The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045428	Acinetobacter baumannii strain AbCAN2 chromosome, complete genome	3809822	640996	670581	3809822	protease,terminase,portal,tail,head,integrase,capsid	uncultured_Caudovirales_phage(44.44%)	41	640904:640932	677203:677231
640904:640932	attL	CGGGTTCAACTCCCGCCATCTCCACCAAA	NA	NA	NA	NA
WP_159141652.1|640996_642157_-|integrase	tyrosine-type recombinase/integrase	integrase	G3EN73	Psychrobacter_phage	62.9	1.3e-142
WP_159141653.1|642340_642601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114229398.1|642600_642915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159141654.1|642911_643541_-	3'-5' exoribonuclease	NA	A0A2I7R2S7	Vibrio_phage	33.9	2.4e-18
WP_159141655.1|643552_644011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032035832.1|644007_644433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159141656.1|644513_645149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159141657.1|645148_645310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159141658.1|645306_645600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159141659.1|645713_646433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159141660.1|646628_646922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141661.1|646905_647397_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_159141662.1|647396_648305_+	toprim domain-containing protein	NA	A0A0R6PHP8	Moraxella_phage	36.5	3.5e-50
WP_159141663.1|648301_650128_+	hypothetical protein	NA	A0A2H4JF22	uncultured_Caudovirales_phage	30.3	7.4e-60
WP_159141664.1|650510_650975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141665.1|651137_651497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114229384.1|651498_651720_+	phosphohistidine phosphatase	NA	NA	NA	NA	NA
WP_159141666.1|651706_652015_+	HNH endonuclease	NA	A0A0R6PHK1	Moraxella_phage	51.9	3.1e-19
WP_159141667.1|652011_652521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141668.1|652534_652822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141669.1|653041_653506_+	hypothetical protein	NA	A0A2H4J8R0	uncultured_Caudovirales_phage	40.8	6.1e-19
WP_159141670.1|653708_655397_+|terminase	terminase large subunit	terminase	A0A2H4J6B3	uncultured_Caudovirales_phage	57.0	4.9e-191
WP_046023700.1|655453_656077_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PHN0	Moraxella_phage	43.1	1.2e-41
WP_159141671.1|656073_657399_+|capsid	phage major capsid protein	capsid	A0A0R6PCM7	Moraxella_phage	54.3	5.9e-123
WP_159141672.1|657449_657764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141673.1|657764_659030_+|portal	phage portal protein	portal	A0A2H4JB65	uncultured_Caudovirales_phage	57.9	4.1e-134
WP_159141674.1|659010_659298_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JAM4	uncultured_Caudovirales_phage	51.6	1.1e-15
WP_171073730.1|659300_659444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141675.1|659468_659693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141676.1|659695_660052_+|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	38.7	2.0e-14
WP_159141677.1|660052_660508_+	HK97 gp10 family phage protein	NA	A0A2H4J6A2	uncultured_Caudovirales_phage	50.7	1.1e-28
WP_159141678.1|660504_660870_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_159141679.1|660934_661414_+	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	31.1	1.5e-12
WP_159141680.1|661410_661935_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_171519577.1|661886_662165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141681.1|662240_662702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141682.1|662762_666419_+	transglycosylase SLT domain-containing protein	NA	A0A2H4JDA4	uncultured_Caudovirales_phage	25.1	6.7e-44
WP_159142534.1|666433_666904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141683.1|666900_667413_+	hypothetical protein	NA	A0A1B1P9F1	Acinetobacter_phage	40.5	1.2e-26
WP_159141684.1|667409_667778_+	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	55.4	4.5e-33
WP_159141685.1|667755_670581_+	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	35.9	1.5e-168
677203:677231	attR	CGGGTTCAACTCCCGCCATCTCCACCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP045428	Acinetobacter baumannii strain AbCAN2 chromosome, complete genome	3809822	834793	842054	3809822		Acinetobacter_phage(100.0%)	12	NA	NA
WP_031988688.1|834793_835516_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	90.0	2.6e-56
WP_000481377.1|835512_835992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005120240.1|835994_836240_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	96.3	3.7e-39
WP_159141739.1|836241_837231_-	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	74.5	2.2e-130
WP_002085557.1|837245_838013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159141740.1|838024_838348_-	hypothetical protein	NA	A0A0P0IVW1	Acinetobacter_phage	90.7	7.2e-51
WP_159141741.1|838350_838791_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	93.8	1.0e-71
WP_109067479.1|838999_839833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109067480.1|839834_840653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159141742.1|840708_841395_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159141743.1|841500_841689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141744.1|841697_842054_+	transcriptional regulator	NA	J7I452	Acinetobacter_phage	98.3	1.5e-57
>prophage 3
NZ_CP045428	Acinetobacter baumannii strain AbCAN2 chromosome, complete genome	3809822	848103	879559	3809822	lysis,tail,terminase,capsid	Acinetobacter_phage(90.32%)	37	NA	NA
WP_001136775.1|848103_848559_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	98.7	3.5e-83
WP_031962887.1|848618_849053_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	96.5	5.4e-78
WP_005123832.1|849021_849663_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	99.5	6.1e-126
WP_031960791.1|849721_850192_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	88.5	3.7e-72
WP_159141751.1|850181_851609_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	99.2	3.4e-270
WP_086443148.1|851605_853051_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	96.0	2.1e-275
WP_159141752.1|853057_854161_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	93.2	8.1e-195
WP_000589041.1|854314_854629_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	3.1e-14
WP_159141753.1|854743_855511_+	hypothetical protein	NA	A0A0D4DCP5	Acinetobacter_phage	98.4	1.4e-113
WP_000214189.1|855538_856495_+	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	100.0	2.1e-178
WP_000692548.1|856561_857227_+	hypothetical protein	NA	J7I4P7	Acinetobacter_phage	95.5	8.3e-110
WP_000008500.1|857231_857621_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	96.9	1.4e-64
WP_159142536.1|857622_857991_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	94.3	2.7e-62
WP_159141754.1|858053_858584_+	hypothetical protein	NA	A0A0D4DCP9	Acinetobacter_phage	87.5	4.3e-85
WP_159141755.1|858627_858996_+	HK97 gp10 family phage protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.0	2.0e-52
WP_159141756.1|858952_859396_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	85.7	3.7e-66
WP_001277693.1|859397_859616_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	95.7	1.0e-29
WP_031959981.1|859724_860246_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_159141757.1|860343_860694_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	92.3	3.7e-53
WP_159141758.1|860693_861668_+|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	45.3	2.2e-87
WP_159141759.1|861763_862681_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	95.7	4.7e-164
WP_118978789.1|862751_863261_+	hypothetical protein	NA	A0A0D4DBX8	Acinetobacter_phage	84.1	4.4e-63
WP_002052904.1|863783_863933_+	hypothetical protein	NA	J7HXF6	Acinetobacter_phage	79.6	2.1e-13
WP_135536521.1|863944_864490_+	GNAT family N-acetyltransferase	NA	J7I473	Acinetobacter_phage	72.9	2.4e-70
WP_159142537.1|864613_864937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735548.1|865061_865571_+	hypothetical protein	NA	A0A0S0N7I7	Pseudomonas_phage	38.0	4.2e-21
WP_159141760.1|865640_870563_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	62.5	0.0e+00
WP_159141761.1|870653_871241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141762.1|871333_871732_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	98.5	1.8e-72
WP_159141763.1|871731_872238_+	DUF1833 family protein	NA	A0A0P0IKN4	Acinetobacter_phage	95.2	6.5e-91
WP_029423751.1|872234_872597_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	86.7	2.2e-56
WP_159141764.1|872589_876027_+	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	93.3	0.0e+00
WP_024433265.1|876096_876390_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_057049505.1|876370_876595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141765.1|876652_877198_+	hypothetical protein	NA	J7I0Y1	Acinetobacter_phage	96.1	3.0e-97
WP_033855652.1|877455_878226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159141766.1|878260_879559_-	DUF4113 domain-containing protein	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	60.2	3.3e-155
>prophage 4
NZ_CP045428	Acinetobacter baumannii strain AbCAN2 chromosome, complete genome	3809822	1072594	1108548	3809822	terminase,tail,transposase,capsid	Acinetobacter_phage(96.3%)	48	NA	NA
WP_000636785.1|1072594_1072828_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001185369.1|1072979_1073651_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	56.6	1.1e-64
WP_000016214.1|1073886_1074084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427183.1|1074251_1074641_+	hypothetical protein	NA	A0A0P0IVR6	Acinetobacter_phage	74.4	1.4e-48
WP_159141819.1|1074678_1075224_+	hypothetical protein	NA	A0A0N7IRF5	Acinetobacter_phage	73.5	1.6e-74
WP_159141820.1|1075290_1075908_-	LysE family transporter	NA	NA	NA	NA	NA
WP_000072673.1|1076426_1076642_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000350299.1|1076844_1077069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932373.1|1077348_1078164_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001982898.1|1078318_1078438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159141821.1|1078922_1079381_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.8	6.0e-27
WP_001004676.1|1079674_1080019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141822.1|1080116_1081223_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	66.0	1.5e-143
WP_159141823.1|1081217_1082432_-	MFS transporter	NA	NA	NA	NA	NA
WP_114183266.1|1082543_1082990_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001210983.1|1083076_1083406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002133060.1|1083419_1083608_+	peptidoglycan domain protein	NA	A0A0B5L5G0	Acinetobacter_phage	95.2	1.7e-15
WP_000644342.1|1084146_1084740_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_086443157.1|1085123_1085753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086443156.1|1086603_1087134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086443155.1|1087173_1087470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086443172.1|1088683_1089172_+	hypothetical protein	NA	A0A0P0I4C3	Acinetobacter_phage	37.1	3.9e-16
WP_159141824.1|1089441_1090266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159141825.1|1090533_1090962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086443152.1|1092642_1092921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744649.1|1093049_1093385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086443151.1|1093413_1093881_+	hypothetical protein	NA	A0A0P0IRI6	Acinetobacter_phage	80.6	1.5e-65
WP_086443150.1|1093849_1094491_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	96.7	2.2e-123
WP_000212563.1|1094548_1095019_+	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	99.4	6.7e-82
WP_114253100.1|1095008_1096436_+|terminase	phage terminase large subunit	terminase	A0A0D4DCE6	Acinetobacter_phage	98.5	1.1e-268
WP_086443148.1|1096432_1097878_+	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	96.0	2.1e-275
WP_086443147.1|1097884_1098979_+|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	93.4	2.2e-192
WP_086443146.1|1099046_1099544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114253102.1|1099662_1100430_+	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	98.4	1.1e-116
WP_159141826.1|1100457_1101414_+|capsid	phage capsid protein	capsid	A0A0D4DBM4	Acinetobacter_phage	92.1	6.9e-166
WP_086443144.1|1101480_1102146_+	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	61.1	1.7e-62
WP_159141827.1|1102150_1102540_+	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	97.7	9.5e-66
WP_086443142.1|1102541_1102910_+	glutamate 5-kinase	NA	J7I467	Acinetobacter_phage	92.6	1.8e-61
WP_159141828.1|1102975_1103338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086443140.1|1103544_1103949_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
WP_086443139.1|1103920_1104289_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.0	3.6e-54
WP_086443138.1|1104245_1104689_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	85.0	5.8e-67
WP_086443137.1|1104690_1104909_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	5.2e-29
WP_086443136.1|1105017_1105539_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_159141829.1|1105628_1105979_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	87.2	4.6e-51
WP_159141830.1|1105978_1106956_+|tail	phage tail protein	tail	A0A0N7IRE5	Acinetobacter_phage	43.1	8.0e-85
WP_159141831.1|1107050_1107968_+	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	95.1	2.3e-163
WP_024438528.1|1108038_1108548_+	hypothetical protein	NA	A0A0P0J095	Acinetobacter_phage	85.3	1.7e-62
>prophage 5
NZ_CP045428	Acinetobacter baumannii strain AbCAN2 chromosome, complete genome	3809822	2413327	2428125	3809822		Acinetobacter_phage(100.0%)	10	NA	NA
WP_171066371.1|2413327_2413903_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	99.5	1.2e-109
WP_159142223.1|2413999_2416765_-	ERAP1-like C-terminal domain-containing protein	NA	A0A0P0IY26	Acinetobacter_phage	98.8	0.0e+00
WP_159142224.1|2416778_2419511_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	98.7	0.0e+00
WP_001982145.1|2419866_2420916_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608308.1|2420925_2421732_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	99.6	1.8e-146
WP_000066126.1|2421741_2422437_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_159142225.1|2422447_2423431_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	98.2	1.2e-186
WP_159142226.1|2423437_2425813_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	99.4	0.0e+00
WP_159142227.1|2425814_2427314_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	97.2	1.2e-278
WP_001187844.1|2427576_2428125_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
