The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047165	Pelistega sp. NLN63 chromosome, complete genome	2326689	332486	339467	2326689	tRNA	Moraxella_phage(33.33%)	7	NA	NA
WP_159990474.1|332486_332768_+	DNA-binding protein HU	NA	A4JWM7	Burkholderia_virus	56.7	8.2e-19
WP_159990475.1|333678_334047_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	39.5	1.5e-12
WP_159990476.1|334314_335604_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.1	2.8e-69
WP_159990477.1|335750_336782_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	50.4	2.9e-93
WP_159990478.1|336912_337548_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_159990479.1|337857_338607_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.6	8.0e-61
WP_159990480.1|338606_339467_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.3	2.4e-29
>prophage 2
NZ_CP047165	Pelistega sp. NLN63 chromosome, complete genome	2326689	712064	811110	2326689	transposase,protease,terminase,capsid,portal,head,holin,integrase,tail	Burkholderia_phage(10.53%)	101	735168:735190	811131:811153
WP_159990754.1|712064_712904_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_159990755.1|712936_713116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990757.1|713429_713876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990758.1|713879_715052_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.2	5.9e-18
WP_159990759.1|715465_715891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990761.1|716119_716476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990762.1|716678_716993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990763.1|716976_717540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990764.1|717810_718299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990765.1|718382_718793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990766.1|718978_719290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990767.1|719719_720331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990768.1|720450_720705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990769.1|720834_721137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990770.1|721306_721594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990771.1|722564_723305_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_159990772.1|723307_724267_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	32.2	2.2e-07
WP_159990773.1|724408_725227_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_159992070.1|725475_727434_-	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	25.2	1.9e-24
WP_159990774.1|727691_730037_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_159990775.1|730839_731061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159990776.1|731092_731350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159990777.1|731550_734817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159992071.1|734875_735181_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
735168:735190	attL	TTTTGGGGCTGTATTAGATTAGC	NA	NA	NA	NA
WP_159990779.1|735866_736250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990781.1|736448_736919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990783.1|736966_737410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990784.1|737457_737619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990786.1|737760_738120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990788.1|739011_739533_-	lysozyme	NA	F1ADS8	Caulobacter_phage	34.6	1.6e-12
WP_159990790.1|739529_739796_-|holin	holin	holin	NA	NA	NA	NA
WP_159990792.1|739857_740196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990794.1|740265_740454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990796.1|740434_740797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990798.1|740806_747259_-	DUF1983 domain-containing protein	NA	A0A0M3LQG1	Mannheimia_phage	50.0	1.8e-47
WP_159990800.1|747243_747624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990802.1|747626_748124_-	DUF1833 domain-containing protein	NA	NA	NA	NA	NA
WP_159990804.1|748134_748491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990806.1|748500_751926_-|tail	phage tail tape measure protein	tail	I6P8E3	Pseudomonas_phage	25.2	1.9e-24
WP_159990808.1|751986_752445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990810.1|752482_752635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990812.1|752760_753132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990814.1|753131_753791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990816.1|753826_754141_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_159990817.1|754137_754587_-	hypothetical protein	NA	A0A1P8DTH7	Proteus_phage	31.1	1.3e-10
WP_159990818.1|754576_754906_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_159990819.1|754905_755238_-	hypothetical protein	NA	C4ML08	Xanthomonas_virus	32.1	7.0e-09
WP_159990820.1|755247_755451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990821.1|755507_756743_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	56.1	3.3e-128
WP_159990822.1|756746_757595_-|protease	Clp protease ClpP	protease	Q3HQS9	Burkholderia_phage	47.2	1.5e-60
WP_159990823.1|757581_758799_-|portal	phage portal protein	portal	Q3HQS8	Burkholderia_phage	50.0	2.8e-87
WP_159990824.1|758789_760520_-|terminase	phage terminase small subunit P27 family	terminase	A0A0U2C138	Paracoccus_phage	43.2	2.0e-123
WP_159990825.1|760500_761037_-|terminase	phage terminase small subunit P27 family	terminase	H0USW2	Bacillus_phage	29.4	6.4e-12
WP_159990826.1|761206_761542_-	HNH endonuclease	NA	C4ML58	Xanthomonas_virus	59.0	7.3e-22
WP_159990827.1|761678_762317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990828.1|762309_763215_-	DNA-processing protein DprA	NA	S6BFL3	Thermus_phage	40.4	7.2e-40
WP_159990829.1|763377_764070_-	phage repressor protein	NA	A0A0R6PGW1	Moraxella_phage	56.0	2.9e-25
WP_159990830.1|764657_764846_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_159990831.1|765015_765252_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_159990832.1|765220_765499_+	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	A0A1S5SCV8	Streptococcus_phage	47.6	7.9e-14
WP_159990833.1|766432_768709_-	hypothetical protein	NA	A0A2D1GN57	Marinobacter_phage	31.3	7.1e-76
WP_159990834.1|768705_768975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159990835.1|768980_769274_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_159990836.1|769445_769667_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	52.5	1.0e-08
WP_159992072.1|769768_770473_+	helix-turn-helix transcriptional regulator	NA	A0A0U4JEE2	Pseudomonas_phage	34.6	4.5e-13
WP_159990837.1|770563_772195_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_159990838.1|772217_773075_+	DNA adenine methylase	NA	A0A2K9R7J9	Dishui_lake_phycodnavirus	24.5	3.6e-17
WP_159990839.1|773316_773493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159990840.1|773467_773671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159990841.1|773704_774040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159990842.1|774062_774929_+	DUF2303 family protein	NA	NA	NA	NA	NA
WP_159990843.1|775014_775281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159990844.1|775527_776184_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_159990845.1|776699_777416_+	hypothetical protein	NA	Q7Y5V4	Haemophilus_phage	62.2	4.2e-35
WP_159990846.1|777707_778388_+	hypothetical protein	NA	A0A0P0IDX3	Acinetobacter_phage	55.1	3.8e-25
WP_159990847.1|778672_779353_+	phage repressor protein	NA	A0A0R6PGW1	Moraxella_phage	69.4	1.5e-37
WP_159990848.1|779472_780111_+	hypothetical protein	NA	A0A1B0XU26	Freshwater_phage	28.4	3.4e-12
WP_159990849.1|780112_780553_+	single-stranded DNA-binding protein	NA	A0A291LCB6	Klebsiella_phage	58.6	2.4e-33
WP_159992073.1|780701_780875_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_159990850.1|780876_782076_-|integrase	tyrosine-type recombinase/integrase	integrase	Q858E8	Salmonella_phage	52.1	1.0e-110
WP_159990851.1|782281_783874_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	35.0	1.2e-18
WP_159990852.1|783888_785349_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.7	7.9e-97
WP_159990853.1|785574_789615_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	61.6	7.2e-148
WP_159990854.1|790016_790886_+	peptidase S11	NA	NA	NA	NA	NA
WP_159990855.1|791314_792022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159992074.1|792293_792746_+	GatB/YqeY domain-containing protein	NA	A0A218KC79	Bacillus_phage	32.0	2.4e-07
WP_159990856.1|793044_794100_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_159990857.1|794293_794641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159990858.1|794597_796580_-	UvrD-helicase domain-containing protein	NA	A0A1V0SAV1	Catovirus	25.2	2.1e-15
WP_159990859.1|796724_798224_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_159990860.1|798846_801138_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	3.9e-175
WP_159990861.1|801162_801462_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	47.5	1.8e-11
WP_159990862.1|801661_801898_+	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	67.7	7.2e-16
WP_159990863.1|802250_802652_+	DUF192 domain-containing protein	NA	A0A222YVT9	Synechococcus_phage	44.2	5.9e-18
WP_159990864.1|802680_803046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159990865.1|803487_804471_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_159990866.1|804470_807218_+	ribosome-associated ATPase/putative transporter RbbA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.6	2.1e-18
WP_159990867.1|807219_808344_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_159990868.1|808364_809771_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_159992075.1|809786_810329_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.4	4.3e-16
WP_159990869.1|810456_811110_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
811131:811153	attR	GCTAATCTAATACAGCCCCAAAA	NA	NA	NA	NA
