
WP_162482722.1|650436_650760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023003549.1|656934_657180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337201.1|657636_658080_-	hypothetical protein	NA	A0A2P1N076	Streptomyces_phage	33.3	1.8e-07
WP_011337202.1|658089_658470_-	DUF3168 domain-containing protein	NA	A0A0U2BX31	Paracoccus_phage	53.2	3.8e-27
WP_011337203.1|658473_659031_-	hypothetical protein	NA	A0A0U2C0P4	Paracoccus_phage	37.3	2.9e-15
WP_011337204.1|659030_659363_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_011337205.1|659359_659701_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_162482723.1|659744_660131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337208.1|661516_662356_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	58.1	1.4e-69
WP_011337209.1|662352_663603_-|portal	phage portal protein	portal	M4QP41	Tetraselmis_viridis_virus	40.3	5.8e-80
WP_011337210.1|663602_665312_-|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	41.9	6.2e-133
>prophage 4
NZ_CP047037	Rhodobacter sphaeroides strain 2.4.1 substr. H2 chromosome 1, complete sequence	3188040	1622284	1696046	3188040	tRNA,capsid,tail,protease,portal,head,terminase	Paracoccus_phage(27.27%)	47	NA	NA
WP_017140224.1|1622284_1624027_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011337866.1|1624102_1624588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002720104.1|1625349_1625805_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_011337869.1|1625827_1626856_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011337870.1|1626880_1627693_-	glutamate racemase	NA	NA	NA	NA	NA
WP_011337872.1|1631372_1632266_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011337874.1|1635107_1635350_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_002720111.1|1635410_1635776_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_002720112.1|1635996_1636371_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017140225.1|1636363_1636831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140226.1|1639176_1639470_-	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_002720117.1|1641046_1642048_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002720118.1|1642257_1642413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002720120.1|1642998_1643433_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_009565364.1|1644484_1645984_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002720124.1|1647417_1647621_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_009565362.1|1647855_1650714_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.0	0.0e+00
WP_029534511.1|1652170_1653565_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_002720129.1|1654434_1655691_-	MFS transporter	NA	NA	NA	NA	NA
WP_011337883.1|1655770_1656811_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002720132.1|1660270_1660732_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_011337885.1|1661142_1662486_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	46.7	1.5e-20
WP_162482791.1|1662539_1662995_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_011337887.1|1663190_1663967_-	DUF2189 domain-containing protein	NA	NA	NA	NA	NA
WP_002720136.1|1664335_1665463_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_011337888.1|1665571_1668121_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_011337890.1|1669494_1670646_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011337891.1|1670813_1671557_+	DsbA family protein	NA	NA	NA	NA	NA
WP_011337892.1|1671891_1673025_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_017140227.1|1673155_1674370_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011337894.1|1674480_1675704_-	5-aminolevulinate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	3.6e-34
WP_023003635.1|1679867_1680200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023003637.1|1680232_1683850_-	hypothetical protein	NA	A0A0U2C146	Paracoccus_phage	37.0	1.3e-103
WP_023003639.1|1683849_1684275_-	hypothetical protein	NA	S4TR39	Salmonella_phage	31.4	1.3e-10
WP_011337903.1|1685008_1685653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023003642.1|1685656_1687978_-	hypothetical protein	NA	A0A2H4PI09	Pseudomonas_phage	29.6	8.6e-21
WP_023003644.1|1688038_1688308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023003646.1|1688382_1688715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011337905.1|1688841_1689327_-	HNH endonuclease	NA	Q6XQ94	Escherichia_phage	39.5	4.2e-18
WP_023003648.1|1689492_1689912_-|tail	phage major tail protein 2	tail	NA	NA	NA	NA
WP_023003649.1|1689975_1690344_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_023003651.1|1690349_1690814_-	HK97 gp10 family phage protein	NA	A0A0U2C0P4	Paracoccus_phage	34.0	4.1e-15
WP_011337908.1|1690814_1691132_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_011337910.1|1691496_1692606_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_011337911.1|1692678_1693203_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	50.6	3.0e-30
WP_011337912.1|1693199_1694426_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	30.8	7.5e-32
WP_017140232.1|1694465_1696046_-|terminase	terminase	terminase	A0A286S1M9	Klebsiella_phage	53.3	8.5e-145
>prophage 5
NZ_CP047037	Rhodobacter sphaeroides strain 2.4.1 substr. H2 chromosome 1, complete sequence	3188040	1850924	1926613	3188040	integrase,tRNA,capsid,protease,portal,terminase	Tupanvirus(20.0%)	59	1848767:1848814	1851833:1851880
1848767:1848814	attL	TGGAGGCGGGTACCGGAATCGAACCGGTCTTCACGGATTTGCAATCCG	NA	NA	NA	NA
WP_011338017.1|1850924_1851758_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_011338019.1|1852864_1853215_-	hypothetical protein	NA	NA	NA	NA	NA
1851833:1851880	attR	TGGAGGCGGGTACCGGAATCGAACCGGTCTTCACGGATTTGCAATCCG	NA	NA	NA	NA
WP_011338020.1|1853896_1854295_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_002720283.1|1854315_1854543_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_011338021.1|1854555_1855125_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_002720285.1|1855445_1856780_-	trigger factor	NA	NA	NA	NA	NA
WP_017140239.1|1857644_1858481_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_023003675.1|1858477_1859179_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_002720289.1|1859330_1859669_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_002720290.1|1859751_1861161_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_009566212.1|1861353_1862406_-	response regulator	NA	NA	NA	NA	NA
WP_009566213.1|1862402_1862840_-	response regulator	NA	NA	NA	NA	NA
WP_011338023.1|1862836_1864321_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002720294.1|1864637_1865756_+	AAA family ATPase	NA	A0A1L2CUT3	Pectobacterium_phage	31.8	1.7e-27
WP_011338025.1|1865752_1867063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011338027.1|1868089_1868962_-	3-hydroxyisobutyrate dehydrogenase	NA	A0A077SLF7	Escherichia_phage	31.5	3.0e-19
WP_011338030.1|1871249_1871543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011338031.1|1871750_1872650_-	beta-mannanase	NA	NA	NA	NA	NA
WP_011338033.1|1874530_1875523_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	35.6	4.1e-44
WP_011338034.1|1875515_1876553_-	SDR family oxidoreductase	NA	A0A2K9KZK0	Tupanvirus	46.3	3.0e-74
WP_002720305.1|1877438_1878515_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002720306.1|1878631_1878823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011338036.1|1878893_1880567_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002720309.1|1880719_1880974_-	DUF2312 domain-containing protein	NA	A0A1X9HX62	Ruegeria_phage	76.6	4.1e-25
WP_002720310.1|1881110_1881326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011338037.1|1881731_1882049_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_162482751.1|1882375_1882855_+	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_002720316.1|1886844_1887135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002720317.1|1887131_1887500_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.1e-15
WP_011338041.1|1887660_1888947_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_011338042.1|1889083_1889929_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011338043.1|1889938_1890679_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.8	5.6e-14
WP_011338044.1|1890871_1891813_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_011338045.1|1891850_1893632_-	dihydroxy-acid dehydratase family protein	NA	NA	NA	NA	NA
WP_002720324.1|1895356_1896337_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011338047.1|1896366_1897218_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002720326.1|1897214_1898078_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011338050.1|1902034_1902667_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011338051.1|1903509_1904814_-	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_002720333.1|1904885_1905425_-	DedA family protein	NA	NA	NA	NA	NA
WP_011338052.1|1905488_1906826_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002720335.1|1907097_1907592_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_011338054.1|1907599_1908946_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_011338055.1|1908965_1909610_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_002720338.1|1909558_1909930_-	DUF2155 domain-containing protein	NA	NA	NA	NA	NA
WP_002720339.1|1909926_1910397_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_002720340.1|1910396_1910771_-	NADH:ubiquinone oxidoreductase subunit NDUFA12	NA	NA	NA	NA	NA
WP_061350849.1|1910895_1912161_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	2.0e-133
WP_002720342.1|1912285_1912918_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	61.0	5.2e-61
WP_011338057.1|1913084_1913693_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_011338058.1|1913807_1915013_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011338060.1|1916694_1917339_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_002720349.1|1917471_1917942_+	CAP domain-containing protein	NA	A0A0E3T7R5	Bacillus_phage	34.4	4.3e-12
WP_017140245.1|1920597_1920876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011338064.1|1920888_1921395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011338065.1|1921430_1921937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011338066.1|1921938_1923000_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_017140247.1|1923556_1924819_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_017140248.1|1925134_1926613_-|terminase	terminase	terminase	NA	NA	NA	NA
>prophage 1
NZ_CP047038	Rhodobacter sphaeroides strain 2.4.1 substr. H2 chromosome 2, complete sequence	944373	371596	430349	944373	protease,integrase,transposase,tail	Vibrio_phage(13.33%)	46	373354:373372	400088:400106
WP_011339201.1|371596_372973_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_011339201.1|373207_374584_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
373354:373372	attL	CGAGGACGGCGCGGCGGCA	NA	NA	NA	NA
WP_011339202.1|375100_376393_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_011339203.1|376389_377091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140353.1|377087_377303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140354.1|377299_377509_-	DUF4031 domain-containing protein	NA	A0A0A8IK97	Aurantimonas_phage	59.1	7.7e-14
WP_017140355.1|377665_377935_-	hypothetical protein	NA	A0A1X9HWB1	Ruegeria_phage	36.7	6.9e-07
WP_017140356.1|377931_378159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140357.1|378253_378691_+	hypothetical protein	NA	Q8W6P3	Burkholderia_virus	36.6	1.6e-13
WP_011339204.1|378687_379194_+	hypothetical protein	NA	M4SPS7	Rhodobacter_phage	39.2	3.3e-10
WP_002723970.1|379515_380160_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061350878.1|380184_383304_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011339208.1|386652_388455_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002723978.1|388980_389808_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011339211.1|391509_391983_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011339212.1|392126_392786_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011339213.1|392933_393845_-	porin	NA	NA	NA	NA	NA
WP_002723983.1|394084_394258_-	YdcH family protein	NA	NA	NA	NA	NA
WP_162482805.1|394727_395474_+	DUF2306 domain-containing protein	NA	NA	NA	NA	NA
WP_011339216.1|397892_398357_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011339217.1|398415_399132_-	LrgB family protein	NA	NA	NA	NA	NA
WP_011339218.1|399124_399478_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_017140360.1|399586_400243_-	HyuE hydantoin racemase	NA	NA	NA	NA	NA
400088:400106	attR	TGCCGCCGCGCCGTCCTCG	NA	NA	NA	NA
WP_011339221.1|402175_403441_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_011339224.1|405517_405955_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011339225.1|405951_406851_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_009561543.1|407344_407842_+	bacterioferritin	NA	NA	NA	NA	NA
WP_011339226.1|408521_409628_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_011339227.1|409634_411107_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	32.1	3.7e-09
WP_023004202.1|411504_412668_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_011339229.1|412677_415404_-	methionine synthase	NA	NA	NA	NA	NA
WP_011339230.1|415400_416480_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	54.0	1.3e-14
WP_011339231.1|416755_417634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017140362.1|417630_418674_+	lipocalin	NA	NA	NA	NA	NA
WP_002724021.1|419025_419259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011339233.1|419678_419873_+	hypothetical protein	NA	A0A0U4JEJ6	Pseudomonas_phage	58.2	8.8e-12
WP_011339235.1|420153_420651_+|tail	phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	37.7	6.8e-24
WP_011339236.1|420665_420962_+|tail	phage tail assembly protein	tail	E5E3Q0	Burkholderia_phage	51.2	8.4e-14
WP_162482806.1|420988_421105_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_017140365.1|423444_423855_+|tail	phage tail protein	tail	A0A193GYE0	Enterobacter_phage	50.4	8.6e-33
WP_011339239.1|423851_424064_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	47.8	9.9e-09
WP_011339240.1|424060_425035_+|tail	phage tail protein	tail	D4HTW7	Vibrio_phage	38.6	1.0e-44
WP_017140366.1|425178_426006_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	62.3	3.9e-93
WP_011339242.1|426333_427401_+	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	38.8	3.3e-60
WP_011339244.1|428978_429500_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_017140370.1|429527_430349_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	31.7	4.4e-20
>prophage 2
NZ_CP047038	Rhodobacter sphaeroides strain 2.4.1 substr. H2 chromosome 2, complete sequence	944373	740841	748011	944373		Rhizobium_phage(14.29%)	11	NA	NA
WP_011339479.1|740841_742188_+	S49 family peptidase	NA	A0A068CE01	Rhizobium_phage	47.0	6.7e-58
WP_011339481.1|742503_742923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011339482.1|743134_743950_+	hypothetical protein	NA	A0A1S5R1J5	Pseudomonas_phage	29.8	4.2e-15
WP_017140410.1|743956_744274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011339484.1|744277_744604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011339485.1|744737_745055_+	hypothetical protein	NA	I3UM16	Rhodobacter_phage	57.9	2.8e-23
WP_011339486.1|745107_745329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017140411.1|745321_745594_-	BrnT family toxin	NA	K4NX81	Burkholderia_phage	48.2	2.4e-15
WP_011339488.1|745821_746628_+	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	58.6	2.5e-84
WP_011339489.1|746682_747492_+	M15 family metallopeptidase	NA	A0A0B5A5A2	Paracoccus_phage	49.1	7.1e-63
WP_011339490.1|747504_748011_+	hypothetical protein	NA	F8TVB7	EBPR_siphovirus	48.2	3.9e-11
>prophage 3
NZ_CP047038	Rhodobacter sphaeroides strain 2.4.1 substr. H2 chromosome 2, complete sequence	944373	887167	895050	944373		Nostoc_phage(16.67%)	7	NA	NA
WP_011339591.1|887167_888499_-	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	36.2	6.4e-53
WP_011339592.1|888550_888979_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	50.4	8.7e-36
WP_011339593.1|889231_889714_-	hypothetical protein	NA	F8TVB7	EBPR_siphovirus	51.8	1.2e-12
WP_011339595.1|890589_891396_-	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	57.0	3.4e-81
WP_011339597.1|892376_892694_-	hypothetical protein	NA	I3UM16	Rhodobacter_phage	57.9	3.7e-23
WP_011339598.1|892912_893239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011339600.1|893565_895050_-	hypothetical protein	NA	A0A1S5R1J5	Pseudomonas_phage	30.8	1.7e-14
>prophage 1
NZ_CP047039	Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence	124295	50447	60835	124295		Enterobacteria_phage(42.86%)	10	NA	NA
WP_002724637.1|50447_51284_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.1	6.0e-49
WP_011836184.1|51484_52210_+	sulfotransferase	NA	NA	NA	NA	NA
WP_011836183.1|52576_53359_+	deacetylase sulfotransferase	NA	NA	NA	NA	NA
WP_002724812.1|53333_54224_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	54.9	7.7e-87
WP_011836182.1|54220_55072_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	38.5	3.1e-32
WP_011836181.1|55068_56109_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.1	1.2e-91
WP_009565041.1|56112_56676_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	43.5	7.7e-32
WP_002724804.1|56739_57678_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002724803.1|57728_58691_-	replication initiator protein A	NA	A0A0K1Y6J9	Rhodobacter_phage	39.1	1.3e-58
WP_050988687.1|59428_60835_+	AAA family ATPase	NA	A0A0K2FLP4	Brevibacillus_phage	26.6	2.1e-06
