The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 2
NZ_CP047218	Sphingobium yanoikuyae strain YC-JY1 chromosome, complete genome	5482815	1938987	1947910	5482815	tRNA,protease	Burkholderia_virus(16.67%)	9	NA	NA
WP_159366267.1|1938987_1940292_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.0	9.4e-49
WP_159366268.1|1940288_1940948_-|protease	TIGR02281 family clan AA aspartic protease	protease	NA	NA	NA	NA
WP_159366269.1|1940947_1941736_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_159366270.1|1941732_1942521_-	YchF/TatD family DNA exonuclease	NA	NA	NA	NA	NA
WP_159366271.1|1942524_1944093_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.8	1.1e-91
WP_159366272.1|1944136_1945108_-	AAA family ATPase	NA	A0A1U9WR94	Streptococcus_virus	29.9	2.3e-07
WP_159366273.1|1945104_1945731_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	33.0	1.3e-16
WP_159366274.1|1945727_1946891_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	33.5	1.9e-45
WP_159366275.1|1946938_1947910_-	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	46.4	4.7e-13
>prophage 3
NZ_CP047218	Sphingobium yanoikuyae strain YC-JY1 chromosome, complete genome	5482815	2749174	2760016	5482815	tail,head,capsid,protease,portal	Pseudomonas_phage(33.33%)	17	NA	NA
WP_159366685.1|2749174_2749729_-|tail	tail tape measure protein	tail	D6PEW0	uncultured_phage	33.3	1.5e-08
WP_159366686.1|2749753_2749951_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_159366687.1|2749947_2750262_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_004207802.1|2750258_2750666_-|tail	TP901-1 family phage major tail protein	tail	NA	NA	NA	NA
WP_159366688.1|2750722_2751049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159366689.1|2751049_2751460_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_159366690.1|2751456_2751663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366691.1|2751659_2752193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366692.1|2752192_2752471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366693.1|2752624_2754466_-	hypothetical protein	NA	A0A1S5R3Z4	Pseudomonas_phage	49.7	1.2e-30
WP_159366694.1|2754590_2755709_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	43.3	1.4e-77
WP_159366695.1|2755906_2756380_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_159366696.1|2756397_2757066_+	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_155276543.1|2757104_2757644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366697.1|2757658_2758105_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	46.0	6.5e-18
WP_097384108.1|2758101_2758422_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	46.1	2.0e-08
WP_159366698.1|2758885_2760016_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	38.1	5.3e-48
>prophage 4
NZ_CP047218	Sphingobium yanoikuyae strain YC-JY1 chromosome, complete genome	5482815	2955686	2961310	5482815		uncultured_Mediterranean_phage(66.67%)	8	NA	NA
WP_037510479.1|2955686_2956679_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	41.6	6.9e-52
WP_099234171.1|2956877_2957855_+	cell wall hydrolase	NA	A0A0S1WEP8	Vibrio_phage	31.0	6.0e-08
WP_004207973.1|2958226_2958355_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_037510477.1|2958390_2959182_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	42.9	2.0e-46
WP_159366813.1|2959178_2959643_-	translocase	NA	NA	NA	NA	NA
WP_004207976.1|2959669_2959909_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	75.0	4.0e-06
WP_159366814.1|2959937_2960531_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	43.4	1.5e-38
WP_125998105.1|2960527_2961310_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	31.5	2.8e-32
>prophage 5
NZ_CP047218	Sphingobium yanoikuyae strain YC-JY1 chromosome, complete genome	5482815	3112212	3147348	5482815	tail,tRNA,head,capsid,protease,integrase,terminase,portal	Paracoccus_phage(30.0%)	42	3105778:3105794	3128852:3128868
3105778:3105794	attL	CGGGCGGGCTGATCGCG	NA	NA	NA	NA
WP_159368030.1|3112212_3113727_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y4Q1	Acanthamoeba_polyphaga_mimivirus	29.5	7.3e-29
WP_159366891.1|3113790_3116679_+	CHAT domain-containing protein	NA	NA	NA	NA	NA
WP_069335746.1|3116659_3117673_-	2-hydroxyacid dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	40.2	1.9e-57
WP_017502598.1|3117826_3118192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004208138.1|3118319_3119690_+	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_159366892.1|3119755_3121084_-	cytochrome P450	NA	NA	NA	NA	NA
WP_159366893.1|3121223_3123077_+	acyltransferase family protein	NA	W6MVL2	Pseudomonas_phage	41.8	9.8e-68
WP_080726982.1|3123078_3123969_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_004208143.1|3124110_3124488_+	response regulator	NA	NA	NA	NA	NA
WP_004208144.1|3124480_3125827_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_159366894.1|3126084_3127404_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_159366895.1|3127658_3128099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366896.1|3128095_3128308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366897.1|3128304_3128574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366898.1|3128681_3129866_-	ParB N-terminal domain-containing protein	NA	H9A0Q8	Staphylococcus_phage	30.2	4.4e-13
3128852:3128868	attR	CGGGCGGGCTGATCGCG	NA	NA	NA	NA
WP_159366899.1|3129901_3130204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366900.1|3130200_3130626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366901.1|3130640_3130973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366902.1|3130969_3131191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366903.1|3131187_3131523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366904.1|3131525_3132212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366905.1|3132213_3132729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366906.1|3132888_3133626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366907.1|3133746_3133905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159368031.1|3133910_3134759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159366908.1|3134755_3136291_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_159366909.1|3136512_3136911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159366910.1|3136907_3137237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159366911.1|3137233_3137404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159366912.1|3137400_3137961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159366913.1|3138482_3138659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159366914.1|3138655_3139249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368032.1|3139280_3139670_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	44.0	9.7e-10
WP_159366915.1|3140191_3140455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159366916.1|3140546_3140948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159366917.1|3140904_3142779_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	48.4	5.7e-156
WP_159366918.1|3142775_3144053_+|portal	phage portal protein	portal	A0A0U2BXP2	Paracoccus_phage	43.4	3.6e-85
WP_159366919.1|3144039_3144708_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	47.7	1.6e-44
WP_159368033.1|3144814_3146047_+|capsid	phage major capsid protein	capsid	I7HDH9	Xanthomonas_virus	55.8	2.1e-90
WP_159366920.1|3146096_3146396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159366921.1|3146395_3146995_+	hypothetical protein	NA	I3UM02	Rhodobacter_phage	30.9	6.5e-13
WP_159366922.1|3146994_3147348_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
>prophage 6
NZ_CP047218	Sphingobium yanoikuyae strain YC-JY1 chromosome, complete genome	5482815	4161528	4201045	5482815	transposase,integrase	Escherichia_phage(33.33%)	35	4164103:4164117	4204078:4204092
WP_159367933.1|4161528_4162667_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.3	5.2e-19
WP_125990181.1|4162807_4163452_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159367443.1|4163448_4164534_-	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
4164103:4164117	attL	GATGAAGCCGCCGCC	NA	NA	NA	NA
WP_159367444.1|4164616_4165072_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159367445.1|4165068_4165683_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_159367446.1|4165720_4166497_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_159367447.1|4166653_4167562_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159367448.1|4167662_4168055_+	preprotein translocase subunit TatC	NA	NA	NA	NA	NA
WP_159367449.1|4168085_4168874_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_010336197.1|4168942_4169380_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_159367450.1|4169429_4171058_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.2	2.0e-19
WP_159367451.1|4171212_4172712_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_159367452.1|4172841_4174176_+	4-hydroxybutyrate--acetyl-CoA CoA transferase	NA	NA	NA	NA	NA
WP_159367453.1|4174176_4174947_-	thioesterase family protein	NA	NA	NA	NA	NA
WP_159367454.1|4175145_4176231_+	endonuclease	NA	NA	NA	NA	NA
WP_159367455.1|4176227_4176806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013054031.1|4176777_4177542_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.1	5.1e-87
WP_159367456.1|4177711_4178014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159367457.1|4178054_4178669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159367458.1|4178680_4179367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368082.1|4179471_4180035_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	28.2	6.7e-12
WP_159367459.1|4180061_4180802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159367460.1|4181445_4182003_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	55.1	2.1e-45
WP_001389365.1|4182182_4182947_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_013054031.1|4183596_4184361_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.1	5.1e-87
WP_159367461.1|4184177_4187003_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_159367462.1|4187543_4188617_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_159367463.1|4188707_4192613_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_159367464.1|4192655_4193606_-	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_159368083.1|4193648_4194398_-	hypothetical protein	NA	A0A0P0YLT6	Yellowstone_lake_mimivirus	38.5	6.6e-15
WP_159367465.1|4194430_4196077_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_159367466.1|4196470_4197994_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_159368084.1|4197983_4198790_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.9	2.2e-32
WP_008831331.1|4199684_4200080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008831330.1|4200076_4201045_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
4204078:4204092	attR	GGCGGCGGCTTCATC	NA	NA	NA	NA
>prophage 7
NZ_CP047218	Sphingobium yanoikuyae strain YC-JY1 chromosome, complete genome	5482815	4531027	4547571	5482815	transposase,integrase	Stenotrophomonas_phage(20.0%)	12	4530238:4530252	4546574:4546588
4530238:4530252	attL	CGACCAGCCCCATGA	NA	NA	NA	NA
WP_159368096.1|4531027_4532254_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	43.1	8.7e-89
WP_159367625.1|4532348_4533242_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159367626.1|4533360_4534308_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_159367627.1|4534373_4535306_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_159368097.1|4535392_4535752_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_159367628.1|4536033_4536624_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	55.9	1.0e-26
WP_159367629.1|4536762_4537671_+	virulence protein	NA	A0A2I6UGE7	Salinibacter_virus	44.8	1.5e-05
WP_013039223.1|4539235_4540606_-|transposase	IS1380-like element ISSp1 family transposase	transposase	NA	NA	NA	NA
WP_009823939.1|4541659_4542664_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_009823940.1|4542660_4544016_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007015824.1|4544012_4545245_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	27.3	2.1e-05
WP_001389365.1|4546806_4547571_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
4546574:4546588	attR	TCATGGGGCTGGTCG	NA	NA	NA	NA
>prophage 8
NZ_CP047218	Sphingobium yanoikuyae strain YC-JY1 chromosome, complete genome	5482815	4719370	4749966	5482815	transposase	Escherichia_phage(60.0%)	38	NA	NA
WP_015449415.1|4719370_4720135_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.2	3.6e-85
WP_159368110.1|4720163_4720313_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_063976428.1|4720415_4720742_-	pemk protein	NA	NA	NA	NA	NA
WP_063976429.1|4720738_4720996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159367693.1|4721278_4721929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368111.1|4721929_4722460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159367694.1|4722507_4722726_+	DUF1491 family protein	NA	NA	NA	NA	NA
WP_159367695.1|4722789_4723392_-	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_006473457.1|4723632_4724988_-|transposase	IS1380-like element IS1247 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	29.7	2.2e-45
WP_081260992.1|4725129_4725828_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_063976430.1|4725904_4726147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063976431.1|4726197_4726683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122129195.1|4726807_4728265_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_122129113.1|4728363_4729488_-	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_122129112.1|4729606_4730044_-	pseudoazurin	NA	NA	NA	NA	NA
WP_159367696.1|4730138_4731695_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_159367697.1|4731714_4732053_-	cytochrome c	NA	NA	NA	NA	NA
WP_159367698.1|4732049_4732388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368112.1|4732751_4734407_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_159368113.1|4734500_4734644_+	killer protein	NA	NA	NA	NA	NA
WP_159367699.1|4734654_4734939_+	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	37.0	5.6e-07
WP_159367700.1|4735148_4735601_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_159367701.1|4735998_4736352_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015063481.1|4736773_4737877_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_015449415.1|4740314_4741079_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.2	3.6e-85
WP_099232206.1|4741611_4742022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069336911.1|4742018_4742456_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_069336921.1|4742452_4743370_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_159367702.1|4743470_4744094_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_069336910.1|4744090_4744465_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069336909.1|4744841_4745135_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_069336908.1|4745362_4746439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069336920.1|4746590_4746971_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_069336907.1|4747161_4747557_+	group III truncated hemoglobin	NA	NA	NA	NA	NA
WP_159367703.1|4747584_4748271_+	oxidase	NA	NA	NA	NA	NA
WP_099232202.1|4748272_4748545_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_069336904.1|4748600_4748807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159367704.1|4749019_4749966_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	24.0	9.0e-09
>prophage 9
NZ_CP047218	Sphingobium yanoikuyae strain YC-JY1 chromosome, complete genome	5482815	4821246	4919198	5482815	transposase,integrase	uncultured_Caudovirales_phage(33.33%)	101	4876027:4876086	4915163:4916043
WP_099232343.1|4821246_4822398_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_099232344.1|4822390_4824139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099232346.1|4825980_4826466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159367735.1|4828701_4829622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066667215.1|4829814_4831680_-	RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	38.0	1.8e-29
WP_159367736.1|4832635_4833022_+	DUF3768 domain-containing protein	NA	NA	NA	NA	NA
WP_159367737.1|4833149_4833407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159367738.1|4833409_4834696_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_159367739.1|4834716_4835505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159367740.1|4835541_4835679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159367741.1|4836266_4836596_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159367742.1|4836558_4837524_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.3	3.8e-47
WP_008830456.1|4838199_4839090_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_037519512.1|4839110_4839752_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_008830454.1|4839754_4840384_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_008830453.1|4840380_4841190_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_037519524.1|4841189_4841969_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_008830451.1|4841968_4843201_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008830450.1|4843197_4843632_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_008830449.1|4843650_4844076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_037519509.1|4844075_4844516_-	membrane protein	NA	NA	NA	NA	NA
WP_037519521.1|4844512_4845430_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_037519507.1|4845515_4846139_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_086013073.1|4846135_4846546_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|4846735_4847500_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_159367743.1|4847539_4847953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159367744.1|4848271_4848829_+	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_159367745.1|4849014_4849404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159367746.1|4849467_4849887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159367747.1|4850017_4850470_-	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_159367748.1|4850598_4851156_-	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_159367749.1|4851329_4852391_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_159367750.1|4852920_4854147_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_159367751.1|4854127_4854610_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_159368117.1|4854609_4855041_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_157085496.1|4855138_4856501_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_159367752.1|4856537_4857179_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	67.2	1.1e-77
WP_159368118.1|4857144_4858017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159367753.1|4857936_4859793_+	methylase	NA	A0A076FMQ0	Aureococcus_anophage	29.5	2.4e-13
WP_159367754.1|4859944_4860115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125989582.1|4860159_4861522_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_069337910.1|4861642_4861870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069337911.1|4861916_4862108_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_069337912.1|4862104_4864219_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	27.8	6.4e-63
WP_021227175.1|4864215_4864659_-	FixH family protein	NA	NA	NA	NA	NA
WP_125989584.1|4864655_4866197_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_081331756.1|4866180_4867143_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_020820401.1|4867135_4867291_-	cbb3-type cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_020820402.1|4867287_4868025_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_069337915.1|4868038_4869700_-	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_020820404.1|4869723_4870023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069337920.1|4870580_4871894_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_069337916.1|4871984_4872674_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_081331757.1|4872667_4873282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069337918.1|4873344_4873743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125989592.1|4874059_4875232_+	glycosidase	NA	NA	NA	NA	NA
4876027:4876086	attL	TGGCTCTGTTGCAAAAATCGTGAAGCTTGAGCATGCTTGGCGGAGATTGAACGGATGGAG	NA	NA	NA	NA
WP_013054031.1|4876088_4876853_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.1	5.1e-87
WP_159367755.1|4876824_4877232_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_037521976.1|4877696_4878026_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_159367756.1|4878036_4878558_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	43.2	5.3e-27
WP_159367757.1|4878554_4878983_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	66.9	7.6e-48
WP_159367758.1|4878982_4880269_+	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.5	2.2e-167
WP_120252807.1|4880268_4881012_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.0	5.5e-78
WP_159367759.1|4881063_4881354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159367760.1|4881433_4881817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159367761.1|4881843_4883199_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.2	7.5e-33
WP_159367762.1|4883880_4885365_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	63.6	2.7e-169
WP_159367763.1|4885376_4886228_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.6	1.8e-53
WP_159367764.1|4886202_4886568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159367765.1|4886582_4886786_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_159367766.1|4886862_4887966_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_159367767.1|4888028_4889213_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	61.7	6.4e-105
WP_159367768.1|4889368_4890280_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159367769.1|4890708_4891089_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_043150706.1|4891010_4891457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159367770.1|4891501_4894261_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_013054031.1|4894518_4895283_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.1	5.1e-87
WP_080572850.1|4898182_4899559_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010338372.1|4899567_4900242_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.4	2.0e-31
WP_010338374.1|4900241_4901570_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_037509342.1|4901698_4903885_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_037509343.1|4903887_4904481_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_080572848.1|4904536_4905340_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010338379.1|4905529_4906162_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WF93	Clostridium_phage	29.9	7.8e-09
WP_080572849.1|4906543_4906648_-	DUF2474 family protein	NA	NA	NA	NA	NA
WP_010338381.1|4906647_4907646_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_010338382.1|4907642_4909037_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010338383.1|4909049_4909835_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_029547838.1|4909838_4911422_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_010338385.1|4911459_4911870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010338386.1|4911866_4912073_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_010338387.1|4912089_4912539_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_010338389.1|4912535_4913453_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010338390.1|4913540_4914164_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_159367771.1|4914160_4914424_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013054031.1|4914395_4915160_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	66.1	5.1e-87
WP_159367772.1|4915321_4915567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368119.1|4915584_4917216_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	45.0	1.9e-107
4915163:4916043	attR	CTCCATCCGTTCAATCTCCGCCAAGCATGCTCAAGCTTCACGATTTTTGCAACAGAGCCAGGTGGAGCACTACCTGCAGAACCATGAGCCCACCAGGCTTTGACGTACGCATCCGGTGAGGACCGCGGCTACTGACGGTTCGTTGCGGGATTTGGCATCTTATTTGCCGAGGAAGGTCTCGACGCCTTCTTGAGCGAGCACATCGCGGAACGCGGCGTCGGCATCGCGGTCGGTGGGGAATAGATTGTCCCAGACCGTCGAGGTGCCGTGCTCGTTGACGACCTCGAGGGACCAACCGCGCTCGGTGGCGAGCCGCACGATGTTGATGGTCAGCCGTACGCCCGCCTGTTCGATGGACCGGCAGAGAGAGGATTCAATCAGTTCGGGTTGCGGGCCAAATTCCATGCCGTGATGCTATGAGATCACGGCTCCAGCTTCAACGCTGTTGGTTTCCAATTCCATGGGAGTAGATCGCTAAGCCGATTAGCCGGATGACCGGCGATGCGGGCGAGGACGTCAGCGAGCCAGGCCTGGGGATCAACATCGTTGAGGCGACAGCTCTGGATGAGCGAGAACATGATGGCGGCGCGCTGGCCTCCGCGATCGGAGCCGCAGAATAACCATGCTTTCCGTCCGAGTGGCACGCAGCGCAGTGCTCGTTCCGCCGCGTTGTTCGTCATACAGACCCTTCCATCGGCGAGGAAGCGGGTGAAGGCTTCCCAGCGCCGGAGCATGTAGTTGATGGCCTTGGCGAGATCATGGTTTCGCGACAGCTTGGCGAGTTGGGCGTTCAACCAGTCGTGCAGTTCGGCGATCAACGGCGCGCTCAACTCCTGACGGACAGCCAGCCGCTCTGCTGCAGTTTTGCCGTTGATGCCTCG	NA	NA	NA	NA
WP_019052498.1|4917320_4917662_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	52.4	8.2e-29
WP_062788688.1|4917658_4918006_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_159366036.1|4918118_4919198_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP047220	Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence	65025	24677	60694	65025	transposase	Megavirus(16.67%)	31	NA	NA
WP_159368272.1|24677_25624_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	23.6	6.9e-09
WP_159368273.1|25764_26814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159368274.1|27298_28381_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	24.9	3.7e-14
WP_159368305.1|28481_29564_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	27.5	5.6e-15
WP_159368275.1|29591_29819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159368276.1|29946_31353_-	acyltransferase family protein	NA	A0A2H4J4A1	uncultured_Caudovirales_phage	23.4	6.2e-06
WP_159368277.1|31634_32915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368278.1|33437_34501_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159368279.1|34677_35973_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_159368280.1|35988_36918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368281.1|37141_38296_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	45.7	3.7e-97
WP_159368282.1|38324_39437_-	capsule biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_159368283.1|39433_40468_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	34.1	3.8e-37
WP_159368284.1|40515_42438_-	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	27.9	1.0e-19
WP_159368285.1|42547_44371_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	40.5	7.6e-113
WP_159368286.1|44435_44747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368287.1|45366_45618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368288.1|45709_46507_-	serine/threonine protein phosphatase	NA	K4JTY8	Caulobacter_virus	36.3	8.6e-29
WP_159368289.1|46578_47601_+	peptidase M48 family protein	NA	NA	NA	NA	NA
WP_159368290.1|47636_47900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159368291.1|48291_48657_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_159368292.1|49420_50572_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159368293.1|51124_51421_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_159368294.1|51417_51699_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_159368306.1|52018_52204_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159368295.1|52232_52655_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.6	2.9e-07
WP_015063481.1|52960_54064_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_159368296.1|54887_55523_+	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	52.6	5.2e-45
WP_159368297.1|55548_55830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159368298.1|55886_56798_-	RepB family plasmid replication initiator protein	NA	A0A1V0E006	Clostridioides_phage	32.3	4.0e-06
WP_006961814.1|57784_60694_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
