The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	980756	1014159	5521444	portal,tail,terminase,head,protease,integrase,tRNA,capsid	uncultured_Caudovirales_phage(73.33%)	33	998509:998526	1014504:1014521
WP_002919147.1|980756_981704_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|981718_982228_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|982356_983481_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|983452_983926_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|983951_984494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|984498_985071_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|985074_985893_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|985889_986147_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|986122_986677_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|992617_992839_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|993132_996243_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|996255_997395_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|997773_998424_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
998509:998526	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|998699_999926_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|1000018_1000960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|1001141_1001426_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|1001436_1002216_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|1002667_1002937_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|1002929_1003118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|1003110_1003425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|1003421_1003790_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|1003786_1004152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|1004151_1006287_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|1006629_1006965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|1007013_1007526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|1007789_1008956_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|1009007_1009568_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|1009569_1010811_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|1010807_1011143_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|1011139_1011439_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|1011438_1011882_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|1012157_1012514_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|1012497_1014159_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
1014504:1014521	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	1765690	1814834	5521444	lysis,portal,tail,terminase,plate,transposase,head,integrase,tRNA,coat,capsid	Salmonella_phage(79.55%)	61	1753657:1753673	1792307:1792323
1753657:1753673	attL	CCAGCTGCTGGCGCAGG	NA	NA	NA	NA
WP_000019473.1|1765690_1766671_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1766716_1767715_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1767717_1768347_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1768469_1768712_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1768744_1769254_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1769261_1769462_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1769425_1769764_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1769831_1770065_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1770064_1770292_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1770288_1771140_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1771136_1773521_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004152765.1|1774001_1775486_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1775593_1775782_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1775793_1776027_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1776122_1776806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1776792_1777872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1777871_1778873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1779394_1779664_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1779720_1780764_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1780763_1782527_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1782667_1783501_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1783517_1784570_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1784573_1785227_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1785322_1785787_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1785786_1785990_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1785993_1786209_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1786189_1786699_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1786703_1787087_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1787083_1787512_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|1787607_1788030_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1788022_1788469_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1788491_1789358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1789452_1790025_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1790021_1790384_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1790370_1791279_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1791271_1791943_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1791944_1793894_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
1792307:1792323	attR	CCTGCGCCAGCAGCTGG	NA	NA	NA	NA
WP_004200602.1|1793903_1795022_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1795073_1796147_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1796295_1797468_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1797477_1797993_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1798045_1798345_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1798359_1798479_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1798471_1801102_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1801098_1801584_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1801580_1802675_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1802741_1802960_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1802987_1803365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1803968_1804451_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1804561_1805038_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1805027_1805318_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1805384_1805726_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1805873_1807535_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1807621_1808500_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1808624_1809215_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1809334_1810621_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1810640_1811432_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1811595_1812960_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1813219_1813468_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1813486_1814035_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1814066_1814834_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	1843424	1887160	5521444	portal,tail,terminase,holin,head,protease,integrase,tRNA,capsid	Salmonella_phage(21.95%)	61	1837493:1837510	1889036:1889053
1837493:1837510	attL	TGTAACGCTTACTGATGA	NA	NA	NA	NA
WP_002914089.1|1843424_1844510_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914088.1|1844567_1845257_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914084.1|1845570_1845954_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914082.1|1845999_1847331_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914079.1|1847462_1848200_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914076.1|1848184_1849804_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_121980491.1|1850132_1850228_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_002914074.1|1850224_1850800_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_002914072.1|1850832_1851483_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_002914070.1|1851482_1852439_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_004144354.1|1852435_1852915_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_002914069.1|1853100_1854900_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.4	5.5e-23
WP_002914067.1|1854915_1855890_+	signal peptidase I	NA	NA	NA	NA	NA
WP_002914065.1|1856139_1856820_+	ribonuclease III	NA	A0A0P0YM82	Yellowstone_lake_phycodnavirus	29.7	1.6e-20
WP_002914063.1|1856816_1857722_+	GTPase Era	NA	NA	NA	NA	NA
WP_002914062.1|1857733_1858471_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002914059.1|1858482_1859214_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004144351.1|1859213_1859594_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_094818641.1|1859606_1859867_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.8e-18
WP_087473069.1|1860081_1861479_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071839937.1|1861475_1861676_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_087473103.1|1861695_1862250_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	66.7	4.5e-69
WP_094818642.1|1862251_1863073_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	81.2	3.7e-43
WP_094818643.1|1863073_1863328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818644.1|1863339_1863603_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	69.0	7.0e-28
WP_094818645.1|1863602_1863845_-	hypothetical protein	NA	H6WYL1	Enterobacter_phage	58.2	2.4e-22
WP_094818646.1|1863844_1864237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818647.1|1864229_1864454_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.8	6.4e-14
WP_094818648.1|1864768_1865629_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.1	1.0e-72
WP_080884803.1|1865710_1866523_-	DUF2303 family protein	NA	NA	NA	NA	NA
WP_094067207.1|1866564_1866924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818649.1|1867845_1868556_-	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	67.5	4.0e-86
WP_004104275.1|1868663_1868858_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	79.4	3.6e-21
WP_094818650.1|1868935_1869451_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	63.4	8.8e-59
WP_094818651.1|1869929_1870205_+	hypothetical protein	NA	A0A1P8VVT6	Streptococcus_phage	41.8	8.7e-05
WP_029497188.1|1870197_1871727_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	6.6e-203
WP_094818652.1|1871723_1872695_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	61.1	3.5e-109
WP_020317326.1|1872664_1873309_+	bacteriophage Lambda NinG protein	NA	A0A1W6JNX3	Morganella_phage	54.3	1.9e-39
WP_094067210.1|1873305_1873950_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	67.8	3.4e-84
WP_029497192.1|1873939_1874344_+	antitermination protein	NA	S5M7R9	Escherichia_phage	54.0	5.5e-32
WP_001294159.1|1874553_1874940_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_000243811.1|1874926_1875208_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_094818653.1|1875207_1875837_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	74.9	6.5e-88
WP_094818654.1|1875839_1876115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094818655.1|1876065_1876260_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.1	1.6e-21
WP_094818657.1|1876617_1876863_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	65.4	1.2e-18
WP_021313631.1|1877374_1877725_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.9	1.2e-51
WP_004884285.1|1877855_1878350_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_032418747.1|1878346_1880077_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
WP_094818659.1|1880271_1881501_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
WP_004884313.1|1881487_1882141_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_094818660.1|1882155_1883364_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	6.4e-193
WP_077254151.1|1883390_1883606_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.9e-07
WP_021313626.1|1883602_1883923_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_032408655.1|1883931_1884270_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_048997608.1|1884266_1884716_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	83.2	2.3e-63
WP_094818661.1|1884712_1885060_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.9	2.0e-30
WP_021313623.1|1885116_1885821_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	2.5e-80
WP_029497345.1|1885851_1886256_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
WP_042936677.1|1886258_1886564_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	3.6e-28
WP_019706055.1|1886638_1887160_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	45.2	2.2e-09
1889036:1889053	attR	TGTAACGCTTACTGATGA	NA	NA	NA	NA
>prophage 4
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	1954455	2002063	5521444	tail,holin,terminase,transposase,integrase	Salmonella_phage(42.55%)	58	1957022:1957036	2009258:2009272
WP_004151980.1|1954455_1955922_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1955989_1957567_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1957022:1957036	attL	GCCGCTTCCGCCACC	NA	NA	NA	NA
WP_094818678.1|1957757_1959008_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	3.1e-206
WP_032441415.1|1959024_1959216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818679.1|1959212_1959806_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	3.7e-109
WP_094818680.1|1959802_1959961_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	82.4	6.7e-18
WP_009485475.1|1959953_1960247_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|1960356_1960605_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_064148642.1|1960655_1961678_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.6	1.4e-180
WP_059065285.1|1961687_1962587_-	endonuclease	NA	Q858E0	Salmonella_phage	91.0	1.9e-157
WP_004164029.1|1962583_1962883_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1963247_1963829_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_094818681.1|1963983_1964217_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	7.0e-24
WP_004152537.1|1964363_1964573_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_094818682.1|1964572_1965340_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	90.6	9.8e-139
WP_032418532.1|1965336_1966122_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1966241_1966589_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1966781_1967192_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1967175_1967367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1967363_1968008_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1968301_1968769_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1968768_1969062_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_085955245.1|1970122_1971315_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_094818683.1|1971514_1971796_+	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	41.2	3.6e-06
WP_064106727.1|1971788_1972127_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	6.4e-50
WP_017896964.1|1972202_1972532_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	3.0e-28
WP_094818622.1|1972589_1973210_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	73.2	1.1e-76
WP_094818621.1|1973206_1974682_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	92.4	4.2e-279
WP_040173633.1|1974726_1975098_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	94.3	3.0e-61
WP_004152472.1|1975805_1976009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149313.1|1976012_1977692_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152470.1|1977688_1977994_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004221310.1|1978320_1978707_+	peptidase	NA	T1SAP9	Salmonella_phage	58.6	1.9e-34
WP_004197367.1|1978719_1979727_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|1979736_1980129_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_024622837.1|1980121_1980400_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004197381.1|1980448_1981060_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_094818619.1|1981059_1983537_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.8e-267
WP_094818618.1|1983538_1984009_+	hypothetical protein	NA	Q858G2	Salmonella_phage	54.6	1.1e-44
WP_004197440.1|1984001_1984499_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	43.6	4.0e-24
WP_024622832.1|1984511_1987256_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.7	7.4e-96
WP_094818617.1|1987255_1990645_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	41.6	5.3e-120
WP_094818616.1|1990654_1991269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094818615.1|1991313_1991610_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	90.6	9.2e-45
WP_048293155.1|1991897_1992275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025860592.1|1992271_1992484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094818614.1|1992726_1993422_-	anti-repressor protein	NA	A0A193GYJ9	Enterobacter_phage	52.5	2.6e-61
WP_158208721.1|1993505_1993694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004141317.1|1993797_1994343_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_094818613.1|1994729_1995026_-	hypothetical protein	NA	T1SA06	Salmonella_phage	64.3	3.1e-24
WP_094818612.1|1995177_1997391_+	hypothetical protein	NA	A0A0U3DL17	Klebsiella_phage	42.9	8.9e-108
WP_094818611.1|1997387_1997639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142295460.1|1997671_1997944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062955010.1|1998188_1998593_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1998579_1998885_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_094818610.1|1998874_1999504_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.0	8.1e-91
WP_094818609.1|1999500_1999998_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	73.3	2.1e-57
WP_004152009.1|2000194_2002063_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
2009258:2009272	attR	GGTGGCGGAAGCGGC	NA	NA	NA	NA
>prophage 5
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	2332260	2339166	5521444	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|2332260_2333124_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|2333134_2333908_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|2334149_2335043_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|2335288_2336650_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|2336968_2337691_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_062955084.1|2337687_2339166_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 6
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	2381091	2390656	5521444		Enterobacteria_phage(28.57%)	8	NA	NA
WP_062955058.1|2381091_2382498_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_062955056.1|2382721_2383786_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
WP_062956182.1|2383799_2384669_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_048996045.1|2384700_2385591_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_004175260.1|2385605_2386160_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_000704907.1|2386339_2387506_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_016947628.1|2387934_2388054_-	small membrane protein	NA	NA	NA	NA	NA
WP_062955151.1|2389651_2390656_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
>prophage 7
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	3378695	3389583	5521444		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|3378695_3381803_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|3381857_3383123_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|3383153_3384242_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|3384328_3384589_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|3384886_3385747_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|3385767_3386529_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|3386790_3387693_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_048260141.1|3387704_3388970_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	3.9e-233
WP_002210516.1|3388962_3389583_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	3409549	3417626	5521444	transposase	Escherichia_phage(83.33%)	10	NA	NA
WP_002903722.1|3409549_3409876_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.9	1.1e-22
WP_002903720.1|3410020_3410362_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_002903719.1|3410439_3411000_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_004219441.1|3410993_3411704_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_002903714.1|3411805_3412075_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_094818672.1|3412225_3414616_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.3	1.2e-203
WP_001067855.1|3414652_3415357_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152235.1|3415499_3416117_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.1	2.6e-73
WP_002903710.1|3416118_3416976_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	35.9	9.0e-24
WP_004152236.1|3417017_3417626_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.3	3.2e-23
>prophage 9
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	3619107	3657573	5521444	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	3648686:3648700	3654695:3654709
WP_004152576.1|3619107_3619974_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3619973_3620747_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3620743_3621940_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3621939_3622293_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3622294_3622948_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3623001_3623568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3623610_3623793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3623842_3624184_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3624183_3625206_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3625208_3625511_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3625511_3626111_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3626110_3628114_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3628103_3628256_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3628291_3628717_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3628720_3629161_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3629171_3630317_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3630320_3630761_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3630855_3631242_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3631241_3631748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3631744_3632164_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3632132_3632414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3632453_3633395_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3633406_3633901_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3633904_3635107_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3635158_3635707_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3635762_3637214_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3637451_3638852_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3638802_3639555_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3639656_3639977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3640211_3640601_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3640597_3641128_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3641130_3641379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3641784_3642567_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3642563_3643040_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3643036_3643999_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3644000_3645659_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3646235_3646457_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3646554_3647223_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3647393_3647708_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3647700_3647889_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3648058_3648424_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3648416_3648671_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3648642_3648861_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3648686:3648700	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3648857_3649283_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3649279_3649474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3649470_3650298_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3650402_3650921_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3650926_3651637_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3651626_3651851_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3651847_3652060_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3652056_3652536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3652714_3652957_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3652937_3654119_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3654315_3654864_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3654695:3654709	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3655062_3656595_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3656811_3657573_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 10
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	3690506	3721390	5521444	holin,integrase,transposase	Enterobacteria_phage(36.67%)	40	3690288:3690303	3718696:3718711
3690288:3690303	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3690506_3691178_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3691364_3692192_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3692267_3693533_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3693534_3693954_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3694033_3695518_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3696415_3696838_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3697419_3698124_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|3698739_3699087_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001261740.1|3699250_3700042_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001067855.1|3701023_3701728_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004218565.1|3701899_3702439_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3702435_3702735_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004232548.1|3703384_3704074_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3704073_3704214_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3704210_3704849_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3704841_3705510_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3705506_3705674_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3705654_3706122_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3706642_3707671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3707878_3708124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3708179_3708482_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3708478_3709327_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3709323_3710184_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3710269_3710491_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3710531_3710759_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3710870_3711569_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3711591_3711711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3711856_3712933_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3713014_3713218_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3713646_3713841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3713929_3714214_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3714229_3715075_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3715071_3715359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3715360_3716041_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3716037_3716466_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3716462_3717125_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|3717332_3718520_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3718696_3719587_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3718696:3718711	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3719586_3720579_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3720580_3721390_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 11
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	4098838	4191789	5521444	lysis,portal,tail,terminase,plate,head,protease,integrase,tRNA,capsid	Salmonella_phage(56.9%)	93	4154364:4154382	4191864:4191882
WP_002898139.1|4098838_4100131_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|4100221_4101565_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|4101573_4102185_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|4102307_4106561_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|4106696_4107191_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|4107696_4108692_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|4108806_4110573_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|4110573_4112295_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|4112339_4113041_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4113394_4113613_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|4113733_4116013_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|4116043_4116361_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|4116686_4116908_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|4116984_4118925_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|4118921_4120037_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|4120183_4121842_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|4122261_4122957_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|4123072_4123972_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|4124115_4125768_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|4125778_4126747_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|4126958_4127393_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|4127544_4129263_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|4129301_4130303_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|4130313_4131756_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|4131843_4132857_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|4132853_4133684_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|4133715_4134855_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|4135732_4136248_+	lipoprotein	NA	NA	NA	NA	NA
WP_032419144.1|4136474_4137203_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|4137223_4137955_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|4137961_4138678_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|4138677_4139346_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|4139529_4140261_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|4140303_4141776_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|4141772_4142489_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|4142567_4143695_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|4143736_4144225_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|4144282_4145128_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|4145124_4146078_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|4146088_4147222_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|4147385_4148498_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|4148846_4149326_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|4149414_4150317_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|4151138_4151426_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|4151628_4151892_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|4151898_4152282_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|4152548_4154234_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
4154364:4154382	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|4154453_4154672_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|4154763_4155864_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|4155860_4156346_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|4156342_4158970_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|4158962_4159082_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|4159096_4159396_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|4159448_4159964_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|4159973_4161146_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|4161284_4162361_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|4162390_4162594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|4162590_4163322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|4163325_4166277_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|4166278_4166878_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|4166870_4167779_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|4167765_4168128_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|4168124_4168697_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|4168791_4169484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|4169480_4169927_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|4169919_4170351_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|4170446_4170875_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|4170871_4171255_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|4171259_4171769_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|4171749_4171965_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|4171968_4172172_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|4172171_4172636_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|4172731_4173382_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|4173385_4174444_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|4174460_4175294_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|4175436_4177203_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|4177202_4178228_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|4178289_4180032_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|4180307_4180985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|4181099_4181333_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|4181343_4181532_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|4181685_4184100_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|4184096_4184954_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|4184950_4185178_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|4185177_4185411_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|4185478_4185820_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|4185783_4185984_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|4185991_4186501_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|4186533_4186755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|4186900_4187779_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|4187790_4188735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|4188833_4190318_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|4190736_4191789_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
4191864:4191882	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 12
NZ_CP047160	Klebsiella pneumoniae strain KP19-2029 chromosome, complete genome	5521444	4836548	4848201	5521444	integrase	Enterobacteria_phage(70.0%)	13	4836998:4837012	4860054:4860068
WP_004144574.1|4836548_4837652_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4836998:4837012	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4837662_4838916_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4839268_4840459_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4840446_4841397_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4841396_4841822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4842389_4842956_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4842973_4843219_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4843215_4843953_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4844494_4844761_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4844757_4845315_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4845311_4845539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4845535_4845856_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4845867_4848201_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4860054:4860068	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 1
NZ_CP047161	Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence	127240	1796	62081	127240	transposase,protease	Escherichia_phage(36.36%)	55	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_101307356.1|5160_5418_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_072095570.1|5417_6122_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399794.1|6132_6699_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|6720_7032_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_021519752.1|7046_7412_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001254386.1|7445_7673_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_015059009.1|7766_8453_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|8643_9027_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_015059008.1|9303_9951_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234445.1|10247_11069_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_001272251.1|11179_11476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|12390_12549_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001276217.1|12828_13548_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845953.1|13544_13979_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000006003.1|16131_16365_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290834.1|16422_16950_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_015059007.1|17792_18356_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
WP_000170695.1|18402_19764_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|19815_20046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372796.1|21445_23113_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
WP_001027493.1|23426_23618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271762.1|23614_24037_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001198928.1|24083_24509_-	antirestriction protein	NA	NA	NA	NA	NA
WP_011161242.1|24481_25054_-	YubH family protein	NA	NA	NA	NA	NA
WP_000274503.1|25753_26188_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104881.1|26201_26423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|26423_27107_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_032146011.1|27183_27477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000959884.1|27623_28586_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_000361389.1|28588_28939_+	protein stbB	NA	NA	NA	NA	NA
WP_001333089.1|29061_29343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071557810.1|31153_31294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|31284_31989_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_012372818.1|32438_33194_-	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
WP_000027057.1|33363_34224_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_064441864.1|34406_34943_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
WP_000957857.1|35034_35223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839979.1|38483_39002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|39006_39423_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_012579081.1|42262_43186_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_013188475.1|43265_44141_-	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_002210513.1|48145_48907_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002904004.1|48927_49788_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_001067855.1|51992_52697_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014343468.1|52736_53210_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
WP_013213985.1|53332_54313_+|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
WP_004199234.1|54588_55470_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_013213989.1|57329_57755_-	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
WP_013213990.1|57865_58144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|59686_60247_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001067855.1|61376_62081_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP047161	Klebsiella pneumoniae strain KP19-2029 plasmid pKP19-2029-KPC2, complete sequence	127240	68137	115682	127240	integrase,transposase	Escherichia_phage(38.1%)	57	61324:61383	115676:116496
61324:61383	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_159154139.1|68137_69142_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000361404.1|70674_71697_-	helicase UvrD	NA	NA	NA	NA	NA
WP_004206609.1|71681_73244_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|73317_73734_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|73730_73961_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011977810.1|74539_75484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032738650.1|75562_75913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214008.1|75970_76492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977813.1|76537_76741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977814.1|76770_77775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013214009.1|77958_78738_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_013214010.1|78783_79041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|79818_80685_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_011977818.1|81794_83000_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_086523286.1|82996_83974_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
WP_013214011.1|84055_85327_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
WP_001568036.1|85326_85758_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_004152765.1|86167_87652_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152353.1|87900_88872_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_013214012.1|88874_89546_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|89608_89839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151488309.1|90275_90977_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	2.1e-26
WP_001568042.1|90976_91198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|91207_91627_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_013214013.1|91680_92448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013023797.1|92891_93557_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_013214014.1|93599_94106_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_001568047.1|94148_94340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|94527_94782_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_001568049.1|94816_95137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568050.1|95816_96044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568051.1|96135_96366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343515.1|96417_97773_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_014343514.1|97820_98384_+	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	7.4e-19
WP_014343512.1|99216_99759_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_001568055.1|99807_100056_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_015493064.1|100125_102183_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.2e-21
WP_001568057.1|102227_102659_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001568058.1|102655_103384_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_013023807.1|103380_103707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343510.1|103762_104137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343509.1|104364_104523_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_040245921.1|105215_105488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040245917.1|105484_105835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343505.1|105849_106167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343501.1|107007_107364_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	7.5e-25
WP_014343500.1|107424_107637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343499.1|107647_107872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343498.1|107952_108273_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	1.5e-08
WP_004152721.1|108262_108541_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_001067855.1|108822_109527_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015493085.1|109855_110806_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	6.6e-76
WP_015493086.1|110802_111414_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_015493087.1|111410_111806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|112319_113300_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_042934582.1|113951_114509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|114977_115682_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
115676:116496	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCGCGCGACGAGCAGCAGCACCAGGAGCAGAAGCACGTCGAGAAAAAGCAACAGCAGATCGAGCAGCGCCCACGGCGGGCCGCTCGCATCGGATAAGTCGAAAAATCCGGCTAAAGTGGCCGAGCTGCACATCAGGCCGCGCGGTTTTCCTCCCTGATCGCCGGCGCGGTTTCTTCCTCCCTGAACCGCATGCAGACTTGCCGCCTCGGACACCCCGAGGCGGTTTTTTTTCGCCTCGCTCGAGCATCGCCGCATCCGACGATGCCGAGACGACCAGGCCGCGCACGTCGAGCTGCAGCATCGCCATTGCCGACGATGGCACCAGGTCGCCGGCGGTGGCCACCGACCTCGAGCTCGCATCGCCACATCCGACGATGCGCGCCGGCGTCGACCATCGCCAGGTCTGACGATGGCGGCCGCCCTGCCCTGGATCTCGCATCGCCATTTCTGGCGATGAGATCCACGGAGCGGCCATTTAGACCCGCCAATAACGACCCGGCCAAGATAAATCGCATGACGGCCTTTTTGGCCGGGGGTAGCATGACCGGACACTTTGCGTATGCCCAAAGGAGCCCGCAAGTATGCGCAGGACGAAGCCAGTAGCCGCGCCGATGGTGGCGCGGGTCTATCTGCGCGTCAGCACCGACGCGCAGGACTTGGAACGCCAAGAGGCGATCACTACGGCCGCGAAGGCCGCCGGCTACTACGTCGCCGGCATCTACCGTGAGAAGGCATCCGGCGCACGCGCCGACCGGCCTGAGCTG	NA	NA	NA	NA
