The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	15745	150064	6261650	tail,lysis,head,portal,protease,capsid,integrase,terminase,tRNA	uncultured_Caudovirales_phage(49.11%)	176	100801:100848	150267:150314
WP_003192549.1|15745_16570_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_057977621.1|16633_17266_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_003192545.1|17511_18432_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_034126239.1|18428_19736_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_057977623.1|19719_20388_+	cell division protein	NA	NA	NA	NA	NA
WP_003192538.1|20630_21188_+	colicin V production protein CvpA	NA	NA	NA	NA	NA
WP_003192537.1|21229_22735_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	8.5e-86
WP_057977625.1|22800_24012_+	O-succinylhomoserine sulfhydrylase	NA	NA	NA	NA	NA
WP_003192533.1|24023_24788_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_057977627.1|25673_28505_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_054922414.1|28497_29037_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_034128254.1|29039_30275_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_054898769.1|30276_31248_+	XdhC family protein	NA	NA	NA	NA	NA
WP_057977629.1|31384_32668_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_160049348.1|33213_34146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049350.1|34117_34735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049352.1|34742_35879_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	95.8	2.1e-209
WP_034134173.1|35878_36112_-	hypothetical protein	NA	A0A2H4JA17	uncultured_Caudovirales_phage	100.0	1.4e-35
WP_160049354.1|36114_36333_-	hypothetical protein	NA	A0A2H4J1L2	uncultured_Caudovirales_phage	88.9	4.7e-22
WP_160049356.1|36375_37230_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	50.2	2.7e-73
WP_160049358.1|37301_37637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049360.1|37633_38056_-	hypothetical protein	NA	A0A2K8HP44	Pseudomonas_phage	48.8	4.9e-15
WP_160049362.1|38113_38707_-	DUF1566 domain-containing protein	NA	A0A0A0YR68	Pseudomonas_phage	41.3	5.2e-23
WP_160049364.1|38827_39304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049366.1|39361_39673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049368.1|40064_40427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049370.1|40840_41224_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	62.2	8.9e-24
WP_160049372.1|41581_41899_+	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	53.3	4.5e-21
WP_160049374.1|41936_42764_-	helix-turn-helix domain-containing protein	NA	H2BD63	Pseudomonas_phage	43.3	7.0e-50
WP_160049376.1|42854_43061_+	hypothetical protein	NA	A0A1B0Z2M2	Pseudomonas_phage	65.0	5.3e-15
WP_160049378.1|43157_43358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049379.1|43359_43596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049380.1|43740_44481_+	DNA-binding protein	NA	A0A2D1GNK4	Pseudomonas_phage	50.2	1.4e-57
WP_160049381.1|44480_45227_+	hypothetical protein	NA	A0A2I2MUI8	uncultured_Caudovirales_phage	82.6	1.5e-112
WP_160049383.1|45223_45919_+	Replication protein P	NA	A0A2D1GNB3	Pseudomonas_phage	45.5	1.1e-35
WP_160049384.1|45911_46121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049386.1|46111_46414_+	DUF1364 family protein	NA	A0A2K8HR56	Pseudomonas_phage	44.7	3.0e-19
WP_160049388.1|46410_46788_+	endodeoxyribonuclease RusA	NA	A0A088F6Y8	Sulfitobacter_phage	39.3	5.0e-11
WP_160049390.1|46784_48065_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GND4	Pseudomonas_phage	55.5	4.6e-125
WP_160049391.1|48070_48382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038449228.1|48385_48949_+	hypothetical protein	NA	A0A2H4J2J2	uncultured_Caudovirales_phage	58.1	1.3e-66
WP_160049393.1|49067_49439_+	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	70.2	3.3e-39
WP_160049395.1|49438_49756_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	55.4	8.2e-15
WP_160049790.1|49972_50176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049396.1|50166_50541_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	67.7	4.0e-45
WP_160049398.1|50700_51186_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	96.9	5.7e-84
WP_160049400.1|51185_52913_+|terminase	terminase large subunit	terminase	A0A2D1GNU5	Pseudomonas_phage	93.3	0.0e+00
WP_160049402.1|53077_54415_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	55.6	7.2e-129
WP_160049404.1|54411_55113_+|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	64.6	5.0e-73
WP_160049405.1|55122_56382_+|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	48.5	2.1e-90
WP_160049407.1|56431_56677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049409.1|56679_57156_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_160049410.1|57155_57491_+|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	56.8	3.3e-30
WP_160049412.1|57483_57975_+	hypothetical protein	NA	A0A0U3TGT7	Pseudomonas_phage	71.2	4.4e-60
WP_160049413.1|57971_58340_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	53.3	1.1e-31
WP_034127816.1|58399_58891_+|tail	phage major tail protein	tail	H2BDC0	Pseudomonas_virus	68.0	3.3e-55
WP_160049415.1|58900_59248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049417.1|59277_59532_+	hypothetical protein	NA	Q9MCA3	Pseudomonas_phage	43.9	1.4e-12
WP_160049419.1|59557_62251_+|tail	phage tail tape measure protein	tail	Q9MCU6	Escherichia_phage	32.7	1.4e-102
WP_069556774.1|62257_62596_+|tail	phage tail protein	tail	A0A1B0VMG7	Pseudomonas_phage	64.3	7.3e-38
WP_160049421.1|62605_63358_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	90.8	1.8e-137
WP_160049423.1|63360_64116_+|tail	phage tail protein	tail	A0A2H4J1J7	uncultured_Caudovirales_phage	87.6	1.1e-137
WP_160049791.1|64148_64487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049425.1|64538_65138_+|tail	tail assembly protein	tail	A0A1B0VMI5	Pseudomonas_phage	75.9	3.4e-78
WP_160049427.1|65197_69031_+	DUF1983 domain-containing protein	NA	A0A2H4J8Z6	uncultured_Caudovirales_phage	84.2	0.0e+00
WP_054898339.1|69356_70004_+	hypothetical protein	NA	A0A2H4IY64	uncultured_phage	100.0	7.8e-121
WP_160049428.1|70032_71043_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	86.0	9.5e-158
WP_160049430.1|71086_71512_+	structural protein	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	92.1	3.8e-68
WP_160049432.1|71508_72039_+|lysis	lysis protein	lysis	A0A2H4IZW4	uncultured_Caudovirales_phage	73.1	2.0e-58
WP_160049434.1|72019_72373_-	hypothetical protein	NA	A0A2H4IZV2	uncultured_Caudovirales_phage	69.2	1.9e-36
WP_054898332.1|73258_73975_+	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_034128251.1|73971_74922_+	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_054898331.1|74929_75559_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_054898330.1|75638_76175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057978637.1|76187_77588_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_003192516.1|77584_78256_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.4	4.4e-34
WP_057978635.1|78298_78559_-	DUF2790 domain-containing protein	NA	NA	NA	NA	NA
WP_057978633.1|78742_79420_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_054898326.1|79440_79737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057978631.1|79830_80091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003192511.1|80300_80495_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	66.7	1.4e-12
WP_080757719.1|80744_81125_+	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_052199994.1|81156_81846_-	deoxyribonuclease	NA	NA	NA	NA	NA
WP_034128242.1|81848_82100_-	DUF1654 domain-containing protein	NA	A0A2H4J8G7	uncultured_Caudovirales_phage	50.0	9.3e-14
WP_034128241.1|82358_83447_-	asparaginase	NA	NA	NA	NA	NA
WP_003192504.1|84011_84971_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_160049435.1|85028_86582_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	4.4e-13
WP_054898321.1|86578_87556_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_054922657.1|87559_88582_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	32.5	3.1e-39
WP_054922656.1|88605_89523_+	ribokinase	NA	NA	NA	NA	NA
WP_034128236.1|89519_89924_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_057978625.1|89951_90980_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_003192496.1|91009_91216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034128280.1|91373_91679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054898318.1|91823_92144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003234260.1|92211_92424_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.3	5.8e-17
WP_019820908.1|92713_93028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003192490.1|93392_95315_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	1.4e-125
WP_003192489.1|95332_95866_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	36.7	2.6e-13
WP_002553160.1|95925_96120_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003192488.1|96149_96506_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003192486.1|96615_97632_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	39.3	1.1e-28
WP_054898315.1|97658_100037_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002553164.1|100040_100343_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
WP_003174972.1|100323_100680_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
100801:100848	attL	GCATGGGGTGCTAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCAT	NA	NA	NA	NA
WP_054898948.1|100926_102105_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	70.5	2.2e-158
WP_054898949.1|102364_102583_-	hypothetical protein	NA	A0A2H4J1L2	uncultured_Caudovirales_phage	95.8	6.0e-25
WP_054898950.1|102618_103365_-	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	72.0	2.5e-107
WP_057978644.1|103495_103738_+	hypothetical protein	NA	A0A2H4J1H6	uncultured_Caudovirales_phage	87.5	2.6e-37
WP_125919917.1|104163_104352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049437.1|104472_105123_-	hypothetical protein	NA	A0A1B0VMC7	Pseudomonas_phage	54.3	5.2e-24
WP_160049439.1|105169_106444_-	DNA cytosine methyltransferase	NA	A0A1B0V7P0	Salmonella_phage	44.6	1.5e-104
WP_054898958.1|106501_106828_-	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	55.9	5.1e-20
WP_080643511.1|106897_107077_-	hypothetical protein	NA	A0A1B0VMB1	Pseudomonas_phage	75.0	1.4e-16
WP_057712091.1|107487_108132_-	recombinase	NA	A0A0U2BXF3	Paracoccus_phage	36.5	1.6e-20
WP_160049441.1|108128_109043_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	34.6	8.4e-20
WP_160049442.1|109050_110247_-	hypothetical protein	NA	W6MYA7	Pseudomonas_phage	63.8	9.2e-35
WP_057978962.1|110403_110970_-	hypothetical protein	NA	Q9MC57	Pseudomonas_phage	35.3	2.8e-13
WP_057978960.1|110966_111170_-	hypothetical protein	NA	A0A2H4J1S2	uncultured_Caudovirales_phage	57.5	4.0e-15
WP_014717880.1|111166_111382_-	hypothetical protein	NA	A0A2H4IZT6	uncultured_Caudovirales_phage	85.9	2.0e-28
WP_057978921.1|111378_111801_-	hypothetical protein	NA	A0A2H4J9E7	uncultured_Caudovirales_phage	54.2	5.6e-27
WP_160049444.1|111797_112076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047882113.1|112097_112277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049446.1|112707_112851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049448.1|113473_114049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122736703.1|114130_114880_-	helix-turn-helix transcriptional regulator	NA	A0A1B0VRI7	Pseudomonas_phage	64.9	2.6e-83
WP_160049450.1|114971_115181_+	hypothetical protein	NA	A0A1B0VMF5	Pseudomonas_phage	85.5	1.2e-25
WP_056786173.1|115210_115420_+	hypothetical protein	NA	A0A2H4J3U0	uncultured_Caudovirales_phage	71.4	5.5e-20
WP_057978879.1|115438_115684_+	hypothetical protein	NA	A0A2H4IZI7	uncultured_Caudovirales_phage	77.1	8.2e-23
WP_160049451.1|115765_116569_+	KilA-N domain-containing protein	NA	I6R9D7	Salmonella_phage	47.9	4.2e-23
WP_160049453.1|116571_116892_+	hypothetical protein	NA	A0A2H4J9F7	uncultured_Caudovirales_phage	83.5	3.3e-40
WP_160049792.1|116891_117668_+	DUF1376 domain-containing protein	NA	A0A059VF77	Pseudomonas_phage	62.9	7.3e-41
WP_160049455.1|117657_118467_+	ATP-binding protein	NA	A0A2H4J3E5	uncultured_Caudovirales_phage	64.5	2.1e-91
WP_160049456.1|118858_119059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076965261.1|119055_119475_+	NinB family protein	NA	A0A2H4J1T9	uncultured_Caudovirales_phage	95.7	1.9e-72
WP_160049457.1|119467_120190_+	hypothetical protein	NA	A0A1L6BZG7	Pasteurella_phage	50.8	1.6e-21
WP_160049459.1|120183_120777_+	ninG protein	NA	A0A2H4JGI2	uncultured_Caudovirales_phage	93.3	2.6e-94
WP_160049461.1|120773_121454_+	hypothetical protein	NA	A0A2H4J9G7	uncultured_Caudovirales_phage	97.3	4.8e-121
WP_160049462.1|121640_121880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049463.1|122135_122312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049465.1|122444_122816_+	chemotaxis protein	NA	A0A059VK40	Pseudomonas_phage	84.3	1.8e-37
WP_160049466.1|122815_123139_+	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	54.7	5.4e-14
WP_160049468.1|123119_123416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049470.1|123465_123675_+	hypothetical protein	NA	A0A2I2MUH2	uncultured_Caudovirales_phage	95.7	1.2e-30
WP_160049472.1|123671_123914_+	hypothetical protein	NA	A0A2H4JFZ5	uncultured_Caudovirales_phage	76.1	4.6e-26
WP_160049474.1|123879_124503_+	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	89.4	6.8e-106
WP_160049476.1|124534_125068_+	DUF2280 domain-containing protein	NA	A0A1B0VMH2	Pseudomonas_phage	65.2	5.5e-48
WP_160049793.1|125045_126311_+|terminase	terminase	terminase	A0A2H4IZX6	uncultured_Caudovirales_phage	94.8	2.1e-239
WP_160049478.1|126307_128113_+	DUF1073 domain-containing protein	NA	A0A2H4J4I9	uncultured_Caudovirales_phage	95.3	0.0e+00
WP_160049480.1|128109_129240_+	DUF2213 domain-containing protein	NA	A0A2H4J6J7	uncultured_Caudovirales_phage	84.3	1.1e-149
WP_160049482.1|129250_129730_+	hypothetical protein	NA	A0A2H4J1G1	uncultured_Caudovirales_phage	97.5	9.0e-82
WP_124376723.1|129731_130694_+	DUF2184 domain-containing protein	NA	A0A2H4J526	uncultured_Caudovirales_phage	97.2	9.3e-179
WP_160049484.1|130706_130886_+	hypothetical protein	NA	A0A2H4J908	uncultured_Caudovirales_phage	60.0	6.8e-11
WP_160049486.1|130928_131450_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	68.6	3.6e-52
WP_160049488.1|131446_132502_+	hypothetical protein	NA	A0A2H4IY91	uncultured_Caudovirales_phage	93.2	2.9e-181
WP_160049490.1|132501_132888_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	89.8	1.7e-62
WP_160049794.1|132899_133325_+	HK97 gp10 family phage protein	NA	A0A2H4J3F7	uncultured_Caudovirales_phage	95.7	1.6e-69
WP_160049491.1|133321_133738_+	hypothetical protein	NA	A0A2H4J4N2	uncultured_Caudovirales_phage	93.5	3.8e-68
WP_160049492.1|133809_134466_+|tail	phage tail protein	tail	A0A2H4J6K6	uncultured_Caudovirales_phage	95.9	2.5e-111
WP_034120567.1|134469_134853_+	hypothetical protein	NA	A0A2H4J9Y6	uncultured_Caudovirales_phage	71.7	2.3e-48
WP_052224608.1|134915_135167_+	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	92.7	1.1e-38
WP_056786094.1|135205_135439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155717319.1|135429_135702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049494.1|136348_139273_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	52.0	1.9e-198
WP_160049496.1|139275_139614_+|tail	phage tail protein	tail	A0A2H4JI07	uncultured_Caudovirales_phage	89.3	2.0e-56
WP_160049498.1|139624_140374_+|tail	phage minor tail protein L	tail	A0A2H4J4Q5	uncultured_Caudovirales_phage	96.8	1.1e-145
WP_160049499.1|140377_141133_+|tail	phage tail protein	tail	A0A2H4J1J7	uncultured_Caudovirales_phage	97.2	5.1e-148
WP_160049501.1|141129_141711_+|tail	tail assembly protein	tail	A0A2H4JG90	uncultured_Caudovirales_phage	93.3	1.2e-91
WP_160049502.1|141768_145602_+	DUF1983 domain-containing protein	NA	A0A2H4J8Z6	uncultured_Caudovirales_phage	99.8	0.0e+00
WP_054898339.1|145927_146575_+	hypothetical protein	NA	A0A2H4IY64	uncultured_phage	100.0	7.8e-121
WP_057978578.1|146603_147605_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	100.0	6.1e-189
WP_082631627.1|147648_148074_+	structural protein	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	100.0	1.1e-75
WP_057978576.1|148070_148586_+	lysozyme	NA	A0A2H4IZW4	uncultured_Caudovirales_phage	100.0	5.5e-85
WP_060773026.1|148739_149420_-	hypothetical protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	100.0	1.1e-136
WP_060773027.1|149503_149713_+	hypothetical protein	NA	A0A2H4J2T0	uncultured_Caudovirales_phage	100.0	9.7e-33
WP_060773028.1|149704_150064_-	hypothetical protein	NA	A0A2H4IZV2	uncultured_Caudovirales_phage	100.0	1.2e-59
150267:150314	attR	GCATGGGGTGCTAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCAT	NA	NA	NA	NA
>prophage 2
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	324259	357257	6261650	protease,coat	Bacillus_virus(16.67%)	28	NA	NA
WP_003192254.1|324259_325543_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.7	1.6e-138
WP_034127948.1|325731_328128_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.9	7.9e-219
WP_003174819.1|328277_328550_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	1.8e-18
WP_057974948.1|328778_330653_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_057974947.1|330853_332197_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.3	7.1e-60
WP_054917370.1|332315_333497_-	MFS transporter	NA	NA	NA	NA	NA
WP_057974946.1|333588_334515_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034127943.1|334603_335395_+	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_019819480.1|335761_336796_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_057974945.1|336800_337931_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_034127940.1|338142_340182_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_057974944.1|340238_341180_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_057974943.1|341248_341803_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	41.3	6.2e-18
WP_057974942.1|341917_342745_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_054917360.1|342842_343967_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_057974941.1|344079_344934_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034127935.1|344909_345800_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057974940.1|346058_347384_+	MFS transporter	NA	NA	NA	NA	NA
WP_003192227.1|347493_348198_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_060773018.1|348320_349619_-	protein kinase	NA	A0A0M4JT11	Mollivirus	27.7	5.7e-06
WP_057974938.1|349656_350751_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_087149522.1|350941_351433_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_034127930.1|351426_351972_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_003192220.1|351990_352533_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_014718968.1|352535_353024_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_057974936.1|353049_353838_+	molecular chaperone	NA	NA	NA	NA	NA
WP_057975024.1|353910_356259_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_057974935.1|356336_357257_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	455544	461767	6261650	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
WP_034127876.1|455544_456825_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.8	1.8e-97
WP_057974906.1|456825_458220_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_057974905.1|458330_459326_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_057974904.1|459414_460416_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	86.9	4.1e-169
WP_034127872.1|460412_460748_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	78.4	2.3e-44
WP_054898293.1|460744_461023_-	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	57.6	1.2e-25
WP_054898292.1|461022_461373_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	65.8	1.3e-37
WP_160049514.1|461374_461767_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	84.6	1.6e-57
>prophage 4
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	801398	866211	6261650	tail,lysis,transposase,head,capsid,integrase,plate	Pseudomonas_phage(37.21%)	82	796727:796746	840396:840415
796727:796746	attL	CTTGCGGCCGATCTTGTCGC	NA	NA	NA	NA
WP_160049524.1|801398_801851_-	DUF1018 domain-containing protein	NA	Q6QIE7	Burkholderia_phage	54.0	1.3e-29
WP_150073116.1|802023_802245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049525.1|802241_802937_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	68.4	5.7e-85
WP_005789429.1|802938_803226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049526.1|803227_803677_-	hypothetical protein	NA	A0A076FX15	Pseudomonas_phage	51.4	3.7e-37
WP_160049527.1|803874_804492_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	43.3	1.6e-46
WP_160049528.1|804484_804964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049795.1|804963_805149_-	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	54.1	8.7e-09
WP_160049529.1|805244_805436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049796.1|805432_805699_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	46.2	2.1e-11
WP_160049530.1|805751_806933_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	60.6	5.4e-128
WP_160049531.1|806932_808708_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0S4L2U5	Pseudomonas_phage	58.7	1.5e-190
WP_160049532.1|808711_809641_-	hypothetical protein	NA	J9SND0	Pseudomonas_phage	52.7	2.8e-71
WP_160049533.1|809651_809954_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	63.9	1.1e-24
WP_160049534.1|809950_810430_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	62.6	1.8e-53
WP_160049535.1|810535_810784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069672607.1|810820_811033_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	73.9	1.0e-21
WP_160049797.1|811117_811531_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160049536.1|811548_812031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049537.1|812063_812618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049538.1|812728_813238_+	structural protein	NA	J9Q7Y7	Salmonella_phage	56.5	1.3e-41
WP_160049539.1|813234_813462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049540.1|813657_814272_+|lysis	lysis protein	lysis	A0A0S4L1H0	Pseudomonas_phage	50.3	8.6e-37
WP_032803620.1|814278_814497_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_160049541.1|814493_814799_+	DUF2730 domain-containing protein	NA	J9STR5	Pseudomonas_phage	43.7	2.3e-14
WP_160049542.1|814795_815089_+	ArsR family transcriptional regulator	NA	A0A2I7S9D8	Vibrio_phage	53.2	7.8e-20
WP_160049543.1|815091_815643_+	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	46.7	2.9e-28
WP_160049544.1|815639_817244_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	44.0	3.9e-113
WP_160049545.1|817240_818737_+	DUF935 family protein	NA	A4JWJ5	Burkholderia_virus	58.1	2.2e-158
WP_160049546.1|818738_819575_+|head	phage head morphogenesis protein	head	A0A0A7DJT5	Pseudomonas_phage	56.9	1.4e-82
WP_160049547.1|819576_820053_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	36.5	5.3e-18
WP_160049548.1|820290_821310_+	peptidase	NA	A4JWJ9	Burkholderia_virus	52.0	8.0e-88
WP_160049549.1|821318_821687_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	34.7	3.2e-10
WP_160049550.1|821700_822681_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	41.2	8.6e-63
WP_160049551.1|822684_823119_+	DUF1320 domain-containing protein	NA	Q6QIB3	Burkholderia_phage	58.7	2.2e-42
WP_160049552.1|823115_823604_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	39.7	9.3e-26
WP_160049553.1|823600_823873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049554.1|823872_824133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049555.1|824129_825554_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	63.8	7.8e-174
WP_160049556.1|825554_826079_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	51.8	4.9e-49
WP_160049798.1|826147_826330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049557.1|826503_826914_+|tail	phage tail assembly protein	tail	Q6QIA8	Burkholderia_phage	36.9	2.5e-08
WP_160049558.1|826973_827234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160049559.1|827253_830061_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	36.0	1.9e-131
WP_160049560.1|830060_830942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049561.1|830941_831148_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	59.4	1.6e-16
WP_160049562.1|831135_832245_+	late control protein D	NA	Q6QIA2	Burkholderia_phage	40.1	3.3e-63
WP_160049563.1|832244_832796_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_160049564.1|832892_833270_+|plate	baseplate protein	plate	A4JWL5	Burkholderia_virus	66.1	3.4e-36
WP_160049565.1|833253_834375_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	42.0	7.5e-79
WP_160049566.1|834367_834952_+|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	60.8	1.3e-58
WP_160049567.1|834951_836622_+	hypothetical protein	NA	A0A0U4K5K2	Pseudomonas_phage	36.3	1.9e-33
WP_060765910.1|836630_837227_+|tail	tail fiber assembly protein	tail	B5TK80	Pseudomonas_phage	45.5	2.8e-32
WP_082631497.1|837363_837555_+	Com family DNA-binding transcriptional regulator	NA	Q5ZQW8	Pseudomonas_phage	57.1	1.9e-11
WP_160049568.1|837524_838319_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	84.8	4.7e-136
WP_057975769.1|838412_839336_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_020302594.1|839310_839817_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_014718644.1|839870_841373_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.6	6.3e-57
840396:840415	attR	CTTGCGGCCGATCTTGTCGC	NA	NA	NA	NA
WP_057975770.1|841678_842209_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054897349.1|842352_843756_+	MFS transporter	NA	NA	NA	NA	NA
WP_057975771.1|843742_844588_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_057975772.1|844584_845568_-	DMT family transporter	NA	NA	NA	NA	NA
WP_054921370.1|845660_846569_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.1	1.7e-25
WP_014718638.1|846599_847892_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_054921373.1|847888_848314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057975773.1|848402_848726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034127588.1|848949_849429_+	ATP-binding protein	NA	A0A1Q1PW45	Staphylococcus_phage	37.6	1.0e-24
WP_057975774.1|849425_850223_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_057975775.1|850215_850665_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_057975776.1|850774_851353_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_057975777.1|851517_853716_+	OsmC domain/YcaO domain-containing protein	NA	NA	NA	NA	NA
WP_019817159.1|853839_855006_-	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_057975778.1|855002_856379_-	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	37.4	8.4e-48
WP_057975779.1|857065_857548_-	VOC family protein	NA	NA	NA	NA	NA
WP_054897361.1|857607_858792_-	MFS transporter	NA	NA	NA	NA	NA
WP_057975780.1|858886_859780_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_057975781.1|860049_861648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057975966.1|861826_862474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057975782.1|863052_864267_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_057975783.1|864526_865042_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_057975784.1|865265_865886_-	LysE family translocator	NA	NA	NA	NA	NA
WP_003191615.1|865962_866211_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	2492333	2497406	6261650		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_003189215.1|2492333_2492900_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	73.3	3.7e-74
WP_002554837.1|2493288_2493498_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.7	2.2e-16
WP_034126846.1|2493819_2494827_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.3e-34
WP_057975609.1|2494933_2495770_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	33.3	8.2e-06
WP_003189211.1|2495979_2496657_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.1	3.1e-43
WP_003189210.1|2496656_2497406_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	49.4	7.2e-62
>prophage 6
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	2563096	2627508	6261650	tail,bacteriocin,holin,plate,tRNA	uncultured_Caudovirales_phage(27.59%)	67	NA	NA
WP_034126520.1|2563096_2563783_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_003189104.1|2563873_2564521_-	adenylate kinase	NA	A0A2K9L833	Tupanvirus	32.5	8.6e-11
WP_057976015.1|2564801_2567447_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_034126518.1|2567644_2567989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034126517.1|2568272_2568698_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_034126516.1|2568754_2569540_+	OmpA family protein	NA	NA	NA	NA	NA
WP_057976017.1|2569832_2570153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054917825.1|2570262_2570589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034126512.1|2570585_2571491_-	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	28.1	7.8e-10
WP_014717201.1|2571645_2572923_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_072447663.1|2573051_2573768_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003189082.1|2573911_2575414_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.4	5.5e-85
WP_096001736.1|2575493_2576589_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	2.0e-07
WP_057976019.1|2577120_2579388_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_054897112.1|2579389_2579644_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_054897111.1|2579787_2580789_-	PleD family two-component system response regulator	NA	A0A127AWB9	Bacillus_phage	35.2	2.8e-16
WP_034126508.1|2580841_2581852_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q6XM27	Feldmannia_irregularis_virus	40.3	9.9e-06
WP_054897110.1|2581848_2584128_-	hybrid sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.4	9.7e-09
WP_057976021.1|2584124_2584826_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_054897108.1|2584822_2586085_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_034126504.1|2586081_2586594_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_014717193.1|2586593_2588216_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_057976023.1|2588950_2589658_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_034126501.1|2589962_2591588_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_014717190.1|2591641_2591827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054917808.1|2592031_2592568_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_034126499.1|2592671_2593778_-	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_014717187.1|2593904_2595806_-	potassium transporter Kup	NA	M1IAJ4	Acanthocystis_turfacea_Chlorella_virus	33.3	2.9e-75
WP_054897104.1|2596220_2596544_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	37.2	3.5e-13
WP_034126496.1|2596540_2596876_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_003231334.1|2597057_2598398_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_057976025.1|2598498_2598969_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014717183.1|2599175_2599886_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_005785469.1|2599954_2600416_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	52.0	2.6e-38
WP_057976027.1|2600419_2601115_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_003189055.1|2601296_2602076_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_016977932.1|2602141_2603128_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003189051.1|2603131_2603494_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_003189050.1|2603569_2604220_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054917802.1|2604471_2605191_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_034126491.1|2605369_2605804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057976029.1|2606099_2607212_+	TIGR00730 family Rossman fold protein	NA	NA	NA	NA	NA
WP_034126489.1|2607266_2607734_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_014717176.1|2607742_2608801_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	62.4	2.4e-111
WP_054897099.1|2608884_2609385_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	83.1	1.1e-69
WP_034126487.1|2609466_2609961_-	lysozyme	NA	A0A2H4IZW4	uncultured_Caudovirales_phage	60.6	4.3e-39
WP_054897097.1|2609948_2610506_-	glycoside hydrolase family 19 protein	NA	B5TK83	Pseudomonas_phage	70.5	4.0e-73
WP_160049677.1|2610528_2611530_-	phage late control D family protein	NA	A0A2H4JH05	uncultured_Caudovirales_phage	52.1	8.7e-95
WP_057976032.1|2611539_2611752_-|tail	phage tail protein	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	67.1	1.1e-18
WP_057976034.1|2611744_2612128_-|tail	phage tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	58.3	1.3e-35
WP_082631530.1|2612127_2614269_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_054897093.1|2614478_2615051_-|tail	phage tail assembly protein	tail	B0ZSH0	Halomonas_phage	39.3	3.6e-29
WP_054897092.1|2615232_2615739_-|tail	phage tail protein	tail	Q6R4W3	Vibrio_virus	34.5	1.3e-22
WP_032877508.1|2615738_2616905_-|tail	tail protein	tail	B0ZSG8	Halomonas_phage	57.0	7.2e-125
WP_087149544.1|2617171_2617378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057976039.1|2617432_2618050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057976041.1|2618132_2618663_-	hypothetical protein	NA	A2I2X8	Vibrio_virus	60.2	5.5e-48
WP_057976043.1|2618659_2619298_-|tail	phage tail protein I	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	51.9	4.8e-38
WP_057976044.1|2619294_2620290_-|plate	baseplate J protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.8	9.2e-113
WP_060772877.1|2620286_2620619_-	hypothetical protein	NA	A0A2H4JI46	uncultured_Caudovirales_phage	66.4	3.3e-35
WP_057976049.1|2620628_2621240_-|plate	phage baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	50.6	1.1e-44
WP_054917779.1|2621243_2621759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034126475.1|2621781_2622120_-|holin	pyocin R2, holin	holin	B5TK61	Pseudomonas_phage	84.5	6.8e-44
WP_072447626.1|2622710_2623445_-	helix-turn-helix transcriptional regulator	NA	B5TK58	Pseudomonas_phage	87.7	4.8e-119
WP_034126473.1|2623679_2624168_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	44.5	2.9e-27
WP_054897085.1|2624160_2624532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057976051.1|2624916_2627508_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.0	3.0e-30
>prophage 7
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	3075529	3085077	6261650		uncultured_Caudovirales_phage(71.43%)	8	NA	NA
WP_008437341.1|3075529_3077434_+	type I DNA topoisomerase	NA	A0A1S5V180	Saudi_moumouvirus	29.8	1.0e-64
WP_008437343.1|3077544_3079425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008437346.1|3079439_3081377_+	DEAD/DEAH box helicase	NA	A0A1B3B0M9	Gordonia_phage	25.8	1.1e-24
WP_008437347.1|3081632_3082181_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	53.4	2.6e-45
WP_008437348.1|3082200_3082935_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	79.4	1.2e-104
WP_008437349.1|3082934_3083405_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	60.9	4.7e-51
WP_008437350.1|3083414_3084704_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.2	2.2e-175
WP_008437351.1|3084726_3085077_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.5	2.1e-32
>prophage 8
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	4512409	4523257	6261650		uncultured_Caudovirales_phage(90.91%)	13	NA	NA
WP_096143892.1|4512409_4512880_+	hypothetical protein	NA	A0A2H4J163	uncultured_Caudovirales_phage	41.5	1.8e-26
WP_017337052.1|4512882_4513272_+	hypothetical protein	NA	A0A2H4J8C3	uncultured_Caudovirales_phage	52.4	7.1e-29
WP_124527277.1|4513570_4514443_+	DUF3644 domain-containing protein	NA	NA	NA	NA	NA
WP_124527276.1|4514909_4515677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096143180.1|4515793_4516237_-	hypothetical protein	NA	A0A172JI25	Bacillus_phage	29.2	1.3e-05
WP_096143182.1|4516703_4517039_+	hypothetical protein	NA	A0A2H4J9H6	uncultured_Caudovirales_phage	75.7	4.9e-34
WP_096143183.1|4517374_4517758_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	97.3	3.1e-53
WP_096143184.1|4517768_4518122_+	hypothetical protein	NA	A0A2H4J2R0	uncultured_Caudovirales_phage	97.4	3.5e-59
WP_096143185.1|4518124_4518655_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	97.2	5.4e-96
WP_106115699.1|4518965_4520168_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	100.0	9.5e-197
WP_125970789.1|4520280_4520814_-	NUDIX domain-containing protein	NA	A0A2H4J8B3	uncultured_Caudovirales_phage	100.0	1.6e-71
WP_160049730.1|4520906_4521758_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	98.6	1.1e-151
WP_125970787.1|4521769_4523257_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	99.6	8.0e-270
>prophage 9
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	4568980	4589169	6261650	protease,holin	Klosneuvirus(33.33%)	16	NA	NA
WP_060772770.1|4568980_4570297_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
WP_054922362.1|4570296_4571739_-	TldD/PmbA family protein	NA	NA	NA	NA	NA
WP_054898187.1|4571958_4573662_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	30.3	2.9e-50
WP_054922365.1|4573856_4575329_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_054898188.1|4575439_4576033_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_054898189.1|4576365_4578357_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.4	1.5e-18
WP_054922367.1|4578512_4579691_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.8	3.5e-26
WP_124425260.1|4579687_4580533_-|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_034128893.1|4580602_4581550_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_057976518.1|4581966_4583343_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_003194907.1|4583868_4584972_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_034128891.1|4585060_4585324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057976520.1|4585549_4586041_-	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_057976522.1|4586142_4587108_-	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_034128888.1|4587250_4588138_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_057976525.1|4588224_4589169_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 10
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	4626148	4669473	6261650	tail,transposase,head,protease,integrase,plate	Pseudomonas_phage(33.33%)	55	4619717:4619734	4669914:4669931
4619717:4619734	attL	GCGCAGCAGGGCGAGGCG	NA	NA	NA	NA
WP_014720226.1|4626148_4626649_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_054896765.1|4626657_4627326_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.5	2.7e-28
WP_057976547.1|4627325_4628765_+	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_057976549.1|4628816_4630166_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_054920749.1|4630373_4631003_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_034128863.1|4631276_4632380_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_060765863.1|4634157_4634526_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_060765864.1|4634522_4634963_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	57.5	9.6e-30
WP_060765866.1|4635135_4635357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060765867.1|4635359_4636049_-	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	68.1	1.9e-85
WP_060765868.1|4636050_4636338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060765869.1|4636339_4636957_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	44.3	4.9e-48
WP_060765870.1|4636949_4637429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081089355.1|4637425_4637692_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	47.5	1.6e-11
WP_060765872.1|4637744_4638926_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	61.6	5.4e-128
WP_060765873.1|4638925_4640698_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0S4L2U5	Pseudomonas_phage	60.7	2.7e-192
WP_060765874.1|4640700_4641645_-	hypothetical protein	NA	Q5ZR03	Pseudomonas_phage	31.4	4.9e-23
WP_160049739.1|4641655_4641958_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	65.6	1.3e-25
WP_081089352.1|4641970_4642225_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_060765876.1|4642390_4642813_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	48.1	7.3e-11
WP_060765877.1|4642833_4643505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155717252.1|4643600_4644017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060765880.1|4644745_4645234_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	52.3	4.3e-39
WP_060765881.1|4645230_4645452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060765882.1|4645647_4646262_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	49.7	2.7e-38
WP_081089353.1|4646268_4646499_+	DksA protein	NA	Q9ZXI6	Pseudomonas_virus	44.1	6.5e-06
WP_060765883.1|4646485_4646791_+	hypothetical protein	NA	J9STR5	Pseudomonas_phage	41.7	2.3e-14
WP_060765884.1|4646787_4647084_+	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	61.0	2.4e-24
WP_060765885.1|4647086_4647638_+	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	42.3	5.2e-25
WP_060765886.1|4647634_4649239_+	hypothetical protein	NA	A0A219VH72	Ochrobactrum_phage	44.8	1.2e-114
WP_060765887.1|4649235_4650732_+	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	56.9	4.4e-159
WP_060765888.1|4650733_4651564_+|head	phage head morphogenesis protein	head	A0A0A1IX74	Pseudomonas_phage	60.6	3.8e-88
WP_060765889.1|4651577_4652054_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	37.6	2.8e-19
WP_060765890.1|4652287_4653394_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	49.3	6.6e-96
WP_060765891.1|4653406_4654330_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	50.3	2.0e-82
WP_060765892.1|4654338_4654851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060765893.1|4654847_4655180_+	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	55.5	2.0e-24
WP_060765894.1|4655187_4655622_+	DUF1320 domain-containing protein	NA	Q6QIB3	Burkholderia_phage	57.3	4.8e-42
WP_060765895.1|4655618_4656107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060765896.1|4656103_4656376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060765897.1|4656365_4657787_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	66.6	5.1e-181
WP_060765898.1|4657787_4658312_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	53.5	4.9e-49
WP_060765899.1|4658313_4658712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155717253.1|4658710_4658947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060765900.1|4659110_4659440_+|tail	phage tail assembly protein	tail	A4JWK7	Burkholderia_virus	39.4	8.2e-10
WP_060765901.1|4659606_4662318_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	35.2	3.0e-105
WP_060765902.1|4662317_4663193_+	hypothetical protein	NA	A0A059WRP1	Vibrio_phage	33.3	1.9e-08
WP_155717254.1|4663192_4663399_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	58.0	1.1e-15
WP_060765904.1|4663386_4664499_+	late control protein D	NA	A4JWL3	Burkholderia_virus	40.8	5.5e-66
WP_060765905.1|4664517_4665069_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_060765906.1|4665138_4665516_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.8	3.8e-35
WP_060765907.1|4665499_4666621_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	43.1	1.3e-78
WP_060765908.1|4666613_4667198_+|tail	phage tail protein	tail	Q6QI98	Burkholderia_phage	60.8	2.9e-58
WP_160049740.1|4667194_4668868_+	hypothetical protein	NA	A0A0U4K5K2	Pseudomonas_phage	36.3	1.9e-33
WP_060765910.1|4668876_4669473_+|tail	tail fiber assembly protein	tail	B5TK80	Pseudomonas_phage	45.5	2.8e-32
4669914:4669931	attR	GCGCAGCAGGGCGAGGCG	NA	NA	NA	NA
>prophage 11
NZ_CP043060	Pseudomonas sp. J380 chromosome, complete genome	6261650	4712579	4735860	6261650		uncultured_Caudovirales_phage(92.0%)	28	NA	NA
WP_160049741.1|4712579_4713446_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	25.4	8.8e-11
WP_160049742.1|4713853_4714141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160049743.1|4714534_4715629_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_160049744.1|4715980_4716517_-	hypothetical protein	NA	A0A2H4J2P5	uncultured_Caudovirales_phage	92.1	5.9e-66
WP_160049745.1|4716509_4717682_-	DUF3800 domain-containing protein	NA	A0A2H4J132	uncultured_Caudovirales_phage	95.6	6.8e-208
WP_038443867.1|4718090_4718555_-	GNAT family N-acetyltransferase	NA	A0A2H4J155	uncultured_Caudovirales_phage	85.3	1.8e-66
WP_038443865.1|4718684_4719107_+	arsenate reductase ArsC	NA	A0A2H4J437	uncultured_Caudovirales_phage	96.4	3.3e-72
WP_032894886.1|4719103_4719460_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	98.2	3.6e-59
WP_007247284.1|4719484_4720768_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	99.8	1.4e-230
WP_003395039.1|4720784_4721255_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	99.4	3.7e-80
WP_038443860.1|4721302_4722016_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	99.2	4.1e-131
WP_032894877.1|4722036_4722459_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	96.4	2.5e-72
WP_032894876.1|4722496_4723570_+	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	95.5	5.0e-157
WP_032894875.1|4723596_4724148_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	92.3	6.5e-92
WP_032894874.1|4724437_4725631_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_160049746.1|4726228_4727716_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	98.2	3.3e-268
WP_160049730.1|4727727_4728579_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	98.6	1.1e-151
WP_125970789.1|4728671_4729205_+	NUDIX domain-containing protein	NA	A0A2H4J8B3	uncultured_Caudovirales_phage	100.0	1.6e-71
WP_106115699.1|4729317_4730520_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	100.0	9.5e-197
WP_096143185.1|4730830_4731361_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	97.2	5.4e-96
WP_096143184.1|4731363_4731717_-	hypothetical protein	NA	A0A2H4J2R0	uncultured_Caudovirales_phage	97.4	3.5e-59
WP_096143183.1|4731727_4732111_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	97.3	3.1e-53
WP_032894856.1|4732446_4732779_-	hypothetical protein	NA	A0A2H4J9H6	uncultured_Caudovirales_phage	78.4	3.1e-33
WP_032894853.1|4733245_4733707_+	hypothetical protein	NA	A0A172JI25	Bacillus_phage	31.1	4.8e-08
WP_050499464.1|4733797_4734277_-	transcriptional regulator	NA	A0A2H4J450	uncultured_Caudovirales_phage	57.2	1.1e-39
WP_086793457.1|4734489_4734897_+	hypothetical protein	NA	A0A2H4J161	uncultured_Caudovirales_phage	92.3	1.0e-65
WP_032894852.1|4734939_4735386_+	hypothetical protein	NA	A0A2H4J163	uncultured_Caudovirales_phage	95.9	2.5e-78
WP_032894847.1|4735476_4735860_+	hypothetical protein	NA	A0A2H4J8C3	uncultured_Caudovirales_phage	79.5	4.4e-55
