The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP044412	Lactobacillus sp. JM1 chromosome, complete genome	1996913	548513	591367	1996913	bacteriocin,transposase	Bacillus_phage(50.0%)	39	NA	NA
WP_159310973.1|548513_549398_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_020806850.1|549582_551232_-	APC family permease	NA	NA	NA	NA	NA
WP_020806849.1|551422_552634_-	MFS transporter	NA	NA	NA	NA	NA
WP_020806848.1|552635_552845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003649248.1|552837_553269_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020806847.1|553354_553942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159310974.1|554247_555333_+	M42 family peptidase	NA	NA	NA	NA	NA
WP_003649245.1|555332_555533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806845.1|555590_556877_-	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_020806844.1|556902_558336_-	amino acid permease	NA	NA	NA	NA	NA
WP_020806843.1|558370_559657_-	phosphatidylserine decarboxylase family protein	NA	NA	NA	NA	NA
WP_020806842.1|560011_562048_+	beta-galactosidase	NA	NA	NA	NA	NA
WP_003649236.1|563840_565073_+	MFS transporter	NA	NA	NA	NA	NA
WP_020806840.1|565170_566022_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003649234.1|566110_566551_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020806839.1|566551_568285_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	2.0e-38
WP_020806838.1|568277_570047_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.7	5.4e-47
WP_020806837.1|570098_570920_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003647627.1|571370_572120_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.3	9.9e-35
WP_020806836.1|572121_572946_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003647625.1|572942_573581_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_020806835.1|573594_574245_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_020806834.1|574291_575128_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_020806833.1|575233_576892_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_020806832.1|576905_577631_-	trehalose operon repressor	NA	NA	NA	NA	NA
WP_159310975.1|577825_579754_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_024273054.1|580663_581713_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_035425644.1|581931_582570_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.0	1.1e-37
WP_020806830.1|582728_584096_+	MFS transporter	NA	NA	NA	NA	NA
WP_003649220.1|584238_584391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169554.1|584393_585701_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003649217.1|585697_586495_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003649216.1|586507_588667_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.2	6.5e-47
WP_003649215.1|588677_589271_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_049159833.1|589572_589800_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003649213.1|589809_590007_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003649212.1|590022_590361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156235821.1|590569_590716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003649210.1|591082_591367_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 2
NZ_CP044412	Lactobacillus sp. JM1 chromosome, complete genome	1996913	628709	726408	1996913	portal,protease,terminase,integrase,plate,capsid,tRNA,transposase,head,tail	Lactobacillus_phage(69.09%)	119	648977:649000	691466:691489
WP_020806798.1|628709_629543_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_051904648.1|629667_630630_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	9.1e-25
WP_020806796.1|630622_632170_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_020806795.1|632183_632594_+	OsmC family protein	NA	NA	NA	NA	NA
WP_020806794.1|632722_633787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806793.1|633854_634466_+	(p)ppGpp synthetase	NA	NA	NA	NA	NA
WP_020806792.1|634470_635136_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	32.0	3.8e-22
WP_020806791.1|635145_636420_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_020806790.1|636549_638934_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_080972639.1|639056_639470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065169716.1|640159_642694_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	25.8	2.5e-66
WP_020806787.1|642781_643552_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003649162.1|643597_644293_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_020807583.1|644634_646446_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.2	2.3e-93
WP_020807582.1|646581_647001_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020807581.1|646993_647581_+	cell division protein	NA	NA	NA	NA	NA
WP_159310978.1|647627_648758_-	acyltransferase family protein	NA	NA	NA	NA	NA
648977:649000	attL	TTAAAAAGGGACAGAAAAGGGACA	NA	NA	NA	NA
WP_020807579.1|649003_650161_-|integrase	site-specific integrase	integrase	Q37880	Lactobacillus_phage	98.2	4.7e-217
WP_003653473.1|650745_651726_-	Abi family protein	NA	M1PS09	Streptococcus_phage	43.4	5.4e-65
WP_020807578.1|652263_652452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003653471.1|653270_653501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003653470.1|653482_654178_-	DUF4145 domain-containing protein	NA	A0A1X9I5M7	Streptococcus_phage	29.2	3.6e-15
WP_020807577.1|654195_654876_-	helix-turn-helix domain-containing protein	NA	U3PIS7	Lactobacillus_phage	45.5	3.9e-46
WP_113533036.1|655061_655307_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020807575.1|655306_656104_+	ORF6N domain-containing protein	NA	Q9T1J2	Lactobacillus_phage	77.4	1.8e-55
WP_155271673.1|656230_656395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157957776.1|656416_656572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807574.1|656631_657357_+	phage antirepressor protein	NA	A0A1S5SEX2	Streptococcus_phage	47.9	4.0e-49
WP_020807573.1|657383_657605_+	hypothetical protein	NA	Q9T1J1	Lactobacillus_phage	93.1	2.5e-31
WP_020807572.1|657605_657788_+	hypothetical protein	NA	Q9T1J0	Lactobacillus_phage	98.3	2.9e-25
WP_020807571.1|657784_658033_-	hypothetical protein	NA	Q9T1I9	Lactobacillus_phage	97.6	1.3e-39
WP_020807570.1|658127_658337_+	helix-turn-helix transcriptional regulator	NA	D2IZX1	Enterococcus_phage	47.8	9.8e-09
WP_020807569.1|658393_658675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807568.1|658801_659248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807567.1|659308_659536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807566.1|659571_659892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024273044.1|660057_660273_+	hypothetical protein	NA	Q9T1I6	Lactobacillus_phage	87.3	6.5e-32
WP_020807564.1|660464_660662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807563.1|660667_661405_+	hypothetical protein	NA	Q6SE92	Lactobacillus_prophage	61.5	1.4e-62
WP_020807562.1|661404_661752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807561.1|661777_662110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126327871.1|662263_662737_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020807558.1|662733_663000_+	hypothetical protein	NA	Q9T1H3	Lactobacillus_phage	35.3	6.4e-05
WP_020807557.1|662996_663197_+	hypothetical protein	NA	Q9T1H2	Lactobacillus_phage	81.5	1.6e-24
WP_020807556.1|663204_663399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024273045.1|663395_663575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807555.1|663574_663856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807554.1|663869_664136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807553.1|664122_664395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807552.1|664387_664636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807551.1|664622_664916_+	hypothetical protein	NA	Q9T1G6	Lactobacillus_phage	43.2	1.7e-11
WP_020807550.1|664896_665154_+	hypothetical protein	NA	Q9T1G5	Lactobacillus_phage	80.0	9.2e-33
WP_020807549.1|665146_665509_+	VRR-NUC domain-containing protein	NA	L0P7E5	Lactobacillus_phage	65.0	4.4e-41
WP_015979941.1|665505_665997_+	hypothetical protein	NA	Q9T1G3	Lactobacillus_phage	100.0	1.8e-93
WP_020807548.1|666087_666564_+	hypothetical protein	NA	Q9T1G2	Lactobacillus_phage	83.4	2.3e-69
WP_020807547.1|666850_667363_+	HNH endonuclease	NA	Q9T1G1	Lactobacillus_phage	81.8	1.2e-84
WP_020807546.1|667530_667980_+|terminase	phage terminase small subunit P27 family	terminase	Q9T1G0	Lactobacillus_phage	96.0	1.3e-77
WP_020807545.1|667976_669851_+|terminase	terminase large subunit	terminase	Q9T1F9	Lactobacillus_phage	91.6	0.0e+00
WP_113533035.1|669831_670038_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_020807544.1|670037_671234_+|portal	phage portal protein	portal	Q9T1F8	Lactobacillus_phage	92.8	1.3e-198
WP_020807543.1|671193_671907_+|protease	Clp protease ClpP	protease	Q9T1F7	Lactobacillus_phage	87.9	5.9e-114
WP_020807542.1|671912_673118_+|capsid	phage major capsid protein	capsid	Q9T1F6	Lactobacillus_phage	87.6	1.9e-197
WP_020807541.1|673130_673511_+	DNA packaging protein	NA	Q9T1F5	Lactobacillus_phage	81.7	1.2e-49
WP_035425575.1|673467_673824_+|head	phage head closure protein	head	Q9T1F4	Lactobacillus_phage	94.9	3.6e-59
WP_020807539.1|673816_674296_+	hypothetical protein	NA	Q9T1F3	Lactobacillus_phage	84.9	9.3e-71
WP_020807538.1|674279_674651_+	DUF806 family protein	NA	Q9T1F2	Lactobacillus_phage	92.7	4.0e-61
WP_020807537.1|674650_675298_+|tail	phage major tail protein	tail	Q9T1F1	Lactobacillus_phage	84.9	1.2e-100
WP_020807536.1|675377_675929_+	hypothetical protein	NA	Q9T1F0	Lactobacillus_phage	85.8	8.2e-79
WP_035425578.1|675876_676140_+	hypothetical protein	NA	Q9T1E9	Lactobacillus_phage	93.1	1.0e-39
WP_159310979.1|676139_681590_+	tape measure protein	NA	Q9T1E7	Lactobacillus_phage	74.8	0.0e+00
WP_020807534.1|681576_682320_+	phage protein	NA	Q9T1E6	Lactobacillus_phage	85.0	2.1e-125
WP_113533033.1|682298_685115_+	endopeptidase	NA	Q9T1E4	Lactobacillus_phage	97.6	0.0e+00
WP_020807532.1|685130_685340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051904649.1|685269_688137_+|plate	BppU family phage baseplate upper protein	plate	Q9T1E3	Lactobacillus_phage	68.8	1.4e-307
WP_003656397.1|688191_688656_+	hypothetical protein	NA	Q9T1E2	Lactobacillus_phage	95.5	7.9e-75
WP_020807530.1|688668_688878_+	hypothetical protein	NA	Q9T1E1	Lactobacillus_phage	98.6	1.3e-32
WP_024273047.1|688843_689233_+	hypothetical protein	NA	Q9T1E0	Lactobacillus_phage	88.7	3.7e-41
WP_003656394.1|689236_689446_+	hypothetical protein	NA	Q9T1D9	Lactobacillus_phage	98.6	2.5e-20
WP_003656393.1|689442_689787_+	hypothetical protein	NA	Q38316	Lactobacillus_phage	93.0	1.7e-50
WP_003656391.1|689790_690738_+	lysin	NA	Q38317	Lactobacillus_phage	88.7	6.6e-161
WP_015979968.1|691283_691469_+	hypothetical protein	NA	O48431	Lactobacillus_phage	100.0	5.1e-25
WP_024273048.1|691741_692407_+	nitroreductase	NA	NA	NA	NA	NA
691466:691489	attR	TTAAAAAGGGACAGAAAAGGGACA	NA	NA	NA	NA
WP_020807525.1|692448_693009_-	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_065169717.1|693008_694481_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_003649102.1|694653_695091_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113533030.1|695176_696931_-	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003649099.1|697627_697993_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_020806966.1|698162_699479_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	33.3	5.0e-58
WP_020806965.1|699617_700523_+	ROK family protein	NA	NA	NA	NA	NA
WP_024273054.1|700635_701685_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_159311091.1|701783_702602_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051904650.1|703600_704806_+	MFS transporter	NA	NA	NA	NA	NA
WP_159310980.1|704908_706705_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_081275653.1|706725_707163_+	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	51.7	2.0e-32
WP_024273050.1|707204_707666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806958.1|707662_708493_+	pyridoxal/pyridoxine/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_003649089.1|708496_709054_+	membrane protein	NA	NA	NA	NA	NA
WP_003647546.1|709103_709283_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_004897059.1|709408_709522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806957.1|709648_710971_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_003649087.1|711048_711888_+	YitT family protein	NA	NA	NA	NA	NA
WP_020806956.1|711882_712239_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	38.2	3.9e-13
WP_003647543.1|712455_712767_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_003647542.1|712786_713086_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_020806955.1|713158_714268_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_003647540.1|714352_714922_+	elongation factor P	NA	NA	NA	NA	NA
WP_003647539.1|714939_715386_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_159310981.1|715386_715788_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_020806953.1|715835_716684_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	37.2	9.1e-37
WP_159310982.1|716673_718044_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	27.3	9.6e-36
WP_003647535.1|718024_718270_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_020806951.1|718270_719137_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_003649079.1|719140_719953_+	TlyA family RNA methyltransferase	NA	NA	NA	NA	NA
WP_020806950.1|719962_721642_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_020806949.1|721702_721996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003649076.1|722155_722770_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	30.5	2.5e-12
WP_003647530.1|722773_722992_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_020806948.1|723046_725443_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_065169474.1|725463_726408_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.5	9.0e-09
>prophage 3
NZ_CP044412	Lactobacillus sp. JM1 chromosome, complete genome	1996913	785400	890089	1996913	portal,protease,terminase,integrase,tRNA,capsid,holin,transposase,head,tail	Lactobacillus_phage(37.31%)	112	801618:801640	849336:849358
WP_020806908.1|785400_786294_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_020806907.1|786306_787245_+	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	38.8	1.2e-10
WP_159310990.1|787505_789011_+	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	24.3	6.4e-25
WP_020806905.1|789034_789661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806904.1|789801_790860_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_020806903.1|790871_791450_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_159310991.1|791467_793339_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.3	5.9e-137
WP_020806902.1|793418_794585_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	26.1	2.3e-14
WP_024273054.1|794742_795792_-|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.7	2.4e-47
WP_020806901.1|795925_797764_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	3.1e-21
WP_020806900.1|797927_798617_+	class A sortase	NA	NA	NA	NA	NA
WP_159310992.1|798711_800982_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.8	3.4e-78
WP_020806898.1|801116_801644_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
801618:801640	attL	TCTCTTGTTAAGTACCACGGTGC	NA	NA	NA	NA
WP_159310993.1|801730_802882_-|integrase	tyrosine-type recombinase/integrase	integrase	Q37880	Lactobacillus_phage	76.4	1.6e-172
WP_065169458.1|803043_803262_-	hypothetical protein	NA	E9LUL0	Lactobacillus_phage	55.6	7.3e-15
WP_159310994.1|804267_804801_-	hypothetical protein	NA	Q6SEG3	Lactobacillus_prophage	53.6	9.9e-13
WP_159310995.1|804895_805393_-	hypothetical protein	NA	B8R671	Lactobacillus_phage	64.2	7.0e-29
WP_065169455.1|805404_805800_-	hypothetical protein	NA	Q6SEA2	Lactobacillus_prophage	36.5	3.2e-16
WP_065169454.1|805799_806165_-	helix-turn-helix domain-containing protein	NA	A0A1B0Y3N1	Lactobacillus_phage	45.2	2.7e-14
WP_065169453.1|806429_806609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169452.1|806592_806949_-	DUF2513 domain-containing protein	NA	V5USM0	Oenococcus_phage	44.5	1.4e-18
WP_065169451.1|807027_807324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169450.1|807366_808314_+|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	41.2	1.2e-66
WP_065169449.1|808315_808948_+	methylase	NA	B7T0H3	Staphylococcus_virus	52.0	3.7e-51
WP_159310996.1|808938_809559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159310997.1|809580_810291_+	phage regulatory protein	NA	A0A0A7DN29	Lactobacillus_phage	63.1	1.3e-28
WP_155761823.1|810290_810440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169446.1|810457_810646_+	helix-turn-helix domain-containing protein	NA	Q9T1I7	Lactobacillus_phage	59.7	2.0e-16
WP_159310998.1|810657_810873_+	hypothetical protein	NA	Q9T1I6	Lactobacillus_phage	85.9	7.2e-31
WP_065169444.1|811309_811654_+	hypothetical protein	NA	Q9T1I3	Lactobacillus_phage	77.2	1.7e-45
WP_065169443.1|811647_811914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159310999.1|811900_812569_+	AAA family ATPase	NA	Q9T1I1	Lactobacillus_phage	87.4	5.4e-117
WP_065169441.1|812565_812892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169440.1|812901_813162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159311000.1|813161_814526_+	DEAD/DEAH box helicase family protein	NA	Q9T1H9	Lactobacillus_phage	63.8	2.1e-168
WP_065169438.1|814525_814726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169437.1|814891_815521_+	DUF669 domain-containing protein	NA	F8J1E9	Lactobacillus_phage	43.6	9.8e-20
WP_065169436.1|815531_815765_+	hypothetical protein	NA	Q9T1H7	Lactobacillus_phage	76.6	6.0e-23
WP_065169435.1|815778_818121_+	DNA primase	NA	Q9T1H6	Lactobacillus_phage	55.6	9.3e-249
WP_065169434.1|818438_818792_+	helix-turn-helix transcriptional regulator	NA	Q9T1H4	Lactobacillus_phage	41.4	4.7e-11
WP_065169433.1|818813_819398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169432.1|819423_819705_+	hypothetical protein	NA	Q9T1H1	Lactobacillus_phage	45.5	1.4e-13
WP_065169431.1|819704_820169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169430.1|820171_820465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169429.1|820464_820947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169427.1|821173_821419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169426.1|821415_821682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169425.1|821668_821941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169424.1|821933_822185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169423.1|822168_822396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144842183.1|822385_822556_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_081275650.1|822566_822857_+	hypothetical protein	NA	Q9T1G7	Lactobacillus_phage	86.3	6.1e-25
WP_065169422.1|822856_823183_+	hypothetical protein	NA	Q9T1G6	Lactobacillus_phage	63.8	3.6e-26
WP_065169462.1|823166_823520_+	VRR-NUC domain-containing protein	NA	A0A0A1ENT6	Lactobacillus_phage	71.6	7.4e-41
WP_065169421.1|823503_823995_+	hypothetical protein	NA	Q9T1G3	Lactobacillus_phage	94.5	5.9e-89
WP_159311001.1|824085_824529_+	hypothetical protein	NA	Q9T1G2	Lactobacillus_phage	87.1	6.6e-71
WP_065169419.1|824838_825693_+|terminase	terminase	terminase	Q6SE85	Lactobacillus_prophage	75.0	3.2e-106
WP_065169418.1|825679_826954_+|terminase	PBSX family phage terminase large subunit	terminase	Q6SE84	Lactobacillus_prophage	92.2	2.5e-240
WP_159311002.1|826969_828466_+|portal	phage portal protein	portal	Q6SE83	Lactobacillus_prophage	97.0	2.2e-275
WP_113779149.1|828395_828683_+|protease	ribosomal-processing cysteine protease Prp	protease	Q6SE82	Lactobacillus_prophage	89.5	1.1e-42
WP_159311003.1|828689_829772_+|head	phage head morphogenesis protein	head	Q6SE81	Lactobacillus_prophage	96.4	1.2e-195
WP_159311004.1|829925_830570_+	DUF4355 domain-containing protein	NA	Q6SE80	Lactobacillus_prophage	86.4	7.3e-95
WP_065169414.1|830582_830948_+	hypothetical protein	NA	Q6SE79	Lactobacillus_prophage	84.3	2.4e-50
WP_065169413.1|830974_832024_+|capsid	major capsid protein	capsid	Q6SE78	Lactobacillus_prophage	89.4	9.2e-180
WP_065169461.1|832050_832350_+	hypothetical protein	NA	Q6SE77	Lactobacillus_prophage	77.8	7.1e-37
WP_159311005.1|832346_832700_+	hypothetical protein	NA	Q6SE76	Lactobacillus_prophage	82.9	1.1e-52
WP_065169411.1|832692_833241_+	HK97 gp10 family phage protein	NA	Q6SE75	Lactobacillus_prophage	85.1	1.3e-84
WP_159311006.1|833241_833610_+	hypothetical protein	NA	Q6SE74	Lactobacillus_prophage	87.7	2.1e-54
WP_159311007.1|833613_834105_+|tail	phage tail protein	tail	Q6SE73	Lactobacillus_prophage	86.6	1.9e-71
WP_113779158.1|834177_834591_+	hypothetical protein	NA	Q6SE72	Lactobacillus_prophage	90.4	3.1e-62
WP_113779159.1|834683_834971_+	hypothetical protein	NA	Q6SE71	Lactobacillus_prophage	80.4	1.4e-37
WP_159311008.1|834970_841039_+	lytic transglycosylase	NA	Q6SE70	Lactobacillus_prophage	88.5	0.0e+00
WP_080558343.1|841056_841413_+	hypothetical protein	NA	Q6SE69	Lactobacillus_prophage	98.3	8.5e-61
WP_159311009.1|841426_846217_+	hypothetical protein	NA	Q6SE68	Lactobacillus_prophage	61.2	0.0e+00
WP_065169404.1|846351_846612_+	hypothetical protein	NA	Q6SE67	Lactobacillus_prophage	94.2	4.8e-37
WP_065169403.1|846611_847007_+	hypothetical protein	NA	B8R662	Lactobacillus_phage	31.6	4.3e-13
WP_065169402.1|847020_847239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065169401.1|847235_847580_+|holin	holin	holin	Q38316	Lactobacillus_phage	97.4	1.3e-53
WP_065169400.1|847582_848536_+	lysin	NA	Q65YV6	Lactobacillus_phage	76.4	3.0e-137
WP_065169399.1|849009_849231_+	hypothetical protein	NA	O48431	Lactobacillus_phage	85.2	4.1e-21
WP_020806897.1|849488_850997_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
849336:849358	attR	TCTCTTGTTAAGTACCACGGTGC	NA	NA	NA	NA
WP_020806896.1|851061_852549_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_020806895.1|852684_853641_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	58.6	2.8e-111
WP_020806894.1|853670_854180_+	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	41.0	9.7e-26
WP_159311010.1|854346_855690_+	MFS transporter	NA	NA	NA	NA	NA
WP_020806892.1|855776_858044_-	HAD-IC family P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.3	4.9e-45
WP_020806891.1|858167_859016_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020806890.1|859536_860121_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003647458.1|860298_861585_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	51.7	4.4e-107
WP_159311011.1|862033_863656_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.4	1.7e-47
WP_020806888.1|863755_864736_+	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	31.4	1.1e-25
WP_024272995.1|864919_865969_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.4	2.4e-47
WP_024273052.1|865987_866389_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020807341.1|866618_867470_-	DNA-entry nuclease	NA	NA	NA	NA	NA
WP_035425588.1|867469_868210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807339.1|868602_869457_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_020807338.1|869473_870523_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	8.7e-29
WP_003647450.1|870515_871217_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_020807337.1|871355_872762_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_159311012.1|872776_874150_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	32.4	2.1e-43
WP_020807335.1|874230_875157_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_020807334.1|875276_876653_+	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_020807333.1|876752_877769_+	asparaginase	NA	NA	NA	NA	NA
WP_159311013.1|877783_880210_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.4	9.9e-44
WP_020807331.1|880290_881982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807330.1|882033_882537_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_020807329.1|882598_883546_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_003648989.1|883576_883957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020807328.1|883974_886227_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1X9SH80	Bradyrhizobium_phage	41.4	1.6e-08
WP_020807327.1|886226_886664_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_020807326.1|886943_888230_+|tRNA	histidine--tRNA ligase	tRNA	A0A1V0SLE3	Klosneuvirus	27.3	7.4e-30
WP_113533168.1|888244_890089_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP044412	Lactobacillus sp. JM1 chromosome, complete genome	1996913	1444119	1518894	1996913	portal,terminase,integrase,tRNA,holin,transposase,head,tail	Lactobacillus_phage(44.44%)	85	1464276:1464291	1533312:1533327
WP_003648357.1|1444119_1446051_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	33.4	6.4e-94
WP_020806756.1|1446333_1447233_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	30.3	3.3e-29
WP_020806757.1|1447247_1448588_-	replication initiation/membrane attachment protein	NA	NA	NA	NA	NA
WP_003646909.1|1448595_1449060_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_020806758.1|1449065_1449662_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_020806759.1|1449658_1450489_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	29.9	9.3e-26
WP_065169709.1|1450504_1453165_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	27.7	2.5e-56
WP_020806763.1|1454170_1455484_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_020806764.1|1455869_1456514_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_020806765.1|1456517_1457831_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_020806766.1|1457853_1458378_-	glycine/betaine reductase B	NA	NA	NA	NA	NA
WP_020806767.1|1458392_1459346_-	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_020806768.1|1459362_1460679_-	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_020806769.1|1460701_1461430_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020806770.1|1461610_1462258_-|tRNA	DUF4479 and tRNA-binding domain-containing protein	tRNA	NA	NA	NA	NA
WP_003648332.1|1462282_1462603_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_024273083.1|1462815_1463286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806772.1|1463406_1464060_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_065169710.1|1464071_1465283_-	ABC transporter permease	NA	NA	NA	NA	NA
1464276:1464291	attL	GGTCAGCGGAATTGGC	NA	NA	NA	NA
WP_020806774.1|1465275_1466022_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	2.1e-21
WP_020806775.1|1466118_1466553_+	HIT family protein	NA	D7NW73	Streptomyces_phage	40.0	8.9e-12
WP_020806776.1|1466636_1467125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020806777.1|1467124_1467475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003648324.1|1467596_1468493_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_159311042.1|1468546_1469524_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_051904661.1|1469526_1471965_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_020806780.1|1471942_1473166_-	DNA repair exonuclease	NA	NA	NA	NA	NA
WP_003646880.1|1473171_1473525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020806781.1|1473550_1475608_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_020806782.1|1475714_1476563_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_159311043.1|1477190_1477595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159311044.1|1477596_1477956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159311045.1|1478203_1479139_-	lysin	NA	Q6SE63	Lactobacillus_prophage	65.4	1.2e-117
WP_065169680.1|1479151_1479550_-|holin	phage holin	holin	Q6SEB6	Lactobacillus_prophage	88.6	6.3e-57
WP_159311046.1|1479546_1479783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656253.1|1479796_1480198_-	hypothetical protein	NA	Q6SEB9	Lactobacillus_prophage	66.2	4.4e-42
WP_100215364.1|1480259_1480403_-	XkdX family protein	NA	NA	NA	NA	NA
WP_035422715.1|1480402_1481056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159311047.1|1481075_1481507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159311048.1|1481533_1484104_-	hypothetical protein	NA	Q6SEC0	Lactobacillus_prophage	42.8	4.5e-63
WP_159311049.1|1484103_1484481_-	hypothetical protein	NA	Q6SEC1	Lactobacillus_prophage	50.8	6.5e-27
WP_159311050.1|1484470_1486861_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	89.2	0.0e+00
WP_159311051.1|1486860_1487676_-	hypothetical protein	NA	Q6SEC3	Lactobacillus_prophage	88.7	2.9e-133
WP_159311052.1|1491027_1491348_-	hypothetical protein	NA	A0A0P0ID51	Lactobacillus_phage	51.0	1.1e-16
WP_077959552.1|1491395_1491782_-	hypothetical protein	NA	A0A0P0IQQ6	Lactobacillus_phage	38.0	1.8e-16
WP_159311053.1|1491781_1492411_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_119724385.1|1492411_1492798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159311054.1|1492797_1493163_-	hypothetical protein	NA	A0A0A1ENQ3	Lactobacillus_phage	45.5	5.9e-17
WP_003648527.1|1493155_1493467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003648526.1|1493456_1493798_-|head,tail	phage head-tail connector protein	head,tail	Q6SED1	Lactobacillus_prophage	62.8	1.6e-32
WP_077959555.1|1493812_1494721_-	hypothetical protein	NA	A0A0A1ELG8	Lactobacillus_phage	48.6	8.5e-65
WP_077959556.1|1494731_1495325_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_159311055.1|1495410_1495611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159311056.1|1495672_1496656_-	hypothetical protein	NA	A0A0A1EKX3	Lactobacillus_phage	44.7	4.6e-64
WP_159311057.1|1496630_1498037_-|portal	phage portal protein	portal	Q6SED7	Lactobacillus_prophage	50.1	1.3e-120
WP_159311058.1|1498050_1499283_-|terminase	PBSX family phage terminase large subunit	terminase	X2CYF4	Lactobacillus_phage	72.6	6.3e-172
WP_159311093.1|1499245_1499755_-|terminase	small terminase subunit	terminase	A9D9R6	Lactobacillus_prophage	90.5	4.0e-80
WP_003649135.1|1499808_1500252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003649136.1|1500226_1500697_-	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	39.9	3.1e-26
WP_065169671.1|1502048_1502552_-	hypothetical protein	NA	Q20DE6	Lactobacillus_phage	94.0	2.7e-89
WP_011678824.1|1502581_1502752_-	hypothetical protein	NA	Q20DE7	Lactobacillus_phage	100.0	5.5e-26
WP_159311059.1|1502956_1503244_-	hypothetical protein	NA	Q20DE9	Lactobacillus_phage	89.6	1.8e-45
WP_003648032.1|1503489_1503750_-	hypothetical protein	NA	A9D9P5	Lactobacillus_prophage	60.5	2.3e-23
WP_003656226.1|1503750_1504212_-	RusA family crossover junction endodeoxyribonuclease	NA	Q20DF1	Lactobacillus_phage	90.8	6.6e-74
WP_020807677.1|1504215_1504518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003656224.1|1504933_1505197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020807680.1|1505419_1505605_-	hypothetical protein	NA	Q20DF6	Lactobacillus_phage	69.0	1.4e-14
WP_003656223.1|1505618_1506404_-	hypothetical protein	NA	Q20DF7	Lactobacillus_phage	82.5	3.3e-105
WP_003656222.1|1506396_1507026_-	hypothetical protein	NA	Q20DF9	Lactobacillus_phage	45.0	6.1e-38
WP_159311060.1|1507029_1507380_-	helix-turn-helix domain-containing protein	NA	X2CY61	Lactobacillus_phage	89.9	1.4e-44
WP_159311061.1|1507385_1508291_-	helix-turn-helix domain-containing protein	NA	Q6SEE7	Lactobacillus_prophage	57.8	2.9e-41
WP_003654233.1|1508305_1509106_-	DUF1071 domain-containing protein	NA	X2CXM9	Lactobacillus_phage	76.8	1.1e-111
WP_003648022.1|1509111_1509390_-	hypothetical protein	NA	X2CXD9	Lactobacillus_phage	88.0	5.4e-39
WP_003654231.1|1509389_1509716_-	hypothetical protein	NA	X2CXW9	Lactobacillus_phage	98.1	8.9e-57
WP_159311062.1|1510028_1510304_-	hypothetical protein	NA	X2CY60	Lactobacillus_phage	84.8	8.9e-34
WP_159311063.1|1510307_1510643_-	DUF771 domain-containing protein	NA	X2CYF0	Lactobacillus_phage	95.5	5.7e-59
WP_094503271.1|1510716_1510941_-	helix-turn-helix transcriptional regulator	NA	A9D9J9	Lactobacillus_prophage	97.3	2.7e-33
WP_159311064.1|1511104_1511461_+	helix-turn-helix domain-containing protein	NA	A9D9J6	Lactobacillus_prophage	90.7	1.5e-57
WP_159311065.1|1511460_1511919_+	ImmA/IrrE family metallo-endopeptidase	NA	A9D9J3	Lactobacillus_prophage	92.0	1.9e-81
WP_159311066.1|1511957_1512800_+	DUF4428 domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	39.8	1.1e-26
WP_159311067.1|1512799_1513909_+|integrase	tyrosine-type recombinase/integrase	integrase	E9LUS1	Lactobacillus_phage	42.7	1.8e-77
WP_020806783.1|1514209_1515529_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.8	4.1e-84
WP_020806784.1|1515521_1515905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024273084.1|1515930_1516455_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_024272995.1|1517844_1518894_+|transposase	IS30-like element ISLga1 family transposase	transposase	H7BWC8	unidentified_phage	35.4	2.4e-47
1533312:1533327	attR	GGTCAGCGGAATTGGC	NA	NA	NA	NA
