The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP024621	Halomonas meridiana strain SCSIO 43005 chromosome, complete genome	3860077	293798	331437	3860077	holin,portal,capsid,head,transposase,tail,terminase,protease	Pseudomonas_phage(24.24%)	48	NA	NA
WP_159340731.1|293798_294962_-	DUF3596 domain-containing protein	NA	A0A1W6JTA0	Pseudomonas_phage	55.6	4.1e-112
WP_159340732.1|295112_295916_-	hypothetical protein	NA	A0A219YFC7	Ochrobactrum_phage	40.2	2.4e-31
WP_159340733.1|295912_296575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159340734.1|296571_296793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159340735.1|296789_297035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159340736.1|297031_297685_-	hypothetical protein	NA	H2BD37	Pseudomonas_phage	48.6	8.1e-17
WP_159340737.1|297757_298561_-	DUF2303 family protein	NA	Q8SBF9	Shigella_phage	40.6	2.1e-46
WP_159340738.1|298618_298978_-	hypothetical protein	NA	A0A2D1GMS3	Marinobacter_phage	46.9	1.2e-22
WP_159340739.1|299064_299385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159340740.1|299381_299708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159340741.1|299704_299896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159340742.1|300042_301125_-	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	42.1	3.1e-66
WP_159340743.1|301149_301878_-	helix-turn-helix domain-containing protein	NA	A0A1B0Z078	Pseudomonas_phage	28.2	5.7e-11
WP_159340744.1|301953_302142_+	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	47.2	3.7e-07
WP_159340745.1|302337_302847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159340746.1|302839_303040_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	39.7	8.8e-07
WP_159340747.1|303051_303312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159340748.1|303335_304364_+	toprim domain-containing protein	NA	A0A193GYG9	Enterobacter_phage	31.7	7.5e-25
WP_159340749.1|304363_306082_+	hypothetical protein	NA	A0A2H4JF22	uncultured_Caudovirales_phage	51.2	2.1e-157
WP_159340750.1|306408_306786_+	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	32.3	1.4e-05
WP_159340751.1|306943_308160_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	58.6	6.8e-94
WP_159340752.1|308359_308938_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0GUZ6	Halomonas_phage	57.4	9.6e-54
WP_074211129.1|308963_309287_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	44.3	5.2e-17
WP_159340753.1|309283_309715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159340754.1|309850_310171_+	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	60.4	8.2e-31
WP_159340755.1|310386_310902_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B1V2	Gordonia_phage	32.6	6.2e-12
WP_159340756.1|310864_312586_+|terminase	phage terminase small subunit P27 family	terminase	A0A0U2C138	Paracoccus_phage	44.2	4.3e-134
WP_159343683.1|312729_313905_+|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	35.1	3.3e-53
WP_159340757.1|313861_314572_+|protease	Clp protease ClpP	protease	C7BGG9	Burkholderia_phage	49.7	6.9e-46
WP_159340758.1|314637_315885_+|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	43.3	1.2e-80
WP_159340759.1|315947_316328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159340760.1|316324_316855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159340761.1|316851_317172_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	34.8	1.7e-12
WP_074211120.1|317168_317588_+	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	47.6	9.4e-27
WP_159340762.1|317584_317914_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	36.9	1.1e-09
WP_159340763.1|317971_318445_+|tail	phage tail protein	tail	A0A1W6JP06	Morganella_phage	48.6	9.6e-28
WP_159340764.1|318448_318877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159340765.1|318903_319194_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	47.8	1.0e-16
WP_159340766.1|319249_319690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159340767.1|319745_323009_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	24.3	8.6e-51
WP_159340768.1|323005_323593_+	hypothetical protein	NA	A0A0E3M4C5	Enterobacteria_phage	44.0	4.1e-36
WP_159340769.1|323592_324189_+	hypothetical protein	NA	A0A059VA31	Pseudomonas_phage	60.8	2.8e-64
WP_159340770.1|324172_324394_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	58.5	5.7e-15
WP_159340771.1|324464_324869_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	63.4	6.7e-46
WP_159340772.1|324861_329367_+	DUF1983 domain-containing protein	NA	A0A059VFW9	Pseudomonas_phage	46.8	5.3e-184
WP_159340773.1|329376_329766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159340774.1|329752_330112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159340775.1|330108_331437_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	34.9	4.0e-23
>prophage 2
NZ_CP024621	Halomonas meridiana strain SCSIO 43005 chromosome, complete genome	3860077	764087	775010	3860077	tRNA	Cafeteria_roenbergensis_virus(16.67%)	8	NA	NA
WP_159341244.1|764087_764951_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	43.2	1.4e-48
WP_159341245.1|765019_766309_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	58.5	1.3e-130
WP_044628866.1|766806_767130_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_159341246.1|767312_769880_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.3	4.3e-29
WP_159341247.1|770001_770526_+	nicotinamide-nucleotide amidohydrolase family protein	NA	B5TK85	Pseudomonas_phage	56.6	1.2e-34
WP_159341248.1|770615_771677_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.0	8.9e-114
WP_159341249.1|771715_772177_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_159341250.1|772400_775010_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	37.7	6.2e-76
>prophage 3
NZ_CP024621	Halomonas meridiana strain SCSIO 43005 chromosome, complete genome	3860077	1063146	1103502	3860077	holin,portal,head,capsid,tail,tRNA,terminase,integrase,plate	uncultured_Caudovirales_phage(29.03%)	53	1064268:1064292	1100104:1100128
WP_159341487.1|1063146_1064199_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
1064268:1064292	attL	AGTGTACCACCAGTGTACCAAGCGG	NA	NA	NA	NA
WP_159341488.1|1064521_1065352_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1GMX8	Marinobacter_phage	43.5	9.8e-52
WP_159341489.1|1065348_1065567_-	pyocin activator protein PrtN	NA	NA	NA	NA	NA
WP_159341490.1|1065563_1065815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341491.1|1065908_1066820_-	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	45.1	8.5e-57
WP_159341492.1|1066812_1067031_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	43.9	1.9e-07
WP_159341493.1|1067045_1069349_-	hypothetical protein	NA	F1BUS0	Erwinia_phage	34.3	5.9e-70
WP_159341494.1|1069345_1069627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341495.1|1069623_1070025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341496.1|1070021_1070351_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_159341497.1|1070343_1070532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341498.1|1070569_1070773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341499.1|1070804_1071011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341500.1|1071052_1071349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341501.1|1071414_1072071_+	hypothetical protein	NA	A0A1C6ZDG7	Pseudomonas_phage	26.8	1.5e-15
WP_159341502.1|1072101_1073034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159341503.1|1073018_1073558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159341504.1|1073574_1074144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341505.1|1074416_1074767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159341506.1|1075298_1075883_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_159341507.1|1075830_1076058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341508.1|1076445_1076865_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	53.6	6.1e-34
WP_159341509.1|1076902_1077085_-	addiction module toxin, HicA family	NA	D6R431	Bacillus_phage	66.7	3.8e-17
WP_159341510.1|1077169_1078156_-	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	46.9	2.4e-81
WP_159341511.1|1078152_1078596_-	oxidoreductase	NA	A0A2H4JG54	uncultured_Caudovirales_phage	59.4	4.2e-41
WP_159341512.1|1078606_1081699_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	35.7	1.3e-112
WP_159341513.1|1081720_1081864_-|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	68.6	1.4e-06
WP_159341514.1|1081890_1082241_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	52.9	9.6e-17
WP_159341515.1|1082300_1082810_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	46.5	1.2e-39
WP_159343715.1|1082847_1084011_-|tail	phage tail protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	64.9	8.7e-131
WP_159341516.1|1084673_1085345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341517.1|1085346_1087872_-	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	44.2	1.1e-34
WP_159341518.1|1087873_1088407_-|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	53.5	9.8e-45
WP_159341519.1|1088399_1089290_-|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	54.1	1.8e-80
WP_159341520.1|1089286_1089625_-|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	46.8	1.3e-21
WP_159341521.1|1089624_1090194_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	49.2	1.4e-28
WP_159341522.1|1090272_1090740_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	48.3	2.4e-31
WP_159341523.1|1090736_1091222_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	34.5	2.4e-18
WP_159341524.1|1091339_1091690_-	hypothetical protein	NA	A0A1Y0SUD7	Pseudomonas_phage	50.0	1.9e-17
WP_159341525.1|1091686_1092499_-	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	51.0	5.4e-63
WP_159341526.1|1092500_1092773_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_159341527.1|1092769_1093114_-	hypothetical protein	NA	K4NZQ3	Burkholderia_phage	42.2	8.3e-13
WP_159341528.1|1093133_1093349_-|tail	phage tail protein	tail	A0A077K8R0	Ralstonia_phage	48.5	5.9e-09
WP_159341529.1|1093345_1093807_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	45.0	2.0e-22
WP_159341530.1|1093911_1094592_-|terminase	terminase	terminase	K4NX86	Burkholderia_phage	46.7	2.1e-44
WP_159341531.1|1094591_1095614_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	62.4	3.5e-115
WP_159341532.1|1095657_1096470_-|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	46.7	2.4e-55
WP_159341533.1|1096614_1098405_+|terminase	terminase	terminase	K4NXI4	Burkholderia_phage	59.3	1.1e-204
WP_159341534.1|1098401_1099463_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	57.4	5.0e-109
WP_159341535.1|1099838_1100102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341536.1|1100612_1101191_+	hypothetical protein	NA	NA	NA	NA	NA
1100104:1100128	attR	AGTGTACCACCAGTGTACCAAGCGG	NA	NA	NA	NA
WP_159341537.1|1101212_1101737_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159341538.1|1102023_1103502_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP024621	Halomonas meridiana strain SCSIO 43005 chromosome, complete genome	3860077	1152416	1218247	3860077	tRNA,transposase,protease	Bacillus_virus(18.18%)	53	NA	NA
WP_159341571.1|1152416_1153574_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_159341572.1|1153647_1154118_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_159341573.1|1154114_1154786_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_159341574.1|1155076_1157311_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_159343718.1|1157611_1157920_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	2.2e-12
WP_159341575.1|1158073_1160350_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.4	2.4e-169
WP_007111068.1|1160503_1160722_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_159341576.1|1160860_1161595_-	arginyltransferase	NA	NA	NA	NA	NA
WP_159341577.1|1161623_1162376_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_159341578.1|1162493_1165763_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.9	1.0e-88
WP_159341579.1|1165911_1166568_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_159341580.1|1166632_1167958_-	AAA family ATPase	NA	G3MBE0	Bacillus_virus	36.6	2.8e-64
WP_159341581.1|1168201_1168747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159341582.1|1168907_1169720_+	glutamate racemase	NA	NA	NA	NA	NA
WP_159341583.1|1169762_1170872_+|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	A0A2K5B251	Erysipelothrix_phage	26.3	5.4e-13
WP_159341584.1|1171065_1175889_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_159341585.1|1176043_1177060_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_159341586.1|1177155_1177365_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_159341587.1|1177753_1179964_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_159341588.1|1179998_1180334_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_139525487.1|1180368_1180650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341589.1|1180734_1181880_+	4-phosphoerythronate dehydrogenase PdxB	NA	NA	NA	NA	NA
WP_159341590.1|1181956_1182862_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_159341591.1|1182964_1184212_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_159341592.1|1184267_1185221_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_159341593.1|1185300_1185699_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_159341594.1|1185845_1187432_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_062373659.1|1187459_1188785_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_058576902.1|1188788_1189298_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_159341595.1|1189299_1190403_-	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_159341596.1|1191475_1193104_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_159341597.1|1193379_1194342_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	2.2e-18
WP_159341598.1|1194338_1195112_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_159341599.1|1195166_1196000_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	38.7	1.3e-40
WP_159341600.1|1196028_1196589_+	nitroreductase	NA	NA	NA	NA	NA
WP_159341601.1|1196612_1197119_+	thioesterase	NA	NA	NA	NA	NA
WP_159341602.1|1198411_1199107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341603.1|1199364_1200978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153843651.1|1201056_1201257_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	39.7	1.8e-07
WP_159341604.1|1201661_1202231_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_159341605.1|1203067_1203760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159340751.1|1203772_1204988_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	58.6	6.8e-94
WP_159341606.1|1205030_1206389_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_159341607.1|1206541_1206958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159341608.1|1207089_1207860_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_159341609.1|1207869_1209759_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_159341610.1|1209827_1211180_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_159341611.1|1211148_1211814_-	response regulator	NA	NA	NA	NA	NA
WP_159341612.1|1211828_1212329_-	copper-binding protein	NA	NA	NA	NA	NA
WP_016915528.1|1212671_1213109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159341613.1|1213196_1214453_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_159341614.1|1214475_1216788_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.5	6.3e-88
WP_159340751.1|1217030_1218247_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	58.6	6.8e-94
>prophage 5
NZ_CP024621	Halomonas meridiana strain SCSIO 43005 chromosome, complete genome	3860077	2101982	2124960	3860077	terminase,capsid	Pseudomonas_phage(27.78%)	36	NA	NA
WP_159342334.1|2101982_2102216_-	hypothetical protein	NA	A0A1J0GUV9	Halomonas_phage	47.2	5.8e-10
WP_159342335.1|2102196_2102364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159342336.1|2102360_2102771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159342337.1|2103465_2103795_-	hypothetical protein	NA	K7PHA5	Enterobacterial_phage	40.2	5.1e-12
WP_159342338.1|2103818_2104040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159342339.1|2104478_2105126_-	helix-turn-helix domain-containing protein	NA	U5P0T5	Shigella_phage	45.5	8.0e-25
WP_159343753.1|2105277_2105466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159342340.1|2105530_2105995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159342341.1|2106065_2106527_+	hypothetical protein	NA	A0A088F856	Sulfitobacter_phage	44.0	1.0e-05
WP_159342342.1|2106523_2107636_+	hypothetical protein	NA	W6MYB0	Pseudomonas_phage	41.2	4.0e-08
WP_159342343.1|2107632_2109006_+	AAA family ATPase	NA	O80281	Escherichia_phage	32.2	4.4e-57
WP_159342344.1|2109016_2109208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159342345.1|2109204_2109696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159342346.1|2109692_2110202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159342347.1|2110201_2110534_+	DUF1364 family protein	NA	A0A2I7RNU4	Vibrio_phage	60.6	4.7e-29
WP_159342348.1|2110649_2111033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159342349.1|2111029_2111224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159342350.1|2111220_2111856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159342351.1|2111865_2112438_+	hypothetical protein	NA	A0A2I7S6I2	Vibrio_phage	39.3	1.2e-19
WP_159342352.1|2112615_2113251_+	hypothetical protein	NA	B0ZSJ3	Halomonas_phage	63.0	4.0e-61
WP_159342353.1|2113240_2113459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159343754.1|2113869_2114016_+	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_159342354.1|2114008_2114245_+	hypothetical protein	NA	A0A1J0GV02	Halomonas_phage	46.8	3.2e-08
WP_159342355.1|2114237_2114528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159342356.1|2114680_2115055_+	hypothetical protein	NA	A0A088C427	Shewanella_sp._phage	65.6	6.8e-45
WP_159342357.1|2115051_2115264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159343755.1|2115426_2115996_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	61.2	1.3e-47
WP_159342358.1|2117671_2118853_+	DUF1073 domain-containing protein	NA	A0A0N9SI81	Pseudomonas_phage	31.2	1.2e-31
WP_159342359.1|2118839_2119667_+|capsid	minor capsid protein	capsid	I3PGT9	Xanthomonas_phage	36.8	5.4e-34
WP_159342360.1|2120789_2121029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159342361.1|2121354_2121612_+	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	64.3	2.0e-19
WP_159342362.1|2121553_2122135_+	DUF2184 domain-containing protein	NA	NA	NA	NA	NA
WP_159342363.1|2122392_2122797_+	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	43.6	6.3e-12
WP_159342364.1|2122783_2123179_+	hypothetical protein	NA	A0A2H4IZB5	uncultured_Caudovirales_phage	49.6	2.8e-28
WP_159342365.1|2123558_2123969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162527873.1|2124042_2124960_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	55.1	1.6e-87
