The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	1128251	1300757	5013113	lysis,head,tail,terminase,tRNA,portal,transposase,protease,holin,capsid,integrase	Salmonella_phage(26.53%)	170	1186231:1186247	1270490:1270506
WP_001067855.1|1128251_1128956_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240537.1|1129711_1130683_+	replication protein C	NA	NA	NA	NA	NA
WP_001043265.1|1130870_1131686_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|1131746_1132550_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|1132549_1133386_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|1133446_1134151_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|1134197_1134599_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|1134748_1135609_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|1136193_1136898_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000021514.1|1138300_1139980_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000819716.1|1140202_1141744_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000811366.1|1141873_1142716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603456.1|1142715_1143279_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000776032.1|1143302_1143938_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_000889012.1|1144011_1145214_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_001033832.1|1145508_1146522_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_080312072.1|1146532_1147513_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000973738.1|1147509_1147884_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000480483.1|1147880_1148402_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000749979.1|1148514_1148799_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_010989065.1|1148893_1149250_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989064.1|1149403_1150222_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001520831.1|1150266_1151550_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001520307.1|1151970_1154040_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_000701821.1|1154075_1154291_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001161781.1|1154741_1155569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|1155903_1157097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989063.1|1157486_1158080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542209.1|1158126_1158294_-	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_001542208.1|1158307_1159372_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_010989057.1|1159972_1161136_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196159.1|1161143_1163324_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533858.1|1163320_1164730_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001237668.1|1164794_1176269_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1176882_1177365_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1177514_1177991_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1177980_1178271_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1178436_1178775_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1178923_1180585_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1180670_1181549_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1181671_1182262_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1182296_1182902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1183022_1184309_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1184328_1185120_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1185285_1186647_+	signal recognition particle protein	NA	NA	NA	NA	NA
1186231:1186247	attL	GCTGAGAAGCTGGCGAC	NA	NA	NA	NA
WP_000256453.1|1186960_1187209_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1187227_1187776_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469804.1|1187820_1188588_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1188628_1188976_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030985.1|1189132_1190353_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212379.1|1190345_1190864_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1191303_1192374_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1192383_1193505_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210995.1|1193562_1194471_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200080.1|1194431_1195592_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1195691_1195739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077944531.1|1195902_1196922_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	58.5	6.3e-109
WP_000085723.1|1196961_1197261_-	helix-turn-helix domain-containing protein	NA	Q1JS21	Enterobacteria_phage	53.2	3.8e-22
WP_002954289.1|1197369_1197708_+	phage regulatory protein	NA	NA	NA	NA	NA
WP_000645096.1|1197733_1198066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681786.1|1198075_1198645_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	46.8	1.2e-43
WP_000922120.1|1198647_1198866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054175272.1|1198904_1201562_+	toprim domain protein	NA	A0A077K8T2	Ralstonia_phage	47.6	7.1e-245
WP_000088096.1|1201589_1201913_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	73.1	1.3e-36
WP_054175273.1|1201912_1202932_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	67.8	2.5e-134
WP_054175274.1|1202928_1204713_-|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	69.5	1.9e-246
WP_000273112.1|1204770_1205760_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	52.3	2.5e-46
WP_001176503.1|1205794_1206823_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	71.6	3.7e-133
WP_001177276.1|1206834_1207533_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	52.6	3.6e-63
WP_000491223.1|1207631_1208084_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	64.7	1.2e-48
WP_000080871.1|1208080_1208563_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	48.7	2.3e-37
WP_001534848.1|1208559_1209264_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	59.9	1.8e-70
WP_001748058.1|1209260_1210388_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.5	2.1e-174
WP_054175275.1|1210384_1210840_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	2.3e-58
WP_001154426.1|1210852_1211149_+|holin	holin	holin	C7BGD7	Burkholderia_phage	48.2	2.4e-16
WP_054175276.1|1211145_1211487_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	93.1	7.6e-51
WP_054175277.1|1211486_1211819_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	69.1	9.7e-35
WP_000411500.1|1211965_1212223_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	61.0	2.3e-20
WP_000811098.1|1212410_1214378_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	4.3e-271
WP_001002797.1|1214374_1214704_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_054175278.1|1214700_1215885_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	1.1e-178
WP_001001824.1|1215877_1216465_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	1.1e-89
WP_054175279.1|1216474_1218487_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	81.2	2.1e-148
WP_001215677.1|1218489_1219020_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.4	4.4e-13
WP_054175280.1|1219009_1219735_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.4	6.6e-68
WP_000200789.1|1219706_1220252_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_054175283.1|1220254_1221955_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.3	2.2e-223
WP_001748131.1|1222988_1223375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1223532_1223871_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1224142_1224880_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1225011_1225992_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1225988_1226720_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235094.1|1226849_1229423_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
WP_000985653.1|1235386_1235842_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.0e-34
WP_000807809.1|1235945_1237247_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	6.9e-44
WP_001264473.1|1237243_1237567_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949286.1|1237611_1238967_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082639.1|1239081_1241742_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183639.1|1241795_1242476_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098732.1|1242548_1242968_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1243171_1244209_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1244324_1245014_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1245332_1245716_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1245777_1246365_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1246467_1247367_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1247384_1248719_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1248849_1249587_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1249571_1251194_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1251457_1251622_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1251618_1252194_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1252225_1252876_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1252875_1253832_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1253828_1254308_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1254805_1256035_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1256012_1256297_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1256337_1256577_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1256619_1257777_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1257739_1260667_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1260793_1261144_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1261165_1261324_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1261722_1262127_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1262256_1262493_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1262458_1262833_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1262917_1263901_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1263903_1264653_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1264663_1265011_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1265007_1265532_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1265531_1266005_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1266869_1267109_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_001574100.1|1267098_1267404_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
WP_000929803.1|1267443_1268046_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1268254_1268866_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1268862_1269003_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1268999_1269677_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1269949_1270513_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
1270490:1270506	attR	GCTGAGAAGCTGGCGAC	NA	NA	NA	NA
WP_000657897.1|1271019_1271208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1271422_1272109_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1272384_1272714_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1272697_1273150_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1273167_1273620_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1273855_1274257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1274543_1275089_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1275060_1276992_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1276975_1277179_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1277175_1278756_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1278745_1280242_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1280254_1280602_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1280656_1281685_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1281742_1282102_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1282112_1282496_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1282523_1283102_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1283150_1284281_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1284389_1284791_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_077248250.1|1284798_1285545_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.5	1.9e-99
WP_000479607.1|1285595_1285991_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1285987_1286326_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1286297_1289393_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1289395_1289725_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1289734_1290433_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1290439_1291177_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1291074_1291722_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1291783_1295146_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1295184_1295427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1295480_1297853_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1297849_1298674_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1298663_1299242_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1299338_1299566_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1299672_1299885_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1299947_1300013_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001526383.1|1300637_1300757_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	1672708	1702301	5013113	holin,protease,tail	Salmonella_phage(38.46%)	32	NA	NA
WP_000781589.1|1672708_1673203_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1673616_1674108_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1674097_1674361_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1674357_1676844_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1676850_1677546_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1677532_1678402_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1678517_1678967_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1678976_1679579_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1679599_1680217_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	2.4e-10
WP_000990028.1|1680213_1680873_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1680924_1681662_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1681658_1681871_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1681867_1682347_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1682343_1684275_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1684271_1684829_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_033572444.1|1684825_1685869_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1685912_1686560_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1687289_1687853_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1688044_1688248_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1688550_1689342_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1689638_1689842_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1690010_1692377_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1692705_1693695_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1693709_1694078_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1694106_1695438_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1695734_1696064_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1696656_1697898_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1697900_1698428_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1698805_1699249_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1699302_1701132_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1701479_1701770_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1701797_1702301_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	1774353	1783524	5013113	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1774353_1775301_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824855.1|1775284_1776016_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1775996_1776104_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1776163_1776895_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1777117_1778803_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1778799_1779519_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1779565_1780033_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1780089_1780620_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1780791_1781250_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1781490_1783524_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	1851832	1862338	5013113		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1851832_1853236_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1853413_1854307_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1854683_1855769_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1855768_1856668_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1856715_1857594_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1857594_1858146_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1858151_1859144_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1859140_1859914_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1859918_1860998_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1861024_1862338_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	1948332	1999019	5013113	head,tail,terminase,portal,protease,plate,holin,capsid,integrase	Salmonella_phage(80.3%)	71	1942910:1942924	1959040:1959054
1942910:1942924	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1948332_1948806_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|1949453_1949744_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|1950115_1950913_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1951204_1952194_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|1952195_1952438_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|1952462_1953032_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|1953035_1953617_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|1953627_1953885_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|1953886_1954420_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|1954490_1955030_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|1955166_1955994_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|1956051_1956423_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|1956962_1957187_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|1957149_1957488_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|1957693_1958389_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1958486_1958711_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1958739_1959294_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1959040:1959054	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087404.1|1959290_1960433_+	hypothetical protein	NA	A0A1C9IHV9	Salmonella_phage	100.0	1.5e-212
WP_000620702.1|1960429_1960654_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_033567233.1|1960650_1961625_+	protein phage	NA	A0A1C9IHW0	Salmonella_phage	100.0	2.3e-169
WP_000054228.1|1961621_1962095_+	PerC family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	100.0	4.9e-56
WP_033567232.1|1962091_1962967_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	99.3	2.7e-169
WP_000779148.1|1962975_1963365_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	100.0	4.9e-70
WP_001061452.1|1963381_1964242_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	100.0	1.1e-162
WP_070793644.1|1964249_1965239_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	100.0	2.1e-194
WP_020899401.1|1965252_1966005_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|1966155_1966413_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|1966558_1966945_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|1966931_1967213_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|1967212_1967827_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|1967823_1968216_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|1968678_1969011_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|1969061_1969412_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929191.1|1969537_1970032_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_033567282.1|1970028_1971762_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.5	0.0e+00
WP_000605609.1|1971773_1971956_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466255.1|1971955_1973197_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_033567207.1|1973174_1973825_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	97.7	3.1e-117
WP_033572441.1|1973839_1975045_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	98.0	9.4e-221
WP_033572442.1|1975094_1975295_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	5.8e-27
WP_000927721.1|1975297_1975621_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.4e-54
WP_033567256.1|1975617_1976022_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.6	3.7e-52
WP_033567257.1|1975993_1976506_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.6	1.6e-81
WP_000779213.1|1976502_1977060_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	93.4	1.1e-96
WP_065305283.1|1977081_1977246_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	94.4	7.1e-23
WP_033567258.1|1977235_1978732_+|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	99.4	3.0e-277
WP_000515953.1|1978731_1979088_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	99.2	1.3e-61
WP_000588852.1|1979084_1979411_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785381.1|1979495_1981421_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	97.3	0.0e+00
WP_001033736.1|1981437_1981887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033567259.1|1981946_1983287_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.3	9.7e-251
WP_001066632.1|1983283_1984342_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	99.7	3.0e-202
WP_001273649.1|1984341_1984875_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605055.1|1984879_1985293_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	99.3	1.2e-74
WP_000785581.1|1985285_1986365_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.2	7.2e-204
WP_001207832.1|1986367_1986955_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554735.1|1986941_1988504_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	98.5	1.7e-283
WP_022742744.1|1988473_1989079_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|1989192_1989426_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|1989500_1989614_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|1989661_1990075_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|1990071_1990284_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|1991477_1991639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1991765_1992185_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1992187_1993456_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1993910_1994123_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1994133_1994322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1994582_1995779_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1996428_1996728_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1996819_1997515_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1997588_1999019_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	2103063	2198025	5013113	head,terminase,integrase,tRNA,protease,holin,tail	Salmonella_phage(32.39%)	119	2138748:2138764	2175883:2175899
WP_000856224.1|2103063_2103294_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2103431_2103806_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2103806_2104682_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2104698_2105052_+	YebY family protein	NA	NA	NA	NA	NA
WP_001189085.1|2105425_2106502_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	9.0e-98
WP_023234152.1|2106467_2106749_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.4	2.6e-12
WP_052929118.1|2106855_2107044_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	6.1e-26
WP_042853000.1|2107036_2107231_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_052929117.1|2107287_2108097_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_052929116.1|2108089_2110765_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	59.7	1.3e-201
WP_080312066.1|2110865_2111141_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	91.2	2.4e-39
WP_001359121.1|2111215_2111386_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	92.9	7.9e-25
WP_000560226.1|2111385_2111607_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_001005966.1|2112274_2112478_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	85.0	2.7e-11
WP_052929113.1|2112479_2112698_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.1e-06
WP_000410105.1|2112940_2113360_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2113456_2113699_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702025.1|2113695_2114118_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_001737256.1|2114195_2114984_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_052929112.1|2114990_2115737_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.5	6.2e-114
WP_080312065.1|2115708_2116521_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.9	3.1e-119
WP_050306692.1|2116536_2116959_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.3	9.7e-64
WP_042973267.1|2116955_2117156_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	71.2	6.7e-15
WP_001204666.1|2117429_2118008_+	sce7726 family protein	NA	A0A0U2RXY7	Escherichia_phage	100.0	2.6e-104
WP_042973270.1|2117967_2119065_-	beta family protein	NA	A0A0U2S621	Escherichia_phage	99.7	2.8e-211
WP_000882662.1|2119565_2119778_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_080312064.1|2120014_2120266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052929183.1|2120337_2120937_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	2.0e-107
WP_001533370.1|2120936_2121227_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	9.6e-47
WP_000640144.1|2121223_2121766_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.6	4.9e-76
WP_001533367.1|2122249_2122585_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	97.3	1.7e-58
WP_001194114.1|2122588_2123065_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.8	6.0e-86
WP_042043867.1|2123048_2123441_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	85.3	4.6e-52
WP_000113285.1|2123584_2123770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472362.1|2123902_2124517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218996.1|2124470_2125022_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	70.3	1.9e-67
WP_001130793.1|2125024_2126647_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_080312063.1|2126646_2128113_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	1.3e-261
WP_139707720.1|2128003_2128738_+|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	84.4	1.4e-94
WP_000873186.1|2128752_2129973_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.5	5.8e-202
WP_080312062.1|2129976_2130483_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	8.3e-70
WP_094324017.1|2130494_2131436_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	8.3e-156
WP_001107515.1|2131477_2131699_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_032197767.1|2131664_2132072_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	1.3e-68
WP_080312060.1|2132068_2132623_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	82.6	1.7e-79
WP_001142480.1|2132609_2132999_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
WP_033544654.1|2132973_2133537_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_080312059.1|2133540_2134686_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.0e-160
WP_080312058.1|2134696_2135137_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	2.0e-56
WP_000393960.1|2135140_2135593_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
WP_080312057.1|2135770_2137759_+	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	74.4	1.1e-271
WP_001298404.1|2137758_2138346_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000155119.1|2138345_2138648_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_080312056.1|2138650_2139715_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	80.3	2.5e-156
2138748:2138764	attL	ACTGGTTCAACATCAGC	NA	NA	NA	NA
WP_052929233.1|2139717_2140179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052929232.1|2140352_2141123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059111263.1|2141109_2141505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032286952.1|2141570_2142323_+	translation initiation factor IF-2	NA	A0A0M5M1K7	Salmonella_phage	66.7	2.0e-88
WP_001270632.1|2142322_2142676_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_001197075.1|2142675_2143875_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	1.3e-185
WP_000049950.1|2143871_2144552_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_159316696.1|2144551_2145400_+|tail	phage tail protein	tail	Q9MCR6	Enterobacteria_phage	66.5	6.1e-57
WP_006673255.1|2145399_2146002_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	6.6e-98
WP_006673257.1|2145973_2146414_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	1.2e-51
WP_077872320.1|2146416_2146815_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	38.3	1.6e-12
WP_080312093.1|2146841_2147396_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.5	1.5e-88
WP_001520095.1|2147856_2148711_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_010989030.1|2148770_2149265_-	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001013467.1|2149454_2149685_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050882.1|2149738_2150272_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_000789530.1|2150528_2150696_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2150760_2150949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000275418.1|2151421_2152303_+|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_010989029.1|2152399_2152600_-	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000457876.1|2153169_2153295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|2154442_2155057_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|2155066_2155225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233446.1|2155357_2156272_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000684835.1|2157584_2157953_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_001617922.1|2159416_2159557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752421.1|2159722_2159992_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_000354408.1|2160361_2160781_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030934.1|2161168_2161645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422882.1|2161974_2162370_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000182072.1|2163052_2163775_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|2164059_2164224_+	membrane protein	NA	NA	NA	NA	NA
WP_000986176.1|2164447_2165098_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_000457836.1|2165116_2165308_-	YebW family protein	NA	NA	NA	NA	NA
WP_000978525.1|2165418_2165658_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001542138.1|2165772_2167212_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001535256.1|2167289_2169923_-	PqiB family protein	NA	NA	NA	NA	NA
WP_001207294.1|2169891_2171175_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_000145727.1|2171216_2171801_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431401.1|2171898_2172585_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_033567178.1|2172604_2174653_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.0e-86
WP_000984498.1|2174846_2175728_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_000416128.1|2175775_2177149_-	MFS transporter	NA	NA	NA	NA	NA
2175883:2175899	attR	ACTGGTTCAACATCAGC	NA	NA	NA	NA
WP_001262195.1|2177324_2178116_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001236777.1|2178327_2178567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080312002.1|2178724_2178868_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001000660.1|2178938_2179226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001537930.1|2179874_2180018_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|2180030_2180240_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000730322.1|2180459_2182205_+	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_000010923.1|2182270_2183080_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001518359.1|2183076_2183643_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000156280.1|2184052_2184511_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518647.1|2184568_2185420_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406918.1|2185432_2186233_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150521.1|2186285_2187254_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000421815.1|2187726_2189286_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_001192525.1|2189307_2190909_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624277.1|2191046_2192411_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000381544.1|2192674_2193253_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_080312003.1|2193256_2194621_-	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	3.3e-44
WP_000457328.1|2194701_2194881_+	YoaH family protein	NA	NA	NA	NA	NA
WP_000029550.1|2194886_2195231_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128807.1|2195361_2197272_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_001221014.1|2197329_2198025_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	2939201	3030118	5013113	lysis,terminase,integrase,tRNA,protease,holin,tail	Salmonella_phage(58.7%)	91	2963295:2963314	3027191:3027210
WP_000938191.1|2939201_2939882_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2940502_2941162_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2941248_2941578_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2941574_2941856_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2941904_2942684_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|2942709_2943258_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2943472_2944684_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2944741_2945059_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|2945103_2945520_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2945690_2946353_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2946447_2946906_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2946941_2948996_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2949119_2949566_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2949584_2951738_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2951724_2952330_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2952546_2953056_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2953412_2954465_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2954536_2954989_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2955174_2956935_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2957003_2957522_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2957621_2957789_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_033567177.1|2958044_2958608_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2958604_2960245_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2960249_2961503_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2961517_2963425_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2963295:2963314	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2963437_2965546_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2965644_2966754_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2966750_2967293_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2967458_2968469_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2968676_2971289_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2971715_2971907_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2972177_2972864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603423.1|2972848_2973148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2973216_2973843_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001674638.1|2974490_2975459_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000143167.1|2975934_2976516_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_031247858.1|2976515_2978954_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.8	7.5e-92
WP_000178849.1|2979007_2979250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2979288_2982639_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_001576012.1|2982710_2983415_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606351.1|2983312_2984050_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2984059_2984755_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2984844_2985378_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2985494_2985992_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2986091_2986424_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_000867564.1|2987544_2988090_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024143045.1|2988558_2989005_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	1.2e-64
WP_000984584.1|2989022_2989475_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	7.9e-80
WP_077248428.1|2989458_2989788_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	99.1	2.9e-55
WP_001141973.1|2990063_2990750_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2991110_2991560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2991695_2991821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097242.1|2992015_2992705_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.6	1.1e-59
WP_000801757.1|2992701_2992842_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096542.1|2992838_2993450_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.0	2.7e-91
WP_000929788.1|2993658_2994261_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	99.0	7.5e-110
WP_000763780.1|2994345_2994567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000861985.1|2994676_2994910_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	87.0	1.2e-31
WP_022630855.1|2995501_2996098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493384.1|2996109_2997087_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001536080.1|2997141_2997399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208142.1|2997398_2998043_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	40.7	1.8e-29
WP_000850457.1|2998046_2998355_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	69.3	1.8e-30
WP_000065109.1|2998358_2998817_-	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	77.4	7.1e-44
WP_000113623.1|2998813_2999161_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000800010.1|2999171_2999921_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062943.1|2999923_3000907_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.3	2.1e-162
WP_000426364.1|3000991_3001312_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
WP_001555460.1|3001346_3001574_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|3001679_3002114_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000917559.1|3002410_3002542_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	97.7	1.2e-17
WP_023139985.1|3002590_3002941_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	3.5e-59
WP_136614733.1|3003067_3006268_+	DNA breaking-rejoining protein	NA	S4TNL0	Salmonella_phage	78.6	0.0e+00
WP_014344386.1|3006230_3007388_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|3007430_3007670_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3007710_3007959_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_020899445.1|3008003_3009296_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	4.5e-253
WP_000191399.1|3009490_3010693_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|3010770_3012207_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|3012451_3013666_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3013982_3014444_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3014644_3016045_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|3016651_3017743_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3017927_3019118_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|3019179_3019827_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3019854_3020403_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3020662_3022504_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572724.1|3022848_3027315_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3027191:3027210	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|3027314_3028019_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|3027999_3029322_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3029314_3030118_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	3080181	3088913	5013113	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3080181_3081436_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3081899_3082358_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3082549_3084826_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3084856_3085177_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3085500_3085722_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3085851_3087798_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3087794_3088913_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	3707487	3719489	5013113	integrase	Enterobacteria_phage(33.33%)	14	3698055:3698068	3716715:3716728
3698055:3698068	attL	TCTGGAGCGCCGCC	NA	NA	NA	NA
WP_001529722.1|3707487_3709839_-	hypothetical protein	NA	A0A1W6JPG0	Morganella_phage	48.5	6.8e-74
WP_001529721.1|3709851_3710454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3710446_3710668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3710664_3710928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065738.1|3710924_3711119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032150717.1|3711111_3712140_-	ash family protein	NA	Q8W643	Enterobacteria_phage	53.3	1.0e-13
WP_000476150.1|3712133_3712316_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001019360.1|3712308_3713142_-	hypothetical protein	NA	G9L6G1	Escherichia_phage	47.5	9.0e-21
WP_001529719.1|3713154_3713586_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.0	3.9e-28
WP_000035054.1|3713585_3713789_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_001529718.1|3714217_3715432_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
WP_000893231.1|3715788_3717039_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
3716715:3716728	attR	GGCGGCGCTCCAGA	NA	NA	NA	NA
WP_001285275.1|3717050_3718154_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3718436_3719489_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
>prophage 10
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	4258568	4339234	5013113	head,tail,terminase,portal,protease,transposase,plate,holin,capsid,integrase	Enterobacteria_phage(84.78%)	85	4271531:4271547	4297490:4297506
WP_000852994.1|4258568_4259921_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166287.1|4260016_4260568_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_000683955.1|4260623_4261508_-	sugar phosphate isomerase/epimerase IolH	NA	NA	NA	NA	NA
WP_001019386.1|4261560_4262376_-	2-keto-myo-inositol isomerase IolI2	NA	NA	NA	NA	NA
WP_000661783.1|4262536_4263763_-	MFS transporter	NA	NA	NA	NA	NA
WP_000736098.1|4263835_4264858_-	D-chiro-inositol-2-dehydrogenase IolG2	NA	NA	NA	NA	NA
WP_000849477.1|4265038_4266979_-	3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing)	NA	NA	NA	NA	NA
WP_014343940.1|4267395_4269333_+	5-dehydro-2-deoxygluconokinase	NA	NA	NA	NA	NA
WP_001111174.1|4269393_4270560_+	MFS transporter	NA	NA	NA	NA	NA
WP_000976924.1|4270556_4271390_-	2-keto-myo-inositol isomerase IolI1	NA	NA	NA	NA	NA
WP_000678386.1|4271390_4272734_-	lysosomal glucosyl ceramidase-like type III secretion effector SrfJ	NA	NA	NA	NA	NA
4271531:4271547	attL	CGGGATTCACAAATCCC	NA	NA	NA	NA
WP_000172704.1|4272830_4273841_-	inositol 2-dehydrogenase IolG1	NA	NA	NA	NA	NA
WP_012601329.1|4273859_4274780_-	myo-inosose-2 dehydratase	NA	NA	NA	NA	NA
WP_000332219.1|4275039_4275864_-	myo-inositol utilization transcriptional regulator ReiD	NA	NA	NA	NA	NA
WP_014343939.1|4275986_4276289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450729.1|4276304_4277810_+	malonate-semialdehyde dehydrogenase IolA	NA	NA	NA	NA	NA
WP_000002010.1|4277834_4278644_+	5-deoxy-glucuronate isomerase	NA	NA	NA	NA	NA
WP_000083110.1|4278996_4280433_-	myo-inositol import MFS transporter IolT2	NA	NA	NA	NA	NA
WP_000107709.1|4280891_4282325_+	myo-inositol import MFS transporter IolT1	NA	NA	NA	NA	NA
WP_000033840.1|4282375_4283209_-	myo-inositol utilization transcriptional regulator IolR	NA	NA	NA	NA	NA
WP_001219833.1|4283699_4285079_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853764.1|4285253_4286252_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	1.3e-69
WP_000055079.1|4286478_4287009_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
WP_000977204.1|4287418_4288582_+	metallo-dependent hydrolase	NA	NA	NA	NA	NA
WP_000203131.1|4288578_4289787_+	MFS transporter	NA	NA	NA	NA	NA
WP_081178341.1|4289922_4290918_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	99.1	2.6e-192
WP_081178296.1|4290984_4291278_-	helix-turn-helix transcriptional regulator	NA	A0A0A7NPW3	Enterobacteria_phage	72.8	2.2e-30
WP_081178294.1|4291392_4291818_+	hypothetical protein	NA	A0A0A7NPS5	Enterobacteria_phage	98.6	1.3e-76
WP_081178292.1|4291855_4292206_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	97.4	1.7e-58
WP_081178290.1|4292216_4292495_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	98.9	1.1e-42
WP_000514277.1|4292506_4292749_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021661.1|4292745_4292859_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	1.6e-10
WP_024232567.1|4292945_4293149_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153674.1|4293145_4293391_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_072644302.1|4293387_4293687_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	2.1e-41
WP_047661839.1|4293698_4294316_+	antirepressor	NA	S5MQL6	Escherichia_phage	38.3	2.7e-06
WP_000564226.1|4294312_4294702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159316704.1|4294698_4297539_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
4297490:4297506	attR	CGGGATTCACAAATCCC	NA	NA	NA	NA
WP_159316705.1|4297615_4297924_+	stbA family protein	NA	A0A0A7NPX4	Enterobacteria_phage	99.0	1.4e-51
WP_001378678.1|4297956_4298574_+	plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	99.5	1.0e-109
WP_024242821.1|4298578_4298890_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	3.2e-48
WP_000248600.1|4299268_4300351_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	8.4e-19
WP_000970615.1|4300347_4302552_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000087811.1|4303056_4304103_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	3.3e-206
WP_032419533.1|4304102_4305854_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_000180564.1|4306008_4306845_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
WP_032419534.1|4306868_4307921_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	92.3	3.6e-184
WP_000632329.1|4307966_4308767_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	90.6	7.3e-129
WP_000063082.1|4308869_4309364_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000864901.1|4309363_4309564_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|4309566_4309890_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_032419535.1|4309886_4310279_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.9e-70
WP_000780572.1|4310275_4310683_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000920593.1|4310820_4311288_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
WP_000356339.1|4311280_4311916_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_001271937.1|4311912_4312494_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-102
WP_000213444.1|4312490_4312841_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111951.1|4312844_4313741_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
WP_000071724.1|4313733_4314342_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_074449120.1|4315909_4316143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139108893.1|4316120_4316288_-	hypothetical protein	NA	U5P0S4	Shigella_phage	50.9	1.4e-05
WP_139108894.1|4316424_4316769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000905084.1|4316796_4317396_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.9	6.8e-87
WP_000979945.1|4317422_4317911_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_066018897.1|4317923_4320731_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.3	0.0e+00
WP_000333503.1|4320717_4320873_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|4320881_4321256_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290450.1|4321311_4321824_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_063122167.1|4321823_4323008_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	5.3e-224
WP_000132830.1|4323165_4324275_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_001448290.1|4324317_4324578_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|4324768_4324909_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_094323960.1|4325038_4325272_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_021580365.1|4325264_4325507_-	hypothetical protein	NA	A0A0A7NPW2	Enterobacteria_phage	100.0	7.3e-40
WP_001219167.1|4325679_4326024_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060815.1|4326026_4329806_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001120231.1|4329802_4331536_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000051472.1|4331748_4332387_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000934974.1|4332569_4333913_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689229.1|4333997_4334204_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175305.1|4334530_4335088_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000893398.1|4335077_4335818_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589395.1|4336085_4338029_+	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_001201297.1|4338086_4338473_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000502119.1|4338775_4339234_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 11
NZ_CP047115	Salmonella enterica subsp. enterica strain SCSM4.1 chromosome, complete genome	5013113	4593370	4640414	5013113	tRNA,tail,plate	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182237.1|4593370_4594369_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4594456_4595767_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4596013_4596529_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4596627_4596837_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4596858_4596972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4596968_4598294_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4598472_4599081_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4599189_4599558_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4599728_4602149_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4602247_4603120_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4603133_4603631_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4603811_4604729_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4604892_4606251_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4606339_4607449_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4607810_4609001_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4609132_4610677_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4610691_4611582_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4611747_4612158_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_159316707.1|4612300_4614397_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4614396_4615134_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_125572646.1|4615130_4615799_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4615832_4616075_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4616518_4618168_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4618512_4619862_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4619994_4620342_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4620917_4621205_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4621207_4621813_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4621825_4622140_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4622299_4622755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4622751_4622949_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4622938_4624366_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4624365_4624890_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4624941_4625259_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4625218_4625347_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4625443_4627798_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271423.1|4627797_4628751_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4628750_4628960_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4628947_4629991_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4630000_4630723_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4631050_4631413_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4631409_4632339_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4632338_4633886_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4634049_4634409_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4634399_4635515_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4635507_4636140_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000368196.1|4636142_4637888_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_001526208.1|4637892_4638498_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084331.1|4638494_4638950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989092.1|4639198_4639489_+	membrane protein	NA	NA	NA	NA	NA
WP_000587738.1|4639685_4640414_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
>prophage 1
NZ_CP047116	Salmonella enterica subsp. enterica strain SCSM4.1 plasmid plas4.1.1, complete sequence	190174	117359	134494	190174	transposase	Escherichia_phage(57.14%)	19	NA	NA
WP_000844627.1|117359_117602_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001067855.1|119239_119944_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|120047_120251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|120378_121218_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|121211_121559_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|121781_122234_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|122318_122951_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|123088_123919_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|124049_124604_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|124747_125452_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|125565_126342_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|126570_127596_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|128017_128770_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|130580_131066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|131262_132353_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|132442_133258_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|133344_133647_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_159316712.1|133540_133765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|133789_134494_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP047116	Salmonella enterica subsp. enterica strain SCSM4.1 plasmid plas4.1.1, complete sequence	190174	149098	158350	190174	transposase	Escherichia_phage(37.5%)	11	NA	NA
WP_000259031.1|149098_149938_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|150065_150269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|150493_151198_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001336345.1|151844_152135_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|152246_152744_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001067855.1|153148_153853_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|154042_154858_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_088238917.1|155008_155713_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000612791.1|155943_156807_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|156844_157090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|157558_158350_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
