The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046531	Mannheimia sp. ZY170218 chromosome, complete genome	2143704	209542	255570	2143704	transposase,protease,integrase,tRNA	Bodo_saltans_virus(22.22%)	41	204067:204084	230040:230057
204067:204084	attL	AAATGGTGTTAGACGGCA	NA	NA	NA	NA
WP_159628627.1|209542_210733_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_159628628.1|210811_211276_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_159628629.1|211299_211899_-	VOC family protein	NA	NA	NA	NA	NA
WP_159628630.1|211930_213658_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	35.1	1.2e-86
WP_159628631.1|213712_214888_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_159628632.1|214967_215585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159628633.1|215622_217581_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_159628634.1|217577_218111_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_159628635.1|218287_218482_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_159628636.1|218498_219236_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_159628637.1|219298_219961_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_159631179.1|219957_220599_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4UU96	Bodo_saltans_virus	26.6	4.1e-05
WP_159628638.1|220743_221454_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_159628639.1|221735_223337_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_159628640.1|223600_224605_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_159628641.1|224691_225582_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_159628642.1|225592_226594_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.7	6.6e-18
WP_159628643.1|226595_227597_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	2.5e-17
WP_159628644.1|227691_228390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159628645.1|228587_228953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159628646.1|229085_229454_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JX31	Burkholderia_virus	43.5	7.0e-18
WP_159628647.1|229327_229696_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159628648.1|230518_231691_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
230040:230057	attR	TGCCGTCTAACACCATTT	NA	NA	NA	NA
WP_159628649.1|231722_232775_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.5	3.9e-21
WP_159628650.1|232900_233941_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	99.1	1.4e-199
WP_159628651.1|234277_234601_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_159628652.1|234691_235237_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_159628653.1|235275_236100_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_159631181.1|236216_237539_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_159631183.1|237587_237947_-	chromosome condensation protein CrcB	NA	NA	NA	NA	NA
WP_159628654.1|238159_238945_+	MIP family channel protein	NA	NA	NA	NA	NA
WP_006248030.1|238948_240460_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_159628655.1|240611_241157_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_159628656.1|241211_242648_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_154703686.1|242659_244786_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	28.2	2.6e-48
WP_159628657.1|244860_247701_-	RTX family hemolysin	NA	NA	NA	NA	NA
WP_159631185.1|247738_248221_-	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_159628658.1|248652_249693_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	98.6	3.9e-199
WP_159628659.1|249926_252797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159628660.1|253083_254898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159628661.1|254916_255570_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP046531	Mannheimia sp. ZY170218 chromosome, complete genome	2143704	767241	838028	2143704	transposase,protease,integrase,tRNA	Mannheimia_phage(14.29%)	56	787025:787042	817698:817715
WP_159629094.1|767241_768279_-|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	98.6	2.2e-197
WP_159629095.1|768432_768960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159631221.1|769058_771983_-	ribonuclease E	NA	NA	NA	NA	NA
WP_159631223.1|772446_773292_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_159631225.1|774328_775792_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_159629096.1|775928_776903_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_159629097.1|777006_777324_-	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_159629098.1|777528_779874_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	1.4e-63
WP_159629099.1|779895_780162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159629100.1|780375_780834_+	division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
WP_159629101.1|780853_781795_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_159629102.1|781806_782118_+	cell division protein FtsL	NA	NA	NA	NA	NA
WP_159629103.1|782121_784182_+	cell division protein FtsI	NA	NA	NA	NA	NA
WP_159629104.1|784190_785690_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_159629105.1|785728_787123_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
787025:787042	attL	CAAAAACAACCGCTTGTA	NA	NA	NA	NA
WP_159629106.1|787146_788229_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_159629107.1|788286_789588_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_159629108.1|789587_790766_+	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_159629109.1|790885_791941_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_159629110.1|792027_793455_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_159629111.1|793492_794404_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_159631227.1|794403_795195_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_159629112.1|795210_796470_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_159629113.1|796500_797691_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_159629114.1|797728_798649_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_159629115.1|798823_800503_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_159629116.1|800908_802348_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_159629117.1|802949_803318_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JX31	Burkholderia_virus	44.3	6.3e-19
WP_159629118.1|803191_803560_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159629119.1|804127_804844_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_159629120.1|805117_805981_+	YicC family protein	NA	NA	NA	NA	NA
WP_159629121.1|805989_806880_+	folate-binding protein	NA	NA	NA	NA	NA
WP_159629122.1|806911_807172_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.2	1.7e-18
WP_159629123.1|807404_807824_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_159629124.1|807833_809330_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.4	4.0e-19
WP_159629125.1|809339_810308_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_159629126.1|810329_811208_+	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_159629127.1|811292_812210_+	ribokinase	NA	NA	NA	NA	NA
WP_159629128.1|812241_813252_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_159629129.1|813283_813913_-	response regulator	NA	NA	NA	NA	NA
WP_159629130.1|814106_816242_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_159629131.1|816255_816735_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_159629132.1|816896_817691_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_159629133.1|817767_818910_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
817698:817715	attR	TACAAGCGGTTGTTTTTG	NA	NA	NA	NA
WP_159629134.1|819070_819406_+	DUF2322 family protein	NA	NA	NA	NA	NA
WP_159629135.1|819465_820413_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	28.3	9.6e-11
WP_006248501.1|820561_821134_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_006248502.1|821133_822006_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_159629136.1|822241_823645_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159629137.1|829400_830552_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	7.3e-130
WP_159629138.1|830788_832045_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_159629139.1|832097_832802_+	ribonuclease	NA	NA	NA	NA	NA
WP_159629140.1|832794_833286_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_159629141.1|833411_835673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159629142.1|835905_837138_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_159629143.1|837140_838028_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 3
NZ_CP046531	Mannheimia sp. ZY170218 chromosome, complete genome	2143704	1204332	1212821	2143704		Hokovirus(16.67%)	9	NA	NA
WP_159629553.1|1204332_1206183_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.3	1.2e-41
WP_159629555.1|1206187_1206742_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.6	2.5e-27
WP_159629557.1|1207050_1207503_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_159629559.1|1207559_1208780_+	IscS subfamily cysteine desulfurase	NA	A0A2K9L679	Tupanvirus	27.7	4.4e-16
WP_018651776.1|1208880_1209264_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	75.8	1.3e-51
WP_159629561.1|1209388_1209712_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	2.2e-23
WP_159629563.1|1209721_1210243_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_159629565.1|1210277_1210910_+	DUF2625 family protein	NA	NA	NA	NA	NA
WP_159629567.1|1210967_1212821_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	43.4	1.8e-109
>prophage 4
NZ_CP046531	Mannheimia sp. ZY170218 chromosome, complete genome	2143704	1440731	1533012	2143704	integrase,transposase,protease,capsid,tail,holin,head,plate,terminase,portal,tRNA	Mannheimia_phage(64.91%)	109	1439087:1439106	1536344:1536363
1439087:1439106	attL	TACAAGCGGTCATTTTTTCT	NA	NA	NA	NA
WP_159629970.1|1440731_1441385_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_159629972.1|1441424_1441772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159629974.1|1441867_1443220_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_159629976.1|1443727_1445176_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_159629978.1|1445267_1445597_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_159629980.1|1445798_1447301_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_159629982.1|1447515_1447980_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_159629984.1|1447989_1448859_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_159629986.1|1449181_1449400_-	cold shock domain-containing protein	NA	A0A1X9IGI9	Lactococcus_phage	50.8	1.3e-11
WP_159629988.1|1449499_1450072_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_159629990.1|1450367_1451522_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.3e-89
WP_159629992.1|1451535_1452048_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_159629994.1|1452096_1452312_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_159629996.1|1452319_1452754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159629998.1|1452763_1453330_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_159630000.1|1453373_1453745_-	invasion protein expression up-regulator SirB	NA	NA	NA	NA	NA
WP_159630002.1|1453750_1454281_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_159630004.1|1454380_1455730_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_159630006.1|1455792_1456329_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.0	5.8e-13
WP_159630008.1|1456495_1458883_-	sialidase	NA	NA	NA	NA	NA
WP_159630010.1|1459734_1460184_-|terminase	terminase	terminase	NA	NA	NA	NA
WP_159630012.1|1460176_1460764_-	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_020831320.1|1460815_1461121_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159630014.1|1461287_1463027_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	30.8	5.6e-57
WP_159630016.1|1463023_1463368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630018.1|1463360_1463549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630020.1|1463541_1463739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021280442.1|1463731_1463995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630022.1|1463987_1464590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630024.1|1464703_1464994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630026.1|1465806_1466076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630028.1|1466072_1466501_-	hypothetical protein	NA	A0A1X9SFE5	Acinetobacter_phage	56.7	2.1e-29
WP_159630030.1|1466497_1466782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630032.1|1466781_1467450_-	hypothetical protein	NA	A0A2K5B268	Erysipelothrix_phage	35.4	1.3e-22
WP_159630034.1|1467457_1467691_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_159630036.1|1467892_1468579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630038.1|1468974_1469373_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_044426834.1|1469415_1469682_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5NR91	Burkholderia_phage	43.0	8.4e-13
WP_159631272.1|1470046_1470634_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	37.8	8.3e-29
WP_159630040.1|1471665_1471992_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_159630042.1|1472116_1474018_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.3	1.7e-38
WP_159630044.1|1474085_1474916_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_159630046.1|1474967_1476050_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.5	7.2e-87
WP_159630048.1|1476059_1479434_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_159630050.1|1479426_1480845_-	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_159630052.1|1480853_1481423_-	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_159630054.1|1481540_1482323_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_159630056.1|1483175_1484192_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.7	6.6e-34
WP_159630058.1|1484193_1484790_+	DedA family protein	NA	NA	NA	NA	NA
WP_159630060.1|1484958_1485207_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	6.2e-10
WP_159630062.1|1485200_1485545_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	48.4	2.0e-11
WP_159630064.1|1486519_1487560_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	98.8	1.4e-199
WP_159630066.1|1488473_1488632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630068.1|1488778_1489813_-|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	98.3	9.0e-196
WP_159630070.1|1489821_1491660_-|terminase	terminase	terminase	R9QCL2	Mannheimia_phage	98.0	0.0e+00
WP_159630072.1|1491773_1492607_+|capsid	capsid scaffolding protein	capsid	Q19UT4	Mannheimia_phage	84.8	1.2e-121
WP_159630074.1|1492621_1493650_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3LPD2	Mannheimia_phage	89.5	7.4e-174
WP_159630076.1|1493659_1494331_+|terminase	terminase	terminase	Q19US0	Mannheimia_phage	95.9	8.9e-112
WP_006248195.1|1494442_1494958_+|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	100.0	3.3e-90
WP_006250771.1|1494954_1495167_+|tail	tail protein	tail	A0A0M3LPY0	Mannheimia_phage	100.0	2.0e-33
WP_006250772.1|1495172_1495379_+|holin	holin	holin	Q19UR7	Mannheimia_phage	100.0	7.6e-30
WP_159630078.1|1495371_1495938_+	glycoside hydrolase family protein	NA	A0A0M3LPQ1	Mannheimia_phage	97.9	2.2e-103
WP_159630080.1|1495934_1496390_+	hypothetical protein	NA	A0A0M3LQV2	Mannheimia_phage	93.3	2.1e-64
WP_159630082.1|1496518_1497196_+	site-specific DNA-methyltransferase	NA	A0A1S5SBM4	Streptococcus_phage	33.5	1.2e-31
WP_159630084.1|1497233_1497455_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	98.6	5.8e-36
WP_159630086.1|1497451_1497937_+|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	97.5	1.9e-87
WP_159630088.1|1498709_1501349_+|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	30.9	9.4e-64
WP_159630090.1|1501582_1501870_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q19UQ8	Mannheimia_phage	98.9	4.7e-46
WP_159630092.1|1501998_1502547_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	93.8	6.2e-71
WP_159630094.1|1502554_1502890_+|plate	baseplate wedge subunit	plate	Q19UQ6	Mannheimia_phage	95.5	1.4e-52
WP_159630096.1|1502886_1503801_+|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	68.1	2.5e-109
WP_159630098.1|1503790_1504327_+|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	55.1	1.7e-52
WP_159630100.1|1504335_1506255_+	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	36.4	2.5e-42
WP_159631274.1|1506254_1506887_+	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	53.3	4.7e-54
WP_159630102.1|1506870_1507143_+	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	83.7	8.5e-37
WP_159630104.1|1507244_1508426_+|tail	phage tail protein	tail	A0A0M3LPE9	Mannheimia_phage	97.2	2.3e-219
WP_159630106.1|1508435_1508942_+|tail	phage major tail tube protein	tail	A0A0M3LP31	Mannheimia_phage	98.8	5.0e-91
WP_006252819.1|1509033_1509348_+|tail	phage tail assembly protein	tail	Q19UP7	Mannheimia_phage	99.0	1.5e-48
WP_159631276.1|1509371_1509488_+|tail	GpE family phage tail protein	tail	R9QCM4	Mannheimia_phage	89.5	3.6e-13
WP_006252818.1|1509551_1509716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630108.1|1509715_1510153_+	oxidoreductase	NA	A0A0M3LQ18	Mannheimia_phage	91.7	4.7e-69
WP_159630110.1|1510152_1511385_+	phage late control D family protein	NA	A0A0M3LPR9	Mannheimia_phage	88.9	8.5e-193
WP_159630112.1|1511607_1512051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630114.1|1512109_1512790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630116.1|1512779_1513241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630118.1|1513250_1513508_-	hypothetical protein	NA	A0A0M3LPF9	Mannheimia_phage	54.8	9.8e-19
WP_159630120.1|1513584_1513842_-	hypothetical protein	NA	Q19UP2	Mannheimia_phage	84.1	1.8e-28
WP_159630122.1|1513852_1514239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630124.1|1514261_1514816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630126.1|1514964_1515840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630128.1|1515981_1516176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630130.1|1516700_1516973_+	hypothetical protein	NA	Q19UN6	Mannheimia_phage	83.3	2.4e-39
WP_159631278.1|1517109_1517385_+	hypothetical protein	NA	Q19UT2	Mannheimia_phage	74.4	1.7e-24
WP_159630132.1|1517394_1517688_+	hypothetical protein	NA	Q19UT1	Mannheimia_phage	88.7	3.7e-46
WP_159630133.1|1517748_1518003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630135.1|1517986_1518319_+	hypothetical protein	NA	A0A0M3LRZ6	Mannheimia_phage	82.7	2.6e-48
WP_159630137.1|1518315_1520688_+	replication endonuclease	NA	A0A0M3LSC6	Mannheimia_phage	94.4	0.0e+00
WP_159630139.1|1520700_1521033_+	hypothetical protein	NA	A0A0M3LPG9	Mannheimia_phage	91.8	6.5e-55
WP_159630141.1|1521486_1521828_+	hypothetical protein	NA	A0A0M3LNQ0	Mannheimia_phage	89.1	4.0e-52
WP_159630143.1|1521827_1522130_+	hypothetical protein	NA	A0A0M3LP12	Mannheimia_phage	93.5	8.5e-46
WP_159630145.1|1522400_1523003_+	hypothetical protein	NA	D0UIM5	Aggregatibacter_phage	82.3	9.6e-49
WP_159630147.1|1523015_1523201_-	ribbon-helix-helix protein, CopG family	NA	Q19US2	Mannheimia_phage	91.4	6.4e-20
WP_159630149.1|1523478_1524477_-|integrase	tyrosine-type recombinase/integrase	integrase	Q19US1	Mannheimia_phage	97.6	2.7e-181
WP_159630151.1|1524844_1525657_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	33.6	2.7e-09
WP_159630153.1|1525748_1527725_-	exoribonuclease II	NA	NA	NA	NA	NA
WP_159630155.1|1527824_1528616_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_159630157.1|1528755_1529529_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_159630159.1|1529768_1530194_+	universal stress protein	NA	NA	NA	NA	NA
WP_159630161.1|1530387_1533012_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	37.2	4.6e-79
1536344:1536363	attR	AGAAAAAATGACCGCTTGTA	NA	NA	NA	NA
>prophage 5
NZ_CP046531	Mannheimia sp. ZY170218 chromosome, complete genome	2143704	1596772	1607408	2143704		Bacillus_phage(28.57%)	9	NA	NA
WP_159630265.1|1596772_1599205_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	A0A172JHT4	Bacillus_phage	32.5	1.0e-104
WP_159630267.1|1599392_1600268_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_159630268.1|1600260_1601022_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.5	3.8e-18
WP_159630269.1|1601088_1602456_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.3	2.6e-110
WP_159630271.1|1602489_1603119_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_159631281.1|1603236_1603647_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	61.9	2.3e-41
WP_159631283.1|1603650_1603836_-	addiction module toxin, HicA family	NA	A0A0R6PJD4	Moraxella_phage	66.7	2.1e-18
WP_159630273.1|1603974_1605642_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.1	3.4e-19
WP_159630275.1|1605641_1607408_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y1V6	Organic_Lake_phycodnavirus	29.3	1.3e-13
>prophage 6
NZ_CP046531	Mannheimia sp. ZY170218 chromosome, complete genome	2143704	1893570	2001270	2143704	integrase,transposase,holin,protease,capsid,tail,head,terminase,portal,tRNA	Mannheimia_phage(20.83%)	104	1915368:1915414	1955819:1955865
WP_159630742.1|1893570_1894239_-|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_159630744.1|1894257_1897164_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	38.1	3.5e-19
WP_159630746.1|1897321_1897687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630748.1|1897773_1899105_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_159630750.1|1899189_1900512_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	29.1	6.2e-40
WP_159630752.1|1900508_1901693_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.2	1.6e-23
WP_159630754.1|1901692_1902385_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_159630756.1|1902440_1903397_-	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_159630758.1|1903541_1905599_+|tRNA	methionine--tRNA ligase	tRNA	H2EDI7	Moumouvirus	30.5	2.1e-55
WP_159630760.1|1905609_1906026_+	nucleoside-diphosphate kinase	NA	A0A0M5KH58	Mollivirus	38.1	3.4e-13
WP_159630762.1|1906080_1906557_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_159630764.1|1906790_1907060_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159630766.1|1907232_1908822_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.9	4.9e-76
WP_159630768.1|1908941_1909829_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_159630770.1|1909923_1910868_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	40.2	7.0e-54
WP_159630772.1|1911043_1911328_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_159630774.1|1911502_1912543_+|transposase	IS481 family transposase	transposase	A0A0M3LS26	Mannheimia_phage	97.7	3.7e-197
WP_159630776.1|1912632_1914084_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_159630778.1|1914212_1915073_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.0	4.0e-32
1915368:1915414	attL	CTTCTAAGGCGTGGGTCAAAGGTTCGAATCCTTTAGGGCGTGCCATT	NA	NA	NA	NA
WP_159630780.1|1915498_1916494_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077KGX2	Edwardsiella_phage	35.9	1.1e-60
WP_159630782.1|1916948_1917197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630784.1|1917266_1918109_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	67.3	5.2e-109
WP_006248807.1|1918157_1918283_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_159630786.1|1918414_1918639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630788.1|1918631_1918862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630790.1|1919022_1919442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630793.1|1919455_1920037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630795.1|1920126_1920930_-	DUF2303 family protein	NA	I3PUY7	Vibrio_phage	39.8	9.9e-49
WP_006248791.1|1920995_1921355_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	51.5	3.6e-19
WP_159630797.1|1921389_1921848_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	49.3	4.2e-36
WP_159630799.1|1921860_1922025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630801.1|1922025_1922382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630803.1|1923118_1923358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630805.1|1923726_1924977_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_159630807.1|1924960_1925623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630809.1|1925632_1926763_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	28.1	5.1e-19
WP_159630811.1|1926792_1927515_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LQ62	Mannheimia_phage	37.9	6.8e-41
WP_159630813.1|1927638_1927863_+	transcriptional regulator	NA	D0UIL8	Aggregatibacter_phage	62.9	8.3e-14
WP_159630815.1|1927918_1928599_+	hypothetical protein	NA	D0UIL6	Aggregatibacter_phage	57.3	1.1e-61
WP_159630817.1|1929650_1930253_+	adenine methyltransferase	NA	A0A0M3LNW2	Mannheimia_phage	86.5	6.0e-99
WP_159630819.1|1930322_1931351_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	33.9	9.7e-49
WP_115262493.1|1931343_1931703_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	33.9	3.0e-13
WP_159630821.1|1931692_1932052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630823.1|1932350_1932644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630825.1|1932671_1933016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159631315.1|1933661_1934114_+	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	67.6	1.3e-34
WP_159630827.1|1934453_1934807_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	36.4	5.5e-12
WP_159630829.1|1934855_1935407_+	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
WP_159630831.1|1935424_1935757_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_159630833.1|1935662_1935947_+	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	43.7	4.6e-09
WP_159630835.1|1935956_1936280_+	HNH endonuclease	NA	B4UTZ8	Rhizobium_phage	57.9	4.3e-19
WP_159630837.1|1936376_1936841_+|terminase	terminase	terminase	Q77WA1	Escherichia_phage	41.8	1.8e-15
WP_159630839.1|1936840_1938352_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	66.5	2.2e-190
WP_159630841.1|1938348_1939587_+|portal	phage portal protein	portal	A0A0R6PKP4	Moraxella_phage	64.9	1.6e-146
WP_038643905.1|1939576_1940236_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PIE4	Moraxella_phage	61.1	2.4e-69
WP_138317653.1|1940237_1941434_+|capsid	phage major capsid protein	capsid	A0A0R6PI48	Moraxella_phage	65.7	1.4e-136
WP_042804015.1|1941477_1941795_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	42.2	7.4e-16
WP_159630843.1|1941795_1942125_+|head	phage head closure protein	head	A0A0C5AE87	Paenibacillus_phage	39.8	1.2e-13
WP_159630845.1|1942111_1942591_+	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	27.7	2.0e-09
WP_159630847.1|1942587_1942932_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_159630849.1|1942935_1943577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630851.1|1943659_1944061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630853.1|1944105_1944333_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_159630855.1|1944434_1944635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630857.1|1944805_1948141_+|tail	phage tail tape measure protein	tail	A0A0P0IRB4	Acinetobacter_phage	40.3	5.0e-30
WP_159630859.1|1948140_1948470_+|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	35.2	6.7e-12
WP_159630861.1|1948469_1949186_+|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	94.1	3.9e-129
WP_159630863.1|1949189_1949921_+|tail	phage tail protein	tail	A0A0M3LQI5	Mannheimia_phage	93.0	3.5e-138
WP_159630865.1|1949950_1950577_+|tail	tail assembly protein	tail	A0A0M3LPS1	Mannheimia_phage	80.4	1.7e-85
WP_159631317.1|1952869_1954975_+	DUF1983 domain-containing protein	NA	A0A0R6PD22	Moraxella_phage	59.8	2.7e-37
WP_159630867.1|1954984_1955149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630869.1|1955229_1955577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630871.1|1957684_1958260_-	redoxin family protein	NA	NA	NA	NA	NA
1955819:1955865	attR	CTTCTAAGGCGTGGGTCAAAGGTTCGAATCCTTTAGGGCGTGCCATT	NA	NA	NA	NA
WP_159630873.1|1958247_1958973_-	methyltransferase domain-containing protein	NA	A0A0N9SHZ9	Staphylococcus_phage	37.5	9.2e-38
WP_159630875.1|1958960_1959761_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_159630877.1|1959776_1961048_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_159630879.1|1961057_1962212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630881.1|1962208_1963132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159628598.1|1963267_1963921_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_159630883.1|1963950_1964388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159630885.1|1965249_1966674_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.7	1.9e-42
WP_159630887.1|1966743_1968630_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_159630889.1|1968739_1971397_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_159630891.1|1971792_1972800_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_159630893.1|1972876_1973827_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	38.3	8.1e-42
WP_159630895.1|1973842_1974694_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_159630897.1|1974693_1975326_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_159630899.1|1975420_1977172_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	9.0e-55
WP_159630901.1|1977362_1979285_-	ATP-dependent helicase	NA	A0A127AW80	Bacillus_phage	30.7	2.3e-96
WP_159630903.1|1979288_1980086_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	26.2	3.1e-10
WP_159630905.1|1980087_1981020_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_159630907.1|1981227_1984056_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.0	2.9e-305
WP_159630910.1|1984212_1984734_+	single-stranded DNA-binding protein	NA	A0A2I7RNY1	Vibrio_phage	63.1	7.8e-39
WP_159630912.1|1985453_1988900_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_159630914.1|1989060_1990278_+	tyrosine transporter	NA	NA	NA	NA	NA
WP_159630916.1|1990353_1990860_-	heme utilization cystosolic carrier protein HutX	NA	NA	NA	NA	NA
WP_159631319.1|1990917_1993218_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_159631321.1|1993493_1994015_+	heme utilization protein HutZ	NA	NA	NA	NA	NA
WP_159630918.1|1994166_1996779_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	23.5	1.6e-23
WP_159630920.1|1997171_1998590_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_159630922.1|1998603_1999206_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_159630924.1|1999267_1999732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630926.1|1999760_2000267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159630928.1|2000298_2001270_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
