The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047157	Bacillus velezensis strain FJAT-45028 chromosome, complete genome	3986791	643937	653828	3986791		Synechococcus_phage(50.0%)	9	NA	NA
WP_007408896.1|643937_645230_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_003155762.1|645305_646025_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	5.2e-49
WP_003155758.1|646024_646279_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_015388591.1|646275_646959_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003155755.1|646942_649171_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	3.2e-158
WP_003155754.1|649146_650577_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.6e-54
WP_015388588.1|650668_651709_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	1.4e-63
WP_003155752.1|651705_652293_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.3	1.0e-26
WP_159164876.1|652289_653828_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	6.7e-78
>prophage 2
NZ_CP047157	Bacillus velezensis strain FJAT-45028 chromosome, complete genome	3986791	1209246	1244736	3986791	tail,portal,holin,plate,terminase	Bacillus_phage(35.48%)	46	NA	NA
WP_003154898.1|1209246_1210605_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	1.2e-14
WP_014304836.1|1211066_1211258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015388360.1|1211333_1212098_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014304838.1|1212245_1212713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920760.1|1212917_1214054_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|1214043_1214178_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_003154880.1|1214320_1215274_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154878.1|1215311_1215689_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	40.6	1.1e-15
WP_003154876.1|1215798_1216404_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	46.8	7.4e-41
WP_003154873.1|1216558_1217149_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|1217297_1217636_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_003154869.1|1217827_1218007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048367154.1|1217996_1218824_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.0	1.7e-19
WP_043867013.1|1218723_1219524_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.5	1.2e-59
WP_003154861.1|1219788_1220130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154859.1|1220119_1220323_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
WP_003154857.1|1220435_1220948_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	5.0e-22
WP_043867015.1|1221060_1221858_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	50.6	9.4e-60
WP_044053123.1|1221854_1223153_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.4	4.2e-150
WP_099762611.1|1223201_1224581_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.4	5.1e-138
WP_014304846.1|1224612_1225461_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	57.6	4.4e-55
WP_003154848.1|1225487_1226423_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	2.5e-104
WP_060657682.1|1226439_1226823_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_003154844.1|1226819_1227176_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_014304847.1|1227172_1227676_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_014304848.1|1227672_1228119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154839.1|1228115_1228325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014304849.1|1228324_1229722_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.6	6.9e-82
WP_003154837.1|1229723_1230167_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|1230243_1230690_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|1230731_1230884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159164913.1|1230871_1235914_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	46.6	1.9e-41
WP_007610816.1|1235906_1236566_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
WP_159164914.1|1236579_1237560_+|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
WP_007610818.1|1237556_1237823_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_060657679.1|1237926_1238352_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.1e-11
WP_079004808.1|1238344_1239391_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.0e-69
WP_003154823.1|1239374_1239953_+	YmfQ family protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	2.4e-12
WP_044053127.1|1239949_1240222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154821.1|1240224_1241847_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.3	5.3e-41
WP_014304856.1|1241859_1242231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044053582.1|1242236_1242434_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	5.6e-14
WP_044053129.1|1242490_1243252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154815.1|1243303_1243567_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|1243580_1243844_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_024085195.1|1243857_1244736_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	4.8e-81
>prophage 3
NZ_CP047157	Bacillus velezensis strain FJAT-45028 chromosome, complete genome	3986791	1795369	1801583	3986791		Bacillus_phage(50.0%)	7	NA	NA
WP_014305044.1|1795369_1795762_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	6.5e-30
WP_003154060.1|1795721_1797824_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
WP_003154059.1|1797841_1798831_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.6	8.7e-156
WP_044053225.1|1798879_1799500_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	1.2e-46
WP_044053226.1|1799549_1800308_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	49.6	4.0e-52
WP_015388200.1|1800341_1800566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417523.1|1800614_1801583_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 4
NZ_CP047157	Bacillus velezensis strain FJAT-45028 chromosome, complete genome	3986791	1990137	2037158	3986791	tail,portal,integrase,tRNA,protease,head,capsid,holin,plate,terminase	Bacillus_phage(54.29%)	56	2030977:2030992	2032949:2032964
WP_159164933.1|1990137_1991964_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	39.9	2.1e-102
WP_048367302.1|1991978_1992419_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_014305124.1|1992611_1993304_+	hypothetical protein	NA	Q9AZW5	Lactococcus_phage	31.9	4.1e-11
WP_088005396.1|1993411_1994422_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	98.2	2.5e-190
WP_014305126.1|1994478_1994742_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	1.1e-25
WP_003220204.1|1994756_1994969_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	59.4	1.4e-15
WP_043867136.1|1995020_1995209_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	98.4	8.2e-31
WP_014305128.1|1995205_1995568_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	90.8	7.1e-55
WP_088005397.1|1995564_1996842_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	77.9	7.6e-144
WP_159164934.1|1996854_1999419_-	peptidase G2	NA	D6R401	Bacillus_phage	57.0	5.5e-287
WP_088005399.1|1999469_2001173_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	56.5	1.8e-180
WP_088005400.1|2001187_2002027_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	58.3	4.7e-94
WP_159164935.1|2002020_2006508_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.5	8.5e-65
WP_049627390.1|2006713_2007082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014418477.1|2007140_2007755_-|tail	tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	33.9	1.1e-23
WP_049627391.1|2007769_2008153_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_014418479.1|2008149_2008548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088005402.1|2008544_2008862_-|head	phage head closure protein	head	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	1.1e-11
WP_014418481.1|2008851_2009154_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	41.5	1.2e-10
WP_014305142.1|2009171_2009570_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	44.5	4.8e-12
WP_159164936.1|2009597_2010890_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.4	2.2e-90
WP_159164937.1|2010927_2011554_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	78.6	7.3e-84
WP_088005405.1|2011516_2012797_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	2.6e-152
WP_088005406.1|2012985_2014695_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.7e-205
WP_014418488.1|2014691_2015207_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	9.8e-34
WP_088005408.1|2015434_2015800_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	50.8	8.8e-29
WP_159164938.1|2016167_2017349_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_157662607.1|2017577_2018165_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_038458303.1|2018378_2018921_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
WP_038460747.1|2018917_2019370_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	56.6	3.4e-38
WP_157662608.1|2019424_2019601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014305154.1|2019692_2020376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143255889.1|2020365_2021511_-	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_088005412.1|2021813_2022248_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	69.3	2.6e-48
WP_017417491.1|2022356_2022707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038458311.1|2022850_2023264_-	hypothetical protein	NA	O64129	Bacillus_phage	92.6	8.0e-71
WP_038458314.1|2023268_2023523_-	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	39.8	1.1e-06
WP_038458317.1|2023522_2023735_-	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	60.3	5.4e-15
WP_024085435.1|2023731_2024112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085436.1|2024252_2024456_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
WP_024085438.1|2024703_2024844_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_159164939.1|2024951_2025500_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_038458325.1|2025815_2026649_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.8	3.5e-33
WP_024085443.1|2026632_2027505_-	replication protein	NA	V5UQV4	Oenococcus_phage	45.2	8.5e-46
WP_024085444.1|2027491_2027716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085445.1|2027733_2028057_-	DUF771 domain-containing protein	NA	Q9MC19	Lactococcus_phage	39.8	6.0e-13
WP_041482367.1|2028123_2028327_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014305167.1|2028492_2028891_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048367326.1|2029322_2030423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085448.1|2030665_2031772_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	58.0	1.7e-112
2030977:2030992	attL	TCAAGAGTTTTTAAAT	NA	NA	NA	NA
WP_003153850.1|2032044_2032590_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
WP_003153848.1|2032906_2033137_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
2032949:2032964	attR	ATTTAAAAACTCTTGA	NA	NA	NA	NA
WP_043867191.1|2033380_2035156_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003153843.1|2035202_2036378_-	MFS transporter	NA	NA	NA	NA	NA
WP_003153841.1|2036521_2036824_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_139886895.1|2036861_2037158_-|tRNA	threonyl-tRNA synthetase	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP047157	Bacillus velezensis strain FJAT-45028 chromosome, complete genome	3986791	2267791	2274044	3986791		Staphylococcus_phage(66.67%)	9	NA	NA
WP_003153378.1|2267791_2268385_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
WP_003153377.1|2268374_2269130_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.3	6.5e-10
WP_003153376.1|2269337_2269427_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153375.1|2269514_2270036_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|2270101_2270476_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|2270592_2271057_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_024085543.1|2271089_2272286_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_032857114.1|2272300_2272948_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	3.3e-39
WP_024085544.1|2272928_2274044_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.9	5.2e-56
>prophage 6
NZ_CP047157	Bacillus velezensis strain FJAT-45028 chromosome, complete genome	3986791	3111434	3198153	3986791	tail,portal,integrase,coat,protease,head,capsid,holin,plate,terminase	Bacillus_phage(50.0%)	100	3143351:3143386	3179399:3179434
WP_031306537.1|3111434_3112451_-|coat	spore coat protein YutH	coat	NA	NA	NA	NA
WP_003151934.1|3112605_3113106_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.4	6.8e-40
WP_003151932.1|3113132_3113903_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003151930.1|3113936_3114371_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_003151928.1|3114396_3114672_-	YutD family protein	NA	NA	NA	NA	NA
WP_003151923.1|3114888_3115785_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_044052933.1|3115986_3116964_+	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.2	7.9e-08
WP_024085756.1|3117001_3117760_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_032857626.1|3117886_3119281_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_052586528.1|3119298_3120120_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_014305754.1|3120139_3120991_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_044052931.1|3121017_3121371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044052930.1|3121443_3122808_-	allantoinase	NA	NA	NA	NA	NA
WP_044052929.1|3122987_3124583_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041481913.1|3125065_3125425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044052928.1|3126602_3127799_-	tetracycline resistance MFS efflux pump	NA	A0A2H4UVM2	Bodo_saltans_virus	20.5	2.6e-05
WP_044052927.1|3127920_3129174_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_044052926.1|3129192_3130434_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_060657587.1|3130653_3131523_+	ribonuclease	NA	NA	NA	NA	NA
WP_043867399.1|3131571_3132678_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	46.1	7.3e-18
WP_012118372.1|3132833_3133562_+	transcriptional regulator PhoB	NA	NA	NA	NA	NA
WP_060657583.1|3133586_3134441_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_003151895.1|3134454_3135339_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_159165033.1|3135343_3136222_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_159165034.1|3136258_3137524_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003151892.1|3137597_3138584_-	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-11
WP_015387752.1|3138779_3139706_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007410095.1|3139976_3140249_+	DUF1648 domain-containing protein	NA	NA	NA	NA	NA
WP_003151888.1|3140287_3140662_-	nucleotide excision repair endonuclease	NA	NA	NA	NA	NA
WP_072588408.1|3140728_3141844_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003151879.1|3142488_3143325_+	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.4	3.4e-20
3143351:3143386	attL	GGTTTTACTATTAACCGATGGAGCCTTCCATTTCGA	NA	NA	NA	NA
WP_159164973.1|3143723_3144290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159164974.1|3144603_3145767_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1P8CWN6	Bacillus_phage	50.2	5.0e-70
WP_015239640.1|3145813_3146236_-|holin	holin	holin	D6R405	Bacillus_phage	89.5	3.8e-60
WP_073982130.1|3146272_3146428_-	XkdX family protein	NA	A0A1W6JQ64	Staphylococcus_phage	58.1	4.0e-07
WP_159164975.1|3146429_3146813_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	55.8	1.6e-28
WP_159164976.1|3146809_3148042_-|plate	BppU family phage baseplate upper protein	plate	D6R402	Bacillus_phage	82.9	7.8e-146
WP_159164977.1|3148055_3150656_-	peptidase G2	NA	D6R401	Bacillus_phage	49.9	1.5e-234
WP_159164978.1|3150636_3152523_-	autolysin	NA	M5AC19	Bacillus_phage	35.8	2.3e-35
WP_159164979.1|3152535_3153366_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_159164980.1|3153370_3157609_-	transglycosylase SLT domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	32.1	2.1e-65
WP_083058866.1|3157808_3158189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058867.1|3158188_3158827_-	hypothetical protein	NA	A0A1J0MFV0	Staphylococcus_phage	32.6	2.8e-14
WP_159164981.1|3158826_3159210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058871.1|3159215_3159623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083058874.1|3159606_3159951_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_083058875.1|3159931_3160204_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	44.4	6.5e-13
WP_083058878.1|3160187_3161474_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	52.3	1.0e-87
WP_083058879.1|3161470_3162058_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	58.9	2.6e-54
WP_083058882.1|3162050_3163229_-|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	54.8	4.6e-111
WP_159164982.1|3163240_3164974_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	51.6	2.7e-168
WP_159165035.1|3164970_3165375_-|terminase	terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	40.4	1.6e-23
WP_083058886.1|3165452_3165821_-	HNH endonuclease	NA	A0A1B0T6C5	Bacillus_phage	52.8	1.9e-31
WP_159164983.1|3165817_3166036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159164984.1|3166070_3166325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159164985.1|3166564_3166852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159164986.1|3167046_3167259_-	cell division protein FtsK	NA	A0A0K2CPG8	Brevibacillus_phage	54.1	6.7e-05
WP_017417279.1|3167874_3168417_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.4	1.8e-54
WP_159165036.1|3168413_3168866_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.6	5.4e-36
WP_061573996.1|3169196_3169385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095060972.1|3169381_3169756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159164987.1|3169771_3169999_-	hypothetical protein	NA	A0A217EQZ3	Bacillus_phage	60.8	3.8e-22
WP_159164988.1|3169999_3170410_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	37.6	1.4e-14
WP_159164989.1|3170406_3170739_-	hypothetical protein	NA	F8WQ59	Bacillus_phage	52.2	8.3e-18
WP_159164990.1|3170822_3171083_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	43.2	3.3e-06
WP_159164991.1|3171079_3171487_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	43.5	6.1e-23
WP_159164992.1|3171483_3171888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085436.1|3172001_3172205_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
WP_015387918.1|3172452_3172593_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_159164993.1|3172700_3173249_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_159165037.1|3173564_3174395_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	34.5	5.4e-34
WP_159164994.1|3174378_3175245_-	hypothetical protein	NA	D2XR43	Bacillus_phage	61.4	5.1e-51
WP_146284097.1|3175436_3175667_-	hypothetical protein	NA	R9TQ08	Paenibacillus_phage	66.7	1.8e-16
WP_146284636.1|3175708_3175915_-	helix-turn-helix domain-containing protein	NA	A0A0U4B088	Bacillus_phage	34.4	5.9e-06
WP_146284096.1|3176090_3176480_+	helix-turn-helix domain-containing protein	NA	I3VYZ1	Thermoanaerobacterium_phage	35.9	9.4e-05
WP_146284095.1|3176704_3176902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159164995.1|3176898_3178023_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	26.5	5.8e-23
WP_159164996.1|3178299_3179337_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1J0MF14	Staphylococcus_phage	46.6	9.0e-87
WP_003151878.1|3179408_3180806_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
3179399:3179434	attR	GGTTTTACTATTAACCGATGGAGCCTTCCATTTCGA	NA	NA	NA	NA
WP_003151877.1|3180825_3181269_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_007410089.1|3181258_3182479_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	48.6	6.8e-118
WP_003151874.1|3182478_3183792_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_003151872.1|3183809_3184595_-	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
WP_003151857.1|3184771_3184924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387747.1|3185116_3185503_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003151853.1|3185586_3186402_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003151851.1|3186415_3187084_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003151850.1|3187076_3188102_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	2.2e-32
WP_003151848.1|3188424_3188775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151847.1|3188871_3189192_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003151846.1|3189194_3189560_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_003151845.1|3189629_3189866_-	YusG family protein	NA	NA	NA	NA	NA
WP_003151844.1|3189920_3190304_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_003151843.1|3190363_3190720_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	51.9	2.9e-21
WP_014305769.1|3190833_3192618_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003151841.1|3192636_3193812_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_015387743.1|3193822_3196192_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_025853877.1|3196553_3197462_-	proline dehydrogenase	NA	NA	NA	NA	NA
WP_003151832.1|3197551_3197809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003151830.1|3197820_3198153_+|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 7
NZ_CP047157	Bacillus velezensis strain FJAT-45028 chromosome, complete genome	3986791	3649932	3695053	3986791	coat,protease	Cafeteria_roenbergensis_virus(11.11%)	47	NA	NA
WP_003151043.1|3649932_3650592_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003151042.1|3650697_3650886_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_003151040.1|3650923_3651343_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024085923.1|3651733_3653113_+	amino acid permease	NA	NA	NA	NA	NA
WP_003151036.1|3653177_3653678_-	YwgA family protein	NA	NA	NA	NA	NA
WP_003151035.1|3653717_3655019_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
WP_003151034.1|3655179_3655404_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003151032.1|3655607_3656381_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151030.1|3656681_3656957_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032857138.1|3656957_3657512_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_003151027.1|3657609_3658530_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.3	8.4e-36
WP_003151025.1|3658526_3659480_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003151024.1|3659469_3660306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014306029.1|3660296_3661094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151021.1|3661062_3661986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151018.1|3662034_3662214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043867517.1|3662365_3663229_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003151014.1|3663275_3664175_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
WP_052115668.1|3664290_3665268_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003151012.1|3665304_3666276_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_072588365.1|3666538_3667303_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_024085927.1|3667422_3668202_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014306032.1|3668218_3669418_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_003151007.1|3669430_3670612_-	MFS transporter	NA	NA	NA	NA	NA
WP_014306034.1|3670608_3672027_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_003151003.1|3672044_3672806_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	4.4e-22
WP_003151000.1|3672802_3673513_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_159165009.1|3673502_3674117_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_044052810.1|3674278_3675517_-	MFS transporter	NA	NA	NA	NA	NA
WP_044052809.1|3675739_3676942_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	4.2e-27
WP_014306038.1|3676974_3678393_-	amino acid permease	NA	NA	NA	NA	NA
WP_044052808.1|3678417_3680100_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_003150992.1|3680171_3681719_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_044052807.1|3681926_3683213_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_003150988.1|3683398_3683860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015387544.1|3684075_3684531_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_024085934.1|3684527_3685376_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
WP_014306044.1|3685396_3686344_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	7.7e-69
WP_029972897.1|3686346_3687084_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_044052806.1|3687111_3688116_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014306047.1|3688117_3688861_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_044052805.1|3688850_3689972_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015387539.1|3689971_3690835_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003150976.1|3690835_3692005_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_044052804.1|3692027_3693452_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_024085938.1|3693456_3694227_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
WP_003150971.1|3694507_3695053_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
