The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP034754	Enterobacter hormaechei subsp. hoffmannii strain Eh1 chromosome, complete genome	4845040	815069	910886	4845040	integrase,protease,transposase,capsid,plate,tRNA,tail	Burkholderia_virus(34.09%)	102	899930:899947	905660:905677
WP_022647088.1|815069_815960_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155232.1|816019_816475_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_022647089.1|816651_817356_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_003856249.1|817345_817900_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_022647090.1|817973_820403_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.1	1.4e-37
WP_022647091.1|820600_823126_+	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_022647092.1|823363_825613_+	ferrichrome porin FhuA	NA	NA	NA	NA	NA
WP_022647093.1|825663_826461_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
WP_022647094.1|826460_827351_+	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_022647095.1|827347_829330_+	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_022647096.1|829423_830704_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_022647097.1|830881_832282_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_022647098.1|832367_832712_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_003856227.1|832769_833393_-	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_022647099.1|833416_834226_-	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_003856223.1|834218_834917_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_022647100.1|834999_836514_+	dGTPase	NA	NA	NA	NA	NA
WP_022647101.1|836646_838080_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	2.5e-26
WP_003856217.1|838226_839384_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022647102.1|839473_839863_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_003856214.1|839974_840799_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_022647103.1|840831_843507_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_022647104.1|843569_844364_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_022647105.1|844685_845411_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_015572722.1|845528_846380_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_008501910.1|846529_847255_+	UMP kinase	NA	NA	NA	NA	NA
WP_003856180.1|847422_847980_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_022647106.1|848072_849272_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003856176.1|849457_850216_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	43.0	1.4e-25
WP_003856175.1|850228_851086_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_022647108.1|851097_852450_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_022647109.1|852481_854899_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_006810039.1|855022_855517_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_022647110.1|855520_856546_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_003856165.1|856650_857106_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_003856164.1|857109_857898_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_022647111.1|857897_859046_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_022647112.1|859042_859639_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.8	2.7e-27
WP_022647113.1|859677_863160_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.5	1.0e-206
WP_003856154.1|863172_864132_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_022647114.1|864232_866365_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_022647115.1|866431_866821_+	VOC family protein	NA	NA	NA	NA	NA
WP_022647116.1|866879_868166_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_022647117.1|868192_868453_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_003856146.1|868439_868640_-	YaeP family protein	NA	NA	NA	NA	NA
WP_022647118.1|868835_869381_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_022647119.1|869377_869794_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_006810026.1|869833_870532_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_022647120.1|870578_872297_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_022647121.1|872409_873117_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_003856133.1|873113_873518_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_006810023.1|873624_874440_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_006118565.1|874662_875244_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	5.8e-67
WP_023307198.1|875421_875844_-|tail	tail fiber assembly protein	tail	A0A1B0V844	Salmonella_phage	49.3	1.9e-27
WP_159115388.1|875846_876956_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	53.9	2.5e-103
WP_159115321.1|877414_877993_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	2.2e-66
WP_159115322.1|877985_879089_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	53.3	2.1e-105
WP_159115323.1|879079_879427_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	3.5e-35
WP_059346644.1|879481_879994_-|plate	phage baseplate assembly protein V	plate	Q6QIA1	Burkholderia_phage	44.7	4.2e-21
WP_159115324.1|879993_881163_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	48.9	3.0e-86
WP_159115325.1|881150_881366_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	9.1e-18
WP_159115326.1|881362_882247_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.5	8.9e-51
WP_159115327.1|882246_884712_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.7	8.2e-171
WP_001148841.1|884804_884942_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_159115328.1|884907_885222_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023214047.1|885320_885602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165450822.1|885604_886129_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.8	3.6e-68
WP_020803500.1|886125_887553_-|tail	phage tail sheath protein	tail	A4JWK5	Burkholderia_virus	78.8	1.2e-217
WP_001446463.1|887542_887797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101809.1|887793_888258_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	4.1e-39
WP_000271666.1|888257_888704_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.1e-33
WP_011410689.1|888705_889062_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_011410688.1|889072_890026_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.0	7.5e-64
WP_159115329.1|890039_891137_-	peptidase	NA	A4JWJ9	Burkholderia_virus	50.1	6.0e-97
WP_159115330.1|891351_891810_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.0	6.4e-29
WP_159115331.1|891812_892634_-|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	61.2	2.2e-96
WP_159115332.1|892614_894111_-	DUF935 family protein	NA	Q6QIC0	Burkholderia_phage	60.9	3.8e-171
WP_159115333.1|894110_895634_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.4	5.8e-183
WP_023214055.1|895630_896176_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.0	2.7e-58
WP_006122433.1|896175_896487_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_000175096.1|896479_896812_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_159115334.1|896808_897459_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	32.8	1.1e-08
WP_159115335.1|897442_898171_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.7	4.9e-63
WP_016191696.1|898173_898524_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	1.2e-22
WP_059386490.1|898899_899466_-	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_045620424.1|899709_900480_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.3	4.5e-99
899930:899947	attL	AGTTTGTCCGCCAGTTCA	NA	NA	NA	NA
WP_159115336.1|900527_901061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044241752.1|901096_901507_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001041677.1|901595_901820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000042842.1|901816_902122_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
WP_105455006.1|902131_903040_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.4	1.8e-75
WP_159115337.1|903043_904813_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.2	4.8e-229
WP_032637455.1|904823_905990_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	60.6	4.8e-121
905660:905677	attR	TGAACTGGCGGACAAACT	NA	NA	NA	NA
WP_023214064.1|905992_906262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105455009.1|906279_906891_+	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	1.2e-75
WP_023214066.1|906970_907159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001569383.1|907155_907452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159115338.1|907438_908128_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	34.2	5.0e-25
WP_061351304.1|908124_908340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165450819.1|908329_908758_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.1	3.1e-25
WP_001281697.1|908754_909144_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	53.4	3.8e-30
WP_006810022.1|909854_910886_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	7.2e-36
>prophage 2
NZ_CP034754	Enterobacter hormaechei subsp. hoffmannii strain Eh1 chromosome, complete genome	4845040	953604	963238	4845040	integrase	Streptococcus_phage(33.33%)	10	952641:952654	963483:963496
952641:952654	attL	GCCTGAAGGTTTTG	NA	NA	NA	NA
WP_015571369.1|953604_954708_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.9	1.0e-59
WP_022647151.1|954719_955973_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	2.3e-97
WP_022647152.1|956313_957486_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	49.5	3.8e-110
WP_071785223.1|957482_957659_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_159115340.1|957667_959062_-	ATP-dependent helicase	NA	Q3LZN8	Bacteriophage	73.5	6.4e-213
WP_022647155.1|959094_959802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032621500.1|959798_960074_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	64.7	2.3e-26
WP_022647157.1|960063_960285_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032621498.1|960350_961109_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_022647159.1|961165_963238_-	hypothetical protein	NA	Q775A3	Bordetella_phage	67.7	3.1e-272
963483:963496	attR	GCCTGAAGGTTTTG	NA	NA	NA	NA
>prophage 3
NZ_CP034754	Enterobacter hormaechei subsp. hoffmannii strain Eh1 chromosome, complete genome	4845040	970107	976179	4845040		Shigella_phage(33.33%)	7	NA	NA
WP_022647167.1|970107_971802_+	hypothetical protein	NA	A0A0A6Z575	Enterobacter_phage	38.4	1.0e-50
WP_022647168.1|972147_973608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022647169.1|973600_974524_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	88.1	2.4e-155
WP_022647170.1|974520_974883_-	GtrA family protein	NA	U5P0S6	Shigella_phage	56.7	8.7e-29
WP_022647171.1|975069_975300_+	hypothetical protein	NA	A5LH82	Enterobacteria_phage	71.0	2.2e-22
WP_022647172.1|975280_975820_+	lysozyme	NA	H6WRZ4	Salmonella_phage	89.9	9.7e-93
WP_022647173.1|975816_976179_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	46.2	6.0e-14
>prophage 4
NZ_CP034754	Enterobacter hormaechei subsp. hoffmannii strain Eh1 chromosome, complete genome	4845040	2060807	2129694	4845040	integrase,holin,head,tail,terminase	Salmonella_phage(29.63%)	102	2056855:2056870	2116272:2116287
2056855:2056870	attL	ACCAGCCAGATTTTGC	NA	NA	NA	NA
WP_022647981.1|2060807_2061662_-	beta-1,4-mannosyl-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	NA	M1I711	Paramecium_bursaria_Chlorella_virus	32.5	3.1e-24
WP_022647982.1|2061854_2062565_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_022647983.1|2062582_2063143_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_022647984.1|2063142_2063481_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_022647985.1|2063631_2063958_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.5	2.1e-21
WP_022647986.1|2064069_2065284_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.7	2.2e-47
WP_022647987.1|2065298_2066318_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_045265461.1|2066522_2067809_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	60.0	1.8e-153
WP_045265462.1|2067840_2068089_-	excisionase family protein	NA	S4TND0	Salmonella_phage	54.3	8.9e-17
WP_045265463.1|2068196_2068427_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	96.1	2.0e-34
WP_045265464.1|2068435_2068675_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	50.0	6.3e-12
WP_126510787.1|2068637_2069030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045265465.1|2069029_2069248_-	TraR/DksA family transcriptional regulator	NA	A0A0P0ZCX5	Stx2-converting_phage	69.0	1.3e-19
WP_042889502.1|2069514_2069706_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	64.4	9.2e-14
WP_042889503.1|2069702_2069999_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	66.7	2.4e-29
WP_162184457.1|2069958_2070213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051479458.1|2070209_2070812_-	hypothetical protein	NA	A0A142IF90	Pseudomonas_phage	42.3	6.3e-24
WP_042889504.1|2070795_2071437_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	91.3	8.0e-110
WP_163382735.1|2071433_2071601_-	hypothetical protein	NA	G8C7S7	Escherichia_phage	96.4	1.9e-23
WP_042889505.1|2071597_2072026_-	hypothetical protein	NA	G8C7S8	Escherichia_phage	96.5	7.5e-72
WP_088401765.1|2072022_2072640_-	YqaJ viral recombinase family protein	NA	A0A0S2SY31	Pseudomonas_phage	57.3	6.2e-59
WP_088401766.1|2072636_2073383_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	3.1e-65
WP_088401767.1|2073401_2073686_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	91.5	1.2e-46
WP_044866643.1|2073758_2073968_-	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	94.2	1.1e-33
WP_088401768.1|2073967_2074198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163382736.1|2074188_2074353_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	94.2	2.3e-21
WP_088401769.1|2074349_2074619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026080591.1|2075611_2075809_+	hypothetical protein	NA	G8C7T7	Escherichia_phage	96.9	1.8e-25
WP_045265467.1|2075833_2076118_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_045265468.1|2076129_2076426_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_016042178.1|2076619_2077309_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	100.0	2.2e-126
WP_016042179.1|2077419_2077647_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	100.0	4.1e-37
WP_045265469.1|2077677_2078223_+	hypothetical protein	NA	K7P7P2	Enterobacteria_phage	97.2	3.6e-95
WP_015571544.1|2078312_2078459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088401770.1|2078451_2079351_+	DNA replication protein	NA	K7P7U6	Enterobacteria_phage	55.0	1.9e-80
WP_088401771.1|2079340_2080774_+	AAA family ATPase	NA	Q716D2	Shigella_phage	87.1	4.1e-231
WP_042889517.1|2080773_2081118_+	helix-turn-helix transcriptional regulator	NA	G8C7U7	Escherichia_phage	97.3	7.2e-57
WP_032668708.1|2081114_2081411_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	5.4e-29
WP_022651090.1|2081407_2081611_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_088401773.1|2081607_2082156_+	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	40.1	4.0e-25
WP_088401774.1|2082157_2082670_+	hypothetical protein	NA	G9L6B3	Escherichia_phage	74.9	2.1e-73
WP_125387033.1|2083268_2083511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088401775.1|2083759_2084191_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	43.0	2.2e-26
WP_051479461.1|2084183_2084765_+	hypothetical protein	NA	A0A2H4PQR4	Staphylococcus_phage	44.1	3.7e-21
WP_088401776.1|2084764_2084935_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	90.6	1.1e-18
WP_088401777.1|2084927_2085575_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	65.6	5.6e-71
WP_045336325.1|2085571_2086213_+	HNH endonuclease	NA	A0A2I7QND8	Vibrio_phage	46.5	9.6e-39
WP_047716523.1|2086316_2086940_+	hypothetical protein	NA	F1C5D0	Cronobacter_phage	72.2	3.3e-84
WP_016245438.1|2087525_2087927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|2087923_2088199_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_088401779.1|2088201_2088744_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	69.8	4.6e-74
WP_032105111.1|2088740_2089019_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	50.6	6.7e-13
WP_102752849.1|2088969_2089161_+	hypothetical protein	NA	K7PM01	Enterobacterial_phage	95.7	1.9e-19
WP_088401781.1|2089157_2089439_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	98.9	1.6e-46
WP_088401782.1|2089611_2090145_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.8	3.3e-93
WP_045332074.1|2090194_2090749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088401783.1|2090869_2091088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045281509.1|2091095_2091530_+	hypothetical protein	NA	Q716H4	Shigella_phage	74.8	2.2e-47
WP_088401784.1|2091526_2092774_+|terminase	terminase	terminase	I6RSK1	Salmonella_phage	99.5	3.1e-219
WP_023306057.1|2092789_2094145_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	73.2	3.2e-193
WP_113652443.1|2094095_2095028_+|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	83.4	2.7e-138
WP_045265486.1|2095031_2096294_+	hypothetical protein	NA	H6WRT2	Salmonella_phage	94.5	1.0e-225
WP_042889540.1|2096306_2096765_+	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	77.9	2.3e-58
WP_045265487.1|2096778_2097882_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	74.1	8.8e-157
WP_042889542.1|2097892_2098177_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	73.2	3.3e-31
WP_042889543.1|2098236_2098638_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	97.0	2.5e-69
WP_017384998.1|2098637_2098817_+	DUF551 domain-containing protein	NA	Q5G8X7	Enterobacteria_phage	91.5	1.2e-26
WP_022651014.1|2098809_2099172_+	hypothetical protein	NA	A0A1V0E5P3	Salmonella_phage	93.3	1.9e-63
WP_045265488.1|2099179_2099617_+	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	98.6	3.9e-76
WP_023306061.1|2099613_2100000_+	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	96.9	6.6e-67
WP_045265490.1|2100015_2100750_+	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	86.8	6.5e-116
WP_113652441.1|2100790_2101444_+	hypothetical protein	NA	I6R0Q2	Salmonella_phage	92.6	3.2e-114
WP_113652446.1|2101439_2101892_+	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	69.5	3.1e-52
WP_113652440.1|2102058_2102334_+	cor protein	NA	Q5G8V7	Enterobacteria_phage	67.9	3.7e-24
WP_042889549.1|2102456_2102831_+	hypothetical protein	NA	H6WRV1	Salmonella_phage	98.4	9.2e-66
WP_016062812.1|2102823_2103126_+	hypothetical protein	NA	H6WRV2	Salmonella_phage	100.0	3.3e-42
WP_042889550.1|2103218_2103623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113652439.1|2103687_2107086_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	50.5	3.6e-185
WP_113652438.1|2107085_2107433_+|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	94.8	1.2e-59
WP_063256121.1|2107602_2108307_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	97.0	2.3e-134
WP_071994346.1|2108306_2109026_+	C40 family peptidase	NA	A0A1V0E5M9	Salmonella_phage	86.1	6.6e-129
WP_022651027.1|2108968_2109496_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	98.3	1.3e-70
WP_113652437.1|2109505_2113003_+|tail	phage tail protein	tail	A0A1V0E5M1	Salmonella_phage	65.9	0.0e+00
WP_022648877.1|2113002_2113305_+	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	97.0	1.3e-49
WP_032622491.1|2113304_2113982_+	hypothetical protein	NA	K7PGV3	Enterobacterial_phage	96.9	1.9e-117
WP_134680954.1|2114384_2115668_+|tail	phage tail protein	tail	K7PHF0	Enterobacteria_phage	59.7	2.8e-146
WP_045265502.1|2115761_2116028_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	94.3	6.1e-40
WP_045265503.1|2116114_2116354_+	hypothetical protein	NA	K7P7E2	Enterobacteria_phage	88.5	8.2e-36
2116272:2116287	attR	ACCAGCCAGATTTTGC	NA	NA	NA	NA
WP_045265504.1|2116353_2116671_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.0	3.8e-20
WP_045265505.1|2116810_2118106_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_022647989.1|2118329_2119793_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	1.9e-45
WP_003857405.1|2119837_2120041_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	56.7	4.4e-14
WP_022647990.1|2120328_2120760_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	35.2	1.5e-16
WP_003857403.1|2120795_2121482_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022647991.1|2121572_2122319_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_022647992.1|2122462_2124496_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	1.1e-19
WP_071785206.1|2125110_2125338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022647994.1|2125900_2126119_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	62.7	8.3e-19
WP_022647995.1|2126486_2127176_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.5	2.2e-81
WP_006808847.1|2127438_2127678_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	91.1	1.5e-32
WP_022647996.1|2128004_2128424_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	7.2e-35
WP_032622206.1|2128425_2129694_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	90.8	2.1e-226
>prophage 5
NZ_CP034754	Enterobacter hormaechei subsp. hoffmannii strain Eh1 chromosome, complete genome	4845040	2307643	2318408	4845040	head,terminase	Erwinia_phage(42.86%)	13	NA	NA
WP_047352933.1|2307643_2309011_-	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	25.9	1.1e-31
WP_047352934.1|2309011_2309797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047352935.1|2309796_2310150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047352936.1|2310146_2310620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047352937.1|2310681_2310879_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	92.3	4.4e-27
WP_047352938.1|2310934_2311294_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_047352939.1|2311303_2311558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047352940.1|2311561_2312500_-	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	30.6	6.6e-28
WP_047352941.1|2312516_2313308_-	hypothetical protein	NA	A0A1S5R5Y7	Pseudomonas_phage	59.3	3.9e-13
WP_047352942.1|2313307_2314324_-	DUF2213 domain-containing protein	NA	A0A291LCH5	Klebsiella_phage	33.5	1.5e-14
WP_159115362.1|2314295_2315657_-|head	phage head morphogenesis protein	head	E5AGA5	Erwinia_phage	29.5	2.3e-13
WP_150317087.1|2315643_2317023_-	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_047352945.1|2317019_2318408_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	34.4	1.6e-62
>prophage 6
NZ_CP034754	Enterobacter hormaechei subsp. hoffmannii strain Eh1 chromosome, complete genome	4845040	3150146	3192684	4845040	integrase,holin,protease,portal,tail,terminase	Enterobacterial_phage(34.78%)	54	3141816:3141831	3193106:3193121
3141816:3141831	attL	CCAGCAGCGCGGCAAT	NA	NA	NA	NA
WP_032623297.1|3150146_3150467_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	76.4	2.5e-43
WP_032623296.1|3150466_3150706_-	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	96.2	2.7e-39
WP_032623294.1|3150805_3151072_+	DinI family protein	NA	K7P797	Enterobacteria_phage	95.5	1.4e-39
WP_032623293.1|3151165_3152449_-	hypothetical protein	NA	K7PHF0	Enterobacteria_phage	62.1	1.1e-150
WP_032622491.1|3152852_3153530_-	hypothetical protein	NA	K7PGV3	Enterobacterial_phage	96.9	1.9e-117
WP_032623291.1|3153529_3153832_-	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	98.0	1.5e-50
WP_032623290.1|3153831_3157305_-	host specificity protein J	NA	M9P0D8	Enterobacteria_phage	90.3	0.0e+00
WP_128755120.1|3157369_3157849_-	hypothetical protein	NA	M9NZH8	Enterobacteria_phage	98.7	1.2e-78
WP_032623287.1|3157933_3158551_-|tail	tail assembly protein	tail	K7PH59	Enterobacterial_phage	99.0	8.8e-106
WP_032623285.1|3158543_3159263_-	C40 family peptidase	NA	K7PJY5	Enterobacterial_phage	97.5	2.0e-141
WP_016063063.1|3159265_3160003_-|tail	phage minor tail protein L	tail	M9NYX1	Enterobacteria_phage	100.0	5.5e-147
WP_001704112.1|3160057_3160396_-|tail	tail protein	tail	E4WL34	Enterobacteria_phage	100.0	2.3e-60
WP_032623284.1|3160392_3163530_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	94.1	0.0e+00
WP_071993863.1|3163513_3163828_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	93.3	1.4e-51
WP_032623281.1|3163836_3164268_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	93.7	6.0e-69
WP_032623279.1|3164278_3165022_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	98.8	3.9e-132
WP_159115377.1|3165031_3165433_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	99.2	1.2e-71
WP_032623278.1|3165429_3166008_-|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	99.5	2.0e-96
WP_010429892.1|3166017_3166293_-	DNA breaking-rejoining protein	NA	K7PH55	Enterobacterial_phage	98.8	3.2e-39
WP_010429891.1|3166285_3166612_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	99.1	7.8e-53
WP_080688138.1|3166694_3168710_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	99.3	0.0e+00
WP_032623277.1|3168654_3170154_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	99.2	9.4e-287
WP_032623276.1|3170150_3170366_-	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	97.2	7.2e-31
WP_032623274.1|3170362_3172465_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	98.6	0.0e+00
WP_032623273.1|3172464_3172953_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	97.5	1.1e-79
WP_032623272.1|3173167_3173704_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	52.1	4.8e-07
WP_032623271.1|3173700_3174237_-	lysozyme	NA	K7PM52	Enterobacteria_phage	81.7	3.1e-83
WP_000286102.1|3174236_3174452_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	80.3	6.3e-27
WP_032623270.1|3174522_3175575_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	80.3	5.2e-175
WP_016240136.1|3175725_3175917_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	79.0	5.1e-20
WP_032623269.1|3176115_3176808_-	antitermination protein	NA	NA	NA	NA	NA
WP_032623268.1|3176829_3177891_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	55.4	9.2e-111
WP_032623267.1|3177887_3178580_-	antirepressor	NA	G0ZND1	Cronobacter_phage	54.2	1.2e-58
WP_032623266.1|3178594_3178981_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	87.6	4.3e-58
WP_032623264.1|3178977_3180912_-	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.9	1.7e-200
WP_032623420.1|3180904_3182197_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	47.6	4.1e-105
WP_032623263.1|3182202_3183066_-	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	85.1	3.1e-40
WP_020690687.1|3183055_3183235_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	8.6e-14
WP_032623262.1|3183407_3183956_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.7	3.4e-69
WP_032623260.1|3183948_3184212_-	helix-turn-helix transcriptional regulator	NA	A0A0P0ZCZ7	Stx2-converting_phage	57.5	1.3e-18
WP_032623258.1|3184309_3185005_+	helix-turn-helix domain-containing protein	NA	Q8HAA0	Salmonella_phage	70.0	2.7e-87
WP_023294084.1|3185723_3186095_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	90.2	2.9e-56
WP_032623253.1|3186148_3186979_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	77.5	1.3e-117
WP_032623251.1|3187114_3187654_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	75.4	2.7e-74
WP_032623250.1|3187641_3187839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032623249.1|3187835_3188339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032623248.1|3188335_3188563_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032623247.1|3188562_3188775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047363402.1|3189244_3189466_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	59.7	1.5e-12
WP_032623246.1|3189446_3190019_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	84.0	9.3e-94
WP_001515618.1|3190063_3190273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032623244.1|3190275_3191463_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GN00	Marinobacter_phage	30.0	1.9e-32
WP_006811332.1|3191711_3191972_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_032622478.1|3192174_3192684_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
3193106:3193121	attR	CCAGCAGCGCGGCAAT	NA	NA	NA	NA
>prophage 7
NZ_CP034754	Enterobacter hormaechei subsp. hoffmannii strain Eh1 chromosome, complete genome	4845040	3293672	3376943	4845040	integrase,holin,protease,capsid,portal,head,tRNA,tail,terminase	Enterobacterial_phage(30.91%)	92	3325930:3325944	3365897:3365911
WP_001286071.1|3293672_3294485_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_022648855.1|3294484_3295498_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022648856.1|3295565_3296702_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.3	5.2e-19
WP_022648857.1|3296813_3297818_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_022648858.1|3297902_3299081_-	MFS transporter	NA	NA	NA	NA	NA
WP_022648859.1|3299149_3300367_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_159115378.1|3300525_3302523_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_022648861.1|3302588_3302864_-	YfcL family protein	NA	NA	NA	NA	NA
WP_022648862.1|3302877_3303423_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_022648863.1|3303422_3304232_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_003861385.1|3304231_3305056_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_022648864.1|3305058_3306144_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	3.2e-87
WP_022648865.1|3306204_3307137_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_022648866.1|3307282_3307834_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_003861375.1|3307880_3308366_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_022648867.1|3308575_3310723_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_022648868.1|3310722_3312033_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_022648869.1|3312270_3312555_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_022648870.1|3312927_3314211_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_022648871.1|3314255_3315008_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_022648872.1|3315322_3316252_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	83.6	4.8e-140
WP_022648873.1|3316512_3316779_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	96.6	1.6e-40
WP_022648874.1|3316873_3318163_-	hypothetical protein	NA	K7PHF0	Enterobacteria_phage	63.3	2.5e-147
WP_022648876.1|3318566_3319244_-	hypothetical protein	NA	K7PGV3	Enterobacterial_phage	96.4	6.0e-116
WP_022648877.1|3319243_3319546_-	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	97.0	1.3e-49
WP_022648878.1|3319545_3323097_-	DUF1983 domain-containing protein	NA	Q9MCU0	Escherichia_phage	71.4	0.0e+00
WP_022648879.1|3323149_3323734_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	52.6	1.9e-54
WP_022648880.1|3323733_3324444_-	C40 family peptidase	NA	F1C573	Cronobacter_phage	69.8	1.5e-96
WP_022648881.1|3324446_3325205_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	2.3e-95
WP_022648882.1|3325201_3325540_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	59.8	7.3e-38
WP_032627366.1|3325542_3329034_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	84.8	0.0e+00
3325930:3325944	attL	CGCGCCAGCATTCTG	NA	NA	NA	NA
WP_022648884.1|3329080_3329416_-	hypothetical protein	NA	S4TR42	Salmonella_phage	92.8	3.4e-51
WP_032619858.1|3329471_3329750_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	95.7	1.8e-42
WP_001549114.1|3329758_3330142_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	93.7	4.4e-63
WP_006809155.1|3330150_3330594_-	hypothetical protein	NA	K7PHL2	Enterobacterial_phage	93.8	4.6e-72
WP_022648886.1|3330653_3331001_-	DUF3168 domain-containing protein	NA	Q9MCS8	Enterobacteria_phage	99.1	3.8e-58
WP_022648887.1|3330997_3331447_-	HK97 gp10 family phage protein	NA	K7P6X4	Enterobacteria_phage	98.7	2.9e-74
WP_022648888.1|3331443_3331782_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	73.2	6.0e-40
WP_022648889.1|3331790_3332117_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	81.5	1.3e-47
WP_042889606.1|3332159_3333371_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	85.2	2.4e-192
WP_022648891.1|3333380_3334229_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	92.9	3.7e-139
WP_022648892.1|3334242_3335547_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	94.0	4.3e-235
WP_042889604.1|3335546_3337283_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	99.5	0.0e+00
WP_022648894.1|3337282_3337780_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	85.5	1.6e-73
WP_042889602.1|3337937_3338288_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.9	9.2e-52
WP_042889601.1|3338287_3338866_-	hypothetical protein	NA	S4TR53	Salmonella_phage	71.7	8.0e-77
WP_157843586.1|3338859_3339441_-	HNH endonuclease	NA	A0A1W6DXY0	Salmonella_phage	37.0	1.5e-14
WP_042889600.1|3339499_3340957_-	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	94.4	1.6e-278
WP_032671404.1|3341147_3341438_+	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	62.9	6.3e-30
WP_042889599.1|3341547_3341829_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	95.7	3.0e-45
WP_032622297.1|3342034_3342304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648900.1|3342311_3342941_-	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.1	1.5e-100
WP_022648766.1|3342940_3343222_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	93.5	4.1e-42
WP_022648767.1|3343208_3343604_-	phage membrane protein	NA	K7PHB9	Enterobacterial_phage	99.2	9.1e-64
WP_022648901.1|3343759_3344338_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.8	2.8e-45
WP_032622304.1|3344350_3345340_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	89.7	1.9e-179
WP_022648903.1|3345336_3346062_-	hypothetical protein	NA	G0ZND1	Cronobacter_phage	52.7	6.4e-55
WP_022648904.1|3346077_3346467_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKN5	Enterobacterial_phage	95.2	1.2e-65
WP_022648905.1|3346463_3346784_-	hypothetical protein	NA	K7PHB4	Enterobacterial_phage	79.2	7.6e-45
WP_022648906.1|3346780_3347008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648907.1|3347004_3347664_-	adenine-specific DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	81.3	2.9e-99
WP_022648908.1|3347663_3348158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022648909.1|3348154_3349081_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	56.7	5.8e-69
WP_071785216.1|3349037_3349250_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	69.2	4.6e-14
WP_022648911.1|3349490_3349961_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	92.9	1.4e-74
WP_016530206.1|3349986_3350184_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_032623415.1|3350288_3350936_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	6.4e-75
WP_022648914.1|3351397_3351856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042898715.1|3352382_3352703_+	hypothetical protein	NA	K7P7N6	Enterobacteria_phage	55.7	2.7e-26
WP_042898738.1|3352751_3353165_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	92.7	5.2e-62
WP_022648917.1|3353164_3354187_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	89.8	2.3e-167
WP_022648918.1|3354173_3354695_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	83.1	4.4e-50
WP_022648919.1|3354696_3354939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080396514.1|3355458_3355896_+	DUF550 domain-containing protein	NA	K7PGV7	Enterobacterial_phage	78.0	1.2e-48
WP_063132000.1|3355953_3356163_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	59.6	4.5e-14
WP_022648923.1|3356146_3357316_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	84.6	4.0e-200
WP_161177175.1|3357780_3358752_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.3	2.0e-75
WP_099458937.1|3359111_3359183_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_022648925.1|3359240_3360476_-	alanine transaminase	NA	NA	NA	NA	NA
WP_022648926.1|3360862_3362560_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_022648927.1|3362573_3363305_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.1	8.5e-15
WP_022648928.1|3363340_3364306_-	glucokinase	NA	NA	NA	NA	NA
WP_022648929.1|3364511_3365747_+	ion channel protein	NA	NA	NA	NA	NA
WP_022648930.1|3365747_3367406_-	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
3365897:3365911	attR	CGCGCCAGCATTCTG	NA	NA	NA	NA
WP_022648931.1|3367592_3368591_+	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_022648932.1|3368717_3369065_+	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_022648933.1|3369098_3370337_-	Mn(2+) uptake NRAMP transporter MntH	NA	NA	NA	NA	NA
WP_022648934.1|3370682_3371870_+	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_022648935.1|3371915_3374105_-	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_022648936.1|3374725_3375088_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_022648937.1|3375110_3375476_+	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_022648938.1|3375527_3376943_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP034754	Enterobacter hormaechei subsp. hoffmannii strain Eh1 chromosome, complete genome	4845040	4020068	4028188	4845040		uncultured_Caudovirales_phage(62.5%)	11	NA	NA
WP_004118246.1|4020068_4021025_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_022649396.1|4021025_4021793_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|4021891_4022185_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|4022515_4022794_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_007898882.1|4022907_4023333_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	1.9e-51
WP_007898880.1|4023345_4024635_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.1	4.4e-168
WP_022649397.1|4024679_4025000_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	8.5e-20
WP_007898876.1|4025085_4025784_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.4	7.7e-90
WP_004206574.1|4025912_4026218_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206572.1|4026228_4027434_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_016151342.1|4027609_4028188_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	35.5	5.7e-22
>prophage 9
NZ_CP034754	Enterobacter hormaechei subsp. hoffmannii strain Eh1 chromosome, complete genome	4845040	4253260	4353712	4845040	integrase,protease,capsid,portal,head,tRNA,tail,terminase	uncultured_Caudovirales_phage(64.29%)	87	4317027:4317047	4333241:4333261
WP_022649536.1|4253260_4256116_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	9.3e-142
WP_022649537.1|4256239_4256743_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_022649538.1|4256826_4257846_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	31.0	7.1e-44
WP_022649539.1|4257889_4259530_-	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_022649540.1|4259667_4261170_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.4	1.5e-82
WP_096147825.1|4261149_4262091_-	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_022649542.1|4262778_4267239_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_022649543.1|4267248_4268667_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_022649544.1|4268854_4270105_+	cytosine permease	NA	NA	NA	NA	NA
WP_022649545.1|4270094_4271375_+	cytosine deaminase	NA	NA	NA	NA	NA
WP_032622087.1|4271525_4272197_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_022649547.1|4272226_4272757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649548.1|4272753_4275141_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_022649549.1|4275165_4275837_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_022649550.1|4275984_4276731_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_022649551.1|4276780_4277521_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_032622090.1|4277790_4278288_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.6	6.6e-27
WP_003860438.1|4278293_4278932_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_003860436.1|4279239_4279632_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_003860434.1|4279647_4280076_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_022649553.1|4280975_4282100_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_022649554.1|4282289_4282688_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_022649555.1|4282858_4284226_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.4	5.1e-21
WP_003860430.1|4284318_4285386_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_022649556.1|4285437_4286376_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_003860428.1|4286773_4287244_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_006812160.1|4287622_4287886_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_022649557.1|4287945_4288218_-	ribonuclease inhibitor	NA	NA	NA	NA	NA
WP_022649559.1|4289804_4291772_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_022649560.1|4291777_4292710_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_003860416.1|4292717_4292921_-	AaeX family protein	NA	NA	NA	NA	NA
WP_022649561.1|4293099_4294026_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_022649562.1|4294139_4295585_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_022649563.1|4295668_4299475_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_003860405.1|4299517_4300987_-	ribonuclease G	NA	NA	NA	NA	NA
WP_003860403.1|4300976_4301570_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_003860402.1|4301579_4302068_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003860400.1|4302067_4303084_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|4303146_4304190_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_022649564.1|4304472_4306413_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_022649565.1|4306596_4307571_+	oxidoreductase	NA	NA	NA	NA	NA
WP_022649566.1|4307648_4308650_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_022649567.1|4308650_4309250_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_022649568.1|4309484_4309937_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_010436174.1|4309958_4310420_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003860388.1|4310430_4311780_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_022649569.1|4311888_4312131_+	YhdT family protein	NA	NA	NA	NA	NA
WP_022649570.1|4312120_4313572_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_022649571.1|4313583_4314465_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_022649572.1|4314602_4315343_+	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_006812176.1|4315672_4316638_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4316661_4316958_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
4317027:4317047	attL	TGACTGCACCACTGACTGCAC	NA	NA	NA	NA
WP_032629534.1|4317087_4320552_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	100.0	0.0e+00
WP_023332898.1|4320565_4322227_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	100.0	0.0e+00
WP_023332897.1|4322210_4322567_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	100.0	2.5e-60
WP_023332895.1|4322697_4322850_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	100.0	2.4e-20
WP_023332894.1|4322842_4323286_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	100.0	1.2e-85
WP_023332893.1|4323285_4323579_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	100.0	5.5e-50
WP_023332892.1|4323575_4323914_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	100.0	2.9e-58
WP_023332891.1|4323910_4325146_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	100.0	7.6e-242
WP_023332890.1|4325147_4325708_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	100.0	7.0e-102
WP_159115382.1|4325759_4326920_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	99.0	9.1e-213
WP_045327391.1|4327150_4327450_-	hypothetical protein	NA	A0A2H4JB54	uncultured_Caudovirales_phage	99.0	1.8e-48
WP_045327393.1|4327462_4327717_-	hypothetical protein	NA	A0A2H4JEE4	uncultured_Caudovirales_phage	97.6	9.4e-38
WP_159115383.1|4327927_4329304_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	93.4	1.5e-251
WP_023332885.1|4329300_4329669_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	100.0	4.6e-62
WP_001547834.1|4329665_4329893_-	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	100.0	1.6e-33
WP_159115384.1|4329885_4330071_-	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	88.5	4.4e-21
WP_158002311.1|4330063_4330276_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_045327403.1|4330957_4331167_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	91.3	1.0e-29
WP_045327405.1|4331256_4331994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045327407.1|4331993_4333214_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	96.3	8.3e-233
WP_003860373.1|4333584_4333749_+	DUF2556 family protein	NA	NA	NA	NA	NA
4333241:4333261	attR	TGACTGCACCACTGACTGCAC	NA	NA	NA	NA
WP_022649573.1|4333888_4335973_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.8	1.6e-21
WP_022649574.1|4335967_4336615_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_022649575.1|4337011_4338151_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_022649576.1|4338162_4341276_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003860364.1|4341523_4341745_+	lipoprotein	NA	NA	NA	NA	NA
WP_022649577.1|4347790_4348345_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_022649578.1|4348320_4348569_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_022649579.1|4348565_4349384_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_022649580.1|4349388_4349961_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	26.2	2.9e-10
WP_022649581.1|4349953_4350508_-	DNA topoisomerase type IA Zn finger domain-containing protein	NA	NA	NA	NA	NA
WP_000460665.1|4350534_4351008_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032621943.1|4350979_4352104_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_006812188.1|4352231_4352741_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	3.3e-18
WP_022649583.1|4352764_4353712_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.5	1.4e-06
>prophage 1
NZ_CP034755	Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p1, complete sequence	160216	0	63422	160216	integrase,transposase	Salmonella_phage(58.33%)	60	25134:25193	51885:52007
WP_016051671.1|0_1065_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	100.0	1.5e-190
WP_006812558.1|1674_1887_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	98.6	3.1e-34
WP_022649907.1|1886_2222_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	95.5	4.2e-54
WP_022649906.1|2218_2398_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	96.6	9.5e-21
WP_022649905.1|2438_2714_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.4e-47
WP_004110040.1|2782_3193_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	1.1e-75
WP_022649904.1|3176_3548_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
WP_022649903.1|3698_6041_-	intein-containing recombinase RecA	NA	J9Q736	Salmonella_phage	87.8	6.0e-30
WP_000920226.1|6043_6310_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_022649902.1|6309_7254_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	99.7	4.0e-182
WP_004110098.1|7314_8343_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.7	1.3e-165
WP_022649901.1|8462_8894_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	99.3	4.4e-72
WP_071785233.1|9151_9376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022649900.1|9457_10015_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	70.9	8.9e-65
WP_022649899.1|10080_10725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161496785.1|10763_11189_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	99.3	3.7e-71
WP_022649897.1|11203_12373_-	hypothetical protein	NA	J9Q7Z2	Salmonella_phage	95.1	1.3e-211
WP_022649896.1|12394_13090_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	36.5	1.9e-19
WP_022649895.1|13092_15456_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	93.4	0.0e+00
WP_022649894.1|15636_16872_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	99.8	6.0e-239
WP_022649893.1|16968_19341_-	hypothetical protein	NA	J9Q7G6	Salmonella_phage	93.7	0.0e+00
WP_004110118.1|19450_19663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649892.1|19926_20313_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_022649891.1|20304_21411_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	2.8e-25
WP_006812568.1|21582_21999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812569.1|21989_22514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812570.1|22610_22856_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_006812571.1|22855_23221_-	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	5.1e-37
WP_022649890.1|23236_23440_-	hypothetical protein	NA	A0A2P1CDD4	Klebsiella_phage	50.7	5.6e-09
WP_022649889.1|23450_24224_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	63.6	4.7e-88
25134:25193	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
WP_000376623.1|26611_27112_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_134906484.1|28070_28418_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_015243636.1|28590_28923_-	quaternary ammonium compound efflux SMR transporter QacF	NA	NA	NA	NA	NA
WP_010792467.1|29133_29598_-	aminoglycoside N-acetyltransferase AAC(3)-Ib	NA	NA	NA	NA	NA
WP_000845048.1|29746_30760_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001323888.1|31848_32016_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|32004_32565_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|32568_35535_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_043002023.1|35604_36033_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	38.6	1.3e-20
WP_000509966.1|36039_36645_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_039272567.1|39303_42336_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_039272634.1|42332_42926_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	1.2e-40
WP_063840321.1|44278_44833_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|44963_45794_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|45931_46564_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|46648_47101_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_004883563.1|48634_48907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|50320_51526_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|51536_51842_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|52068_52833_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
51885:52007	attR	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAGCTCCTGACAGTTCAATATCAGAAGTGATCTGCACCAATCTCGACTATGCTCAATACTCGTGTG	NA	NA	NA	NA
WP_001137892.1|53325_53910_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|53909_55148_-	MFS transporter	NA	NA	NA	NA	NA
WP_159115394.1|55144_56053_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|56174_56879_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|57029_57845_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_000046891.1|59035_59371_-	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
WP_001515734.1|59613_60177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001348195.1|60241_60616_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001097412.1|60639_61203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|62222_63422_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP034755	Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p1, complete sequence	160216	70282	159472	160216	tail,terminase,transposase	Salmonella_phage(96.74%)	98	NA	NA
WP_004152397.1|70282_71602_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_015062847.1|71851_72733_-	carbapenem-hydrolyzing class A beta-lactamase KPC-4	NA	A0A1B0VBP7	Salmonella_phage	52.5	1.1e-74
WP_004152394.1|73119_73899_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_001141270.1|74757_75033_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000842086.1|75063_76173_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.1	3.7e-30
WP_000235177.1|76214_76613_+	VOC family protein	NA	NA	NA	NA	NA
WP_009652884.1|76678_77515_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000470624.1|77542_78178_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000124025.1|78345_81333_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.6	2.4e-294
WP_004110169.1|82068_82374_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	99.0	1.4e-48
WP_000613550.1|82370_82523_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	98.0	8.9e-20
WP_022649968.1|82522_82735_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	5.8e-33
WP_022649967.1|82894_84217_-	hypothetical protein	NA	J9Q7G5	Salmonella_phage	99.1	2.4e-257
WP_032623539.1|84251_84509_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	97.6	4.0e-36
WP_022649965.1|84809_85604_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	97.0	9.8e-142
WP_022649964.1|85684_86800_-	hypothetical protein	NA	J9Q720	Salmonella_phage	97.6	1.4e-215
WP_006812582.1|86958_88299_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.8	1.3e-247
WP_022649963.1|88359_89085_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	99.6	2.6e-141
WP_022649962.1|89281_90040_-	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	98.4	8.7e-148
WP_161496783.1|90085_90439_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.9e-45
WP_022649960.1|90444_91110_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	99.5	1.4e-117
WP_032623541.1|91264_91966_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	99.6	5.4e-136
WP_016051638.1|91998_92421_-	hypothetical protein	NA	J9Q6E9	Salmonella_phage	100.0	5.7e-72
WP_016051635.1|92769_93021_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	100.0	6.6e-36
WP_022649957.1|93022_93715_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	99.6	2.9e-129
WP_016051633.1|93727_94051_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	100.0	1.9e-51
WP_016051632.1|94143_94377_-	lipoprotein	NA	J9Q714	Salmonella_phage	100.0	1.0e-38
WP_022649956.1|94388_94997_-	hypothetical protein	NA	J9Q7G0	Salmonella_phage	100.0	1.4e-103
WP_022649955.1|94996_95251_-	hypothetical protein	NA	J9Q7R5	Salmonella_phage	95.2	2.4e-41
WP_022649954.1|95294_95831_-	hypothetical protein	NA	J9Q7Y6	Salmonella_phage	98.9	1.0e-94
WP_022649953.1|95830_99385_-	hypothetical protein	NA	J9Q6E3	Salmonella_phage	64.4	2.0e-250
WP_022649952.1|99472_103630_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	99.6	0.0e+00
WP_016051626.1|103647_104238_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	100.0	2.1e-109
WP_022649951.1|104225_105023_-	hypothetical protein	NA	J9Q7R4	Salmonella_phage	99.2	1.2e-160
WP_016051624.1|105015_105714_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	100.0	3.7e-137
WP_016051623.1|105803_106139_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	100.0	1.4e-60
WP_022649950.1|106180_110752_-	tape measure protein	NA	J9Q712	Salmonella_phage	90.5	0.0e+00
WP_000952684.1|110759_110984_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|111109_111427_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_022649949.1|111486_112233_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.0	2.0e-128
WP_000469441.1|112307_112691_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
WP_022649948.1|112692_113166_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	6.8e-82
WP_001027662.1|113156_113501_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
WP_022649947.1|113598_114432_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	98.6	9.3e-151
WP_000801184.1|114431_114866_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
WP_001130336.1|115169_116045_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
WP_022649945.1|116071_116965_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	92.3	1.2e-135
WP_022649944.1|116987_118562_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	7.1e-301
WP_002211787.1|118595_119852_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
WP_022649943.1|119854_120496_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	99.1	5.2e-109
WP_000176291.1|120691_120958_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
WP_002211789.1|120967_121858_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	6.2e-169
WP_022649942.1|121863_122118_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	9.0e-41
WP_006812519.1|122110_122749_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.5	1.1e-111
WP_000164561.1|122745_123414_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
WP_032623529.1|123413_124112_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	98.7	3.6e-124
WP_022649940.1|124176_125736_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.4	1.3e-294
WP_001291547.1|125738_126017_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
WP_032623531.1|126076_126499_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	2.4e-62
WP_006812523.1|126503_127031_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	99.3	2.6e-82
WP_022649938.1|127354_128005_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.1	1.2e-113
WP_016051712.1|128055_128259_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	100.0	1.3e-29
WP_022649937.1|128903_129386_-	hypothetical protein	NA	J9Q805	Salmonella_phage	95.0	5.1e-85
WP_161496780.1|129591_129789_-	hypothetical protein	NA	J9Q753	Salmonella_phage	96.9	5.0e-31
WP_022649934.1|130000_130396_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	99.2	3.3e-66
WP_022649933.1|130523_130835_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	97.1	1.6e-47
WP_161496784.1|130975_131191_-	hypothetical protein	NA	J9Q804	Salmonella_phage	94.4	2.6e-33
WP_022649931.1|131422_131665_+	hypothetical protein	NA	J9Q751	Salmonella_phage	93.8	3.4e-37
WP_022649930.1|133091_133610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022649929.1|133693_134530_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_022649928.1|134611_134929_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	5.2e-46
WP_022649927.1|135013_135280_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	69.3	3.7e-29
WP_022649926.1|135467_135671_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	5.2e-31
WP_022649925.1|135726_136425_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	99.1	4.8e-124
WP_022649923.1|137384_139070_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	99.1	0.0e+00
WP_022649922.1|139211_139784_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	97.9	5.3e-97
WP_000462606.1|139892_140735_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
WP_000872126.1|140843_141032_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
WP_022649921.1|141041_141536_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	97.0	8.7e-80
WP_022649920.1|141678_142287_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	99.0	4.9e-117
WP_000262979.1|142880_143111_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_022649919.1|143313_143907_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.0	1.0e-111
WP_022649918.1|144092_144935_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.0	2.9e-107
WP_022649917.1|145063_145621_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	98.9	2.0e-101
WP_004109992.1|145630_146050_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_000386471.1|146113_146758_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
WP_161496782.1|146757_147228_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	99.4	1.3e-88
WP_160859100.1|147230_147626_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	96.9	3.9e-67
WP_022649915.1|147645_148749_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.2	1.1e-218
WP_022649914.1|148938_149808_-	hypothetical protein	NA	J9Q742	Salmonella_phage	98.3	3.9e-160
WP_002231164.1|149890_151033_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_022649913.1|151140_153456_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
WP_022649912.1|153533_154103_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	98.9	8.4e-103
WP_004110014.1|154114_154861_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.8	2.6e-136
WP_022649911.1|154850_156767_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	98.9	0.0e+00
WP_022649910.1|156996_158082_-	hypothetical protein	NA	J9Q7S9	Salmonella_phage	98.6	1.0e-205
WP_022649909.1|158257_158752_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.2	7.8e-89
WP_022649908.1|158827_159472_-	hypothetical protein	NA	J9Q739	Salmonella_phage	99.1	2.2e-123
>prophage 1
NZ_CP034756	Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence	108486	0	7088	108486	integrase,transposase	Leptospira_phage(50.0%)	3	2621:2634	15860:15873
2621:2634	attL	ATTCTGCCATGGCA	NA	NA	NA	NA
WP_089046468.1|2718_3838_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.0e-51
WP_016479957.1|4775_6098_+	GntP family transporter	NA	NA	NA	NA	NA
WP_008322208.1|6296_7088_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.4	1.4e-50
15860:15873	attR	ATTCTGCCATGGCA	NA	NA	NA	NA
>prophage 2
NZ_CP034756	Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence	108486	13893	14376	108486		Moraxella_phage(100.0%)	1	NA	NA
WP_015060706.1|13893_14376_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	38.0	3.6e-22
>prophage 3
NZ_CP034756	Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence	108486	17435	18416	108486	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019445.1|17435_18416_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 4
NZ_CP034756	Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence	108486	25581	26127	108486		Wolbachia_phage(100.0%)	1	NA	NA
WP_008324931.1|25581_26127_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.1	1.0e-20
>prophage 5
NZ_CP034756	Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p2, complete sequence	108486	60161	106684	108486	integrase,transposase	Enterobacteria_phage(10.0%)	52	93048:93107	104388:104643
WP_008324171.1|60161_60992_-	N-6 DNA methylase	NA	H7BVT3	unidentified_phage	37.9	3.4e-12
WP_008324174.1|61034_61298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324177.1|61383_61728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324178.1|61774_62062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324180.1|62115_62490_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	62.7	2.2e-27
WP_015493069.1|63116_63476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324183.1|63537_63861_-	hypothetical protein	NA	I3UM57	Rhodobacter_phage	38.1	6.0e-13
WP_008324185.1|63857_64586_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_045350915.1|64582_65014_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_016479992.1|65056_67066_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.2	1.6e-26
WP_015493071.1|67136_67367_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_032072909.1|67651_67954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015493072.1|68344_68599_-	hypothetical protein	NA	H9C187	Pectobacterium_phage	46.2	5.2e-12
WP_015493073.1|68791_68983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015493074.1|69025_69532_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_015493075.1|69936_70716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016479994.1|70769_71189_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015493077.1|71199_71421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002211749.1|71420_72098_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
WP_015493079.1|72456_73128_+	Gifsy-2 prophage protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	5.1e-83
WP_000343760.1|73351_74572_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_015493080.1|74631_75054_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_015493081.1|75053_76325_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	6.1e-154
WP_016479949.1|76460_77432_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.9	1.4e-113
WP_015493083.1|77428_78634_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.2	1.1e-205
WP_016479950.1|78996_79629_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.7	1.6e-06
WP_000654811.1|79689_80658_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_004201164.1|80854_81667_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|81670_82036_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|82040_82679_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|82689_83721_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|83725_84055_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|84248_84539_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|84594_86235_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_015056392.1|86423_87953_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_015056391.1|88163_88448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004993315.1|89271_89919_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	31.4	2.6e-15
WP_015056389.1|90070_90295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103254391.1|90361_91581_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.9	1.7e-76
93048:93107	attL	GGGGTCAGTTTGGAGAACGGAAATTTTTGTACGTTAAGCGCATTATTTAACCAATCTTGG	NA	NA	NA	NA
WP_032072920.1|93253_93913_-	endonuclease III	NA	NA	NA	NA	NA
WP_016479969.1|95178_95349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001183923.1|95462_95762_+	DUF2293 domain-containing protein	NA	NA	NA	NA	NA
WP_000376617.1|95845_96088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|96215_97055_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|97048_97396_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_159115397.1|97500_98454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015460531.1|98455_99388_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016479967.1|99384_100071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072922.1|100104_100866_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_003149906.1|101608_103138_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000855769.1|103434_104280_+	RmtC family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_087728544.1|105667_106684_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
104388:104643	attR	GGGGTCAGTTTGGAGAACGGAAATTTTTGTACGTTAAGCGCATTATTTAACCAATCTTGGTTCGTAAGTGGTTGATTTTGCGTCAGTGGCTATCGCTTTTAAGTTGTCGCTCTTGCAGTATCGCATTTAGGTTATCCGATTAAGGTCAAACCTCTGAAAATGCCGTATAGCGCGGGAGGACACCCTATTGCTATAGGTAAGTCTGTTCAAAAAACAGGCTTACCGTACAATAATTCTCTATATCCAAACTGACCCC	NA	NA	NA	NA
>prophage 1
NZ_CP034757	Enterobacter hormaechei subsp. hoffmannii strain Eh1 plasmid p3, complete sequence	28640	11292	19358	28640	transposase	Stx2-converting_phage(42.86%)	8	NA	NA
WP_148240171.1|11292_11679_+|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	89.9	1.7e-59
WP_032667561.1|11675_12023_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	1.8e-60
WP_032667560.1|12073_13612_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.8	2.8e-270
WP_005012528.1|13722_14937_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072159712.1|14970_16374_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.5	4.0e-106
WP_108082295.1|16552_17249_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.5e-125
WP_159115398.1|17636_18191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072159722.1|18389_19358_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	3.1e-182
