The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047286	Proteus cibarius strain G11 chromosome, complete genome	4006850	5163	59473	4006850	lysis,capsid,protease,tRNA,holin,head,terminase,tail,portal	Proteus_phage(55.56%)	54	NA	NA
WP_075673674.1|5163_5694_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	36.4	8.9e-06
WP_075673673.1|5801_6437_-	LysE family translocator	NA	NA	NA	NA	NA
WP_075673672.1|6915_7176_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	2.7e-16
WP_075673671.1|7217_7598_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_075673670.1|7597_8329_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_075673669.1|8398_9139_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_023581601.1|9148_10057_-	GTPase Era	NA	NA	NA	NA	NA
WP_075673668.1|10053_10734_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	46.2	9.6e-21
WP_075673667.1|10929_11901_-	signal peptidase I	NA	NA	NA	NA	NA
WP_075673666.1|11915_13712_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
WP_006533574.1|16180_16759_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_075673662.1|17054_17810_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_023581591.1|19608_19992_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	66.0	5.8e-31
WP_075673659.1|20326_21007_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.7	5.8e-58
WP_159364167.1|21880_22738_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_075673657.1|24599_24962_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_075673656.1|25168_25462_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006533588.1|25454_25889_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_075673655.1|26045_26528_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	3.3e-31
WP_159363432.1|27314_27689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364168.1|33954_34533_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	99.5	2.2e-103
WP_099660124.1|34612_35089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364169.1|35085_35808_-	peptidase P60	NA	A0A1P8DTI6	Proteus_phage	99.1	3.3e-136
WP_159363433.1|35813_36563_-|tail	phage minor tail protein L	tail	A0A1P8DTI3	Proteus_phage	98.8	5.8e-144
WP_159363434.1|36559_36892_-|tail	phage tail protein	tail	A0A1P8DTI9	Proteus_phage	97.3	1.8e-60
WP_159363435.1|36894_40134_-|tail	phage tail tape measure protein	tail	A0A1P8DTH2	Proteus_phage	95.7	0.0e+00
WP_159363436.1|40153_40435_-	DUF4035 domain-containing protein	NA	A0A1P8DTH5	Proteus_phage	90.4	5.0e-40
WP_159363437.1|40458_40839_-|tail	phage tail protein	tail	A0A1P8DTJ2	Proteus_phage	98.4	2.5e-63
WP_036913331.1|40841_41309_-	hypothetical protein	NA	A0A1P8DTJ5	Proteus_phage	100.0	1.3e-80
WP_159363438.1|41374_41710_-	hypothetical protein	NA	A0A1P8DTJ3	Proteus_phage	97.3	2.6e-56
WP_115349556.1|42144_42468_-|head	phage head closure protein	head	A0A1P8DTK6	Proteus_phage	99.1	6.3e-55
WP_159363439.1|42476_42803_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	99.1	2.2e-55
WP_159363440.1|42802_42997_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	97.9	1.3e-18
WP_159363441.1|43049_44264_-|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	98.5	5.2e-219
WP_159363442.1|44275_45127_-|protease	Clp protease ClpP	protease	A0A1P8DTI2	Proteus_phage	98.9	9.5e-151
WP_159363443.1|45131_46463_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	98.9	5.0e-255
WP_159363444.1|46462_48202_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	90.7	0.0e+00
WP_071233560.1|48204_48675_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	81.3	1.0e-69
WP_159363445.1|48822_49020_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	96.9	1.0e-28
WP_159363446.1|49016_49367_-	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	94.0	2.9e-61
WP_159363447.1|49432_49810_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	59.0	2.5e-31
WP_159363448.1|49799_50111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364170.1|50798_51173_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	42.3	4.5e-12
WP_075673907.1|51243_51822_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	66.7	1.5e-70
WP_159363449.1|52021_52441_-	structural protein	NA	A0A2R3UAM8	Myoviridae_environmental_samples	45.4	4.4e-24
WP_159363450.1|52433_52751_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	59.0	1.1e-30
WP_115350921.1|52990_53239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363451.1|53250_53493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363452.1|53614_54781_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	43.6	4.3e-85
WP_071425844.1|55021_55405_-	antitermination protein	NA	A0A088CD47	Shigella_phage	71.4	7.2e-50
WP_159363453.1|55404_56379_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	53.5	1.9e-102
WP_020946098.1|58202_58451_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	8.9e-17
WP_159363454.1|58443_58668_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_159363455.1|58762_59473_+	helix-turn-helix domain-containing protein	NA	A0A2R2X2B0	Escherichia_phage	64.4	8.9e-78
>prophage 2
NZ_CP047286	Proteus cibarius strain G11 chromosome, complete genome	4006850	286222	356297	4006850	protease,tRNA,integrase,plate	Morganella_phage(41.18%)	58	324229:324250	339111:339132
WP_159363498.1|286222_287560_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_075674252.1|287556_288225_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_075674253.1|288203_289943_+	OmpA family protein	NA	NA	NA	NA	NA
WP_023583757.1|289965_290457_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_159363499.1|290742_293454_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.5e-93
WP_159363500.1|293450_295979_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.0	5.9e-15
WP_159363501.1|295978_296746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363502.1|296906_297677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363503.1|297838_298423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363504.1|298687_300820_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	26.2	1.6e-45
WP_159363505.1|301255_301615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363506.1|301626_302745_+	hypothetical protein	NA	A0A077K801	Ralstonia_phage	30.1	7.6e-31
WP_159363507.1|302710_303736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075674106.1|303805_304060_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_159363508.1|304060_305458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363509.1|305457_308781_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_159363510.1|308826_310449_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_159363511.1|310481_312245_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_159363512.1|312208_313306_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_159364175.1|313280_313844_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_075674113.1|313846_314281_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_159363513.1|314360_315743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363514.1|315753_316374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364176.1|316789_317521_+	ankyrin repeat domain-containing protein	NA	A0A0G2Y7V3	Acanthamoeba_polyphaga_mimivirus	33.8	1.1e-06
WP_075674116.1|317664_317958_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_159363515.1|318477_319005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099659264.1|321184_321604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363516.1|321802_322312_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_159363517.1|322674_322983_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159363518.1|323128_323668_-	hypothetical protein	NA	NA	NA	NA	NA
324229:324250	attL	TCATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
WP_159364177.1|324662_324950_-	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	77.3	3.0e-32
WP_159363519.1|325811_326000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363520.1|326786_327203_+	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	80.3	7.8e-58
WP_159363521.1|327327_327987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363522.1|328497_329430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363523.1|329728_329932_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_159363524.1|330009_330468_-	osmoprotectant transporter ProQ	NA	A0A1W6JPI6	Morganella_phage	64.8	1.9e-17
WP_159363525.1|333581_333956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363526.1|333952_334162_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	75.4	1.8e-18
WP_159363527.1|334158_334338_-	hypothetical protein	NA	A0A1W6JPF0	Morganella_phage	62.0	1.1e-08
WP_159363528.1|334334_335201_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	45.7	1.6e-57
WP_064497270.1|335197_336004_-	antA/AntB antirepressor family protein	NA	A0A0P0ZDY7	Stx2-converting_phage	45.8	6.0e-22
WP_159363529.1|336016_336412_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	1.6e-28
WP_159363530.1|336411_336612_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_159363531.1|336833_337289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363532.1|337314_337656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363533.1|337868_339080_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.0	2.6e-130
WP_075673948.1|339513_340386_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
339111:339132	attR	TCATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
WP_075673947.1|340389_340602_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_075673946.1|341254_342196_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_075673945.1|342430_342874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075673944.1|342963_344355_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.3	4.7e-38
WP_036934689.1|344730_345225_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_075673943.1|345237_345960_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_075673939.1|349129_350155_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_159363534.1|352545_355014_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_075673936.1|355010_355697_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	1.6e-31
WP_075673935.1|355667_356297_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 3
NZ_CP047286	Proteus cibarius strain G11 chromosome, complete genome	4006850	1356935	1420981	4006850	lysis,capsid,protease,tRNA,holin,head,integrase,terminase,tail,portal,plate	Salmonella_phage(32.5%)	73	1374421:1374469	1404039:1404087
WP_036933349.1|1356935_1357439_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_159363673.1|1357442_1358453_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	32.2	1.4e-39
WP_159363674.1|1358479_1359646_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.4	5.0e-118
WP_159363675.1|1359706_1360108_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_159363676.1|1360104_1361316_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_159363677.1|1362445_1363546_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_159363678.1|1363558_1364566_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.8	2.0e-38
WP_159363679.1|1364567_1365644_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_159363680.1|1365660_1366710_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_159363681.1|1366693_1367770_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_159363682.1|1367766_1368693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363683.1|1368698_1369796_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_159363684.1|1369800_1371096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069366855.1|1371470_1372862_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.7	2.8e-19
WP_023583423.1|1372874_1373573_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	1.1e-06
WP_075673003.1|1373784_1374336_+	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
1374421:1374469	attL	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTTG	NA	NA	NA	NA
WP_064505896.1|1374618_1375599_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	62.9	5.7e-115
WP_116672651.1|1375665_1375959_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	59.8	2.5e-26
WP_049220107.1|1376088_1376361_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	56.7	1.6e-22
WP_036908539.1|1376362_1376551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363685.1|1376547_1376697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363686.1|1376705_1377101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006536692.1|1377118_1377376_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_109397523.1|1377368_1377590_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
WP_159363687.1|1377591_1378419_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.4	1.3e-59
WP_109397520.1|1378418_1378742_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_159363688.1|1378741_1381120_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.6	7.2e-164
WP_159363689.1|1381326_1382010_+	hypothetical protein	NA	A0A2H4JGK4	uncultured_Caudovirales_phage	28.1	2.9e-17
WP_159363690.1|1382011_1382194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363691.1|1383111_1384140_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	69.3	1.0e-135
WP_134736419.1|1384139_1385894_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.0	4.4e-259
WP_159363692.1|1386066_1386876_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	50.9	7.3e-68
WP_159363693.1|1386893_1388036_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	66.8	1.7e-123
WP_109849549.1|1388035_1388707_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.2	7.2e-45
WP_109397510.1|1388781_1389237_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.9	8.4e-29
WP_109397509.1|1389236_1389443_+|tail	phage tail protein	tail	S4TTA0	Salmonella_phage	54.4	9.0e-15
WP_109397508.1|1389462_1389777_+|holin	holin	holin	NA	NA	NA	NA
WP_159363694.1|1389769_1390201_+	M15 family peptidase	NA	A0A193GZ39	Escherichia_phage	56.5	1.3e-39
WP_159363695.1|1390197_1390701_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_159363696.1|1390675_1391116_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	47.1	3.5e-32
WP_159363697.1|1391102_1391738_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	2.0e-28
WP_159363698.1|1391803_1392430_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	60.3	4.5e-57
WP_159363699.1|1392426_1392765_+|plate	baseplate assembly protein	plate	F1BUP4	Erwinia_phage	50.0	6.4e-26
WP_159363700.1|1392766_1393675_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.6	2.1e-108
WP_159363701.1|1393667_1394279_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.9	1.4e-76
WP_159363702.1|1395923_1396277_+|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	43.7	2.8e-08
WP_159363703.1|1396369_1397542_+|tail	phage tail protein	tail	A0A1S6KZY7	Salmonella_phage	70.6	1.2e-164
WP_109397496.1|1397545_1398061_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	56.7	8.5e-54
WP_159363704.1|1398080_1398428_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.7	1.3e-18
WP_075204427.1|1398388_1398562_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	50.9	1.6e-09
WP_159363705.1|1398554_1401416_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	42.6	3.9e-124
WP_036907694.1|1401415_1401880_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_159363706.1|1401879_1402977_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	54.3	1.1e-111
WP_159363707.1|1403029_1403248_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	68.8	1.1e-18
WP_159363708.1|1403294_1403498_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	6.6e-10
WP_081353461.1|1403682_1403916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363709.1|1404114_1404900_-	glycosyltransferase LpsA	NA	A0A1V0SBR2	Catovirus	31.0	1.3e-05
1404039:1404087	attR	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTTG	NA	NA	NA	NA
WP_159363710.1|1404970_1406125_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_109419649.1|1406338_1407094_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_075673000.1|1407627_1408605_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_159242284.1|1408868_1409870_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069366847.1|1409975_1410746_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_075672998.1|1410852_1411488_-	DUF1454 family protein	NA	NA	NA	NA	NA
WP_075672997.1|1411585_1412017_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_075672996.1|1412082_1412829_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_075672995.1|1413167_1414352_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	5.8e-13
WP_075672994.1|1414453_1415986_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_099659466.1|1416028_1416844_-	aquaporin	NA	M1HBN0	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-16
WP_036933299.1|1417138_1417381_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_075672992.1|1417475_1417979_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_075672991.1|1418088_1419006_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_075672990.1|1419103_1420438_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	27.3	1.1e-41
WP_006534149.1|1420450_1420981_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 4
NZ_CP047286	Proteus cibarius strain G11 chromosome, complete genome	4006850	2376786	2387626	4006850		Mycobacterium_phage(22.22%)	12	NA	NA
WP_075671546.1|2376786_2377986_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.6	2.4e-27
WP_075671548.1|2378609_2379578_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.8	7.5e-136
WP_159363844.1|2379602_2381729_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	50.4	1.6e-202
WP_159363845.1|2381734_2382154_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.4	1.8e-09
WP_075671554.1|2382165_2382390_-	glutaredoxin family protein	NA	V5UN81	Mycobacterium_phage	45.7	7.8e-12
WP_075671556.1|2382673_2383147_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	35.8	5.0e-16
WP_023581133.1|2383344_2383554_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	4.5e-22
WP_023581134.1|2383691_2384066_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.0	2.5e-23
WP_075671558.1|2384079_2385045_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_075671560.1|2385145_2385790_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036912266.1|2385950_2386214_-	YbeD family protein	NA	NA	NA	NA	NA
WP_075671562.1|2386414_2387626_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.1	2.3e-102
>prophage 5
NZ_CP047286	Proteus cibarius strain G11 chromosome, complete genome	4006850	2423482	2460765	4006850	holin,head,integrase,terminase	Proteus_phage(24.32%)	53	2423399:2423417	2464354:2464372
2423399:2423417	attL	CTTATTGGATTATAGTGGG	NA	NA	NA	NA
WP_159363848.1|2423482_2424484_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	43.4	1.4e-68
WP_159363849.1|2424440_2424686_-	excisionase	NA	NA	NA	NA	NA
WP_159363850.1|2425118_2425664_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	60.3	1.1e-56
WP_036935799.1|2425824_2426085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363851.1|2426074_2426344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036970032.1|2426536_2426839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334496.1|2426877_2427060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363852.1|2427127_2427541_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	67.4	8.9e-46
WP_159363853.1|2427530_2428229_-	exonuclease	NA	A0A2L1IV73	Escherichia_phage	57.0	2.6e-74
WP_159363854.1|2428225_2429152_-	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.2	2.0e-109
WP_087802156.1|2429148_2429370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363855.1|2429366_2429630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047887.1|2429846_2430200_-	hypothetical protein	NA	A0A249XWT3	Proteus_phage	50.9	3.9e-18
WP_159363856.1|2430514_2430790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363857.1|2430951_2431455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363858.1|2431478_2431751_-	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	98.9	5.7e-41
WP_159363859.1|2432289_2432697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364197.1|2432723_2433401_-	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	55.9	1.6e-55
WP_109391285.1|2433479_2433707_+	DNA-binding protein	NA	G9L677	Escherichia_phage	68.0	2.9e-22
WP_109391284.1|2433837_2434179_+	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	91.9	2.7e-48
WP_129037626.1|2434434_2435271_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	56.8	2.1e-78
WP_159364198.1|2435274_2436642_+	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	63.8	2.5e-161
WP_159363860.1|2436638_2436905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363861.1|2437371_2437815_+	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	94.6	6.4e-34
WP_159363862.1|2437811_2438474_+	serine/threonine-protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	60.9	2.8e-73
WP_159363863.1|2438470_2438614_+	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	89.4	8.7e-17
WP_159363864.1|2438585_2439179_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	98.5	2.2e-101
WP_159363865.1|2439168_2439360_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	96.8	1.7e-28
WP_159363866.1|2439633_2439996_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	42.4	2.5e-15
WP_159363867.1|2440284_2440602_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	61.9	5.6e-32
WP_159363868.1|2440594_2440987_+	M15 family peptidase	NA	A0A1P8DTE2	Proteus_phage	98.9	5.1e-51
WP_159363869.1|2440983_2441361_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	31.7	3.1e-05
WP_082147394.1|2441604_2441820_+	hypothetical protein	NA	A0A2I7RH69	Vibrio_phage	48.6	1.1e-10
WP_159363870.1|2442249_2443269_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	34.4	7.1e-36
WP_159363871.1|2443466_2444867_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.7	5.1e-85
WP_159363872.1|2444868_2446368_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	45.3	4.5e-103
WP_159364199.1|2446405_2447119_+|head	phage head morphogenesis protein	head	Q6IWU3	Burkholderia_phage	40.5	4.1e-38
WP_109397954.1|2448874_2449942_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	38.9	1.3e-51
WP_159363873.1|2450011_2450353_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.4	4.7e-08
WP_099660761.1|2450355_2450787_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.7	5.7e-11
WP_159363874.1|2450786_2451245_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	38.6	8.5e-13
WP_159363875.1|2451244_2451616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363876.1|2451602_2452118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363877.1|2452126_2453614_+	DUF3383 family protein	NA	A0A088C3U1	Shewanella_sp._phage	37.7	2.5e-82
WP_159363878.1|2453624_2454077_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.8	1.2e-22
WP_159363879.1|2454116_2454575_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	3.0e-26
WP_159363880.1|2454660_2456922_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	31.3	5.8e-22
WP_159363881.1|2456923_2457454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363882.1|2457450_2457768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363883.1|2457736_2458549_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	1.8e-10
WP_159363884.1|2458551_2459244_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	1.6e-34
WP_159363885.1|2459240_2459585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109397942.1|2459577_2460765_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	38.2	1.4e-72
2464354:2464372	attR	CTTATTGGATTATAGTGGG	NA	NA	NA	NA
>prophage 6
NZ_CP047286	Proteus cibarius strain G11 chromosome, complete genome	4006850	2957192	2967792	4006850	tRNA	Tupanvirus(50.0%)	10	NA	NA
WP_099659660.1|2957192_2959121_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	3.9e-128
WP_036937410.1|2959124_2959664_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.7e-15
WP_004263702.1|2959758_2959956_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006537111.1|2959998_2960355_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_120655563.1|2960463_2960511_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_023582383.1|2960686_2961670_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	4.9e-34
WP_075673356.1|2961684_2964072_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.4	3.5e-09
WP_023582381.1|2964076_2964373_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_099659661.1|2964752_2965763_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_099659662.1|2966646_2967792_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.8	3.5e-39
>prophage 7
NZ_CP047286	Proteus cibarius strain G11 chromosome, complete genome	4006850	3627166	3681785	4006850	capsid,tRNA,holin,head,terminase,tail,portal	Cronobacter_phage(62.5%)	53	NA	NA
WP_075674055.1|3627166_3628546_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	81.9	3.0e-178
WP_075674056.1|3628842_3629736_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_006533078.1|3629785_3630835_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_075674057.1|3630898_3631696_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_099660599.1|3632528_3633164_+	phospholipid:lipid A palmitoyltransferase	NA	NA	NA	NA	NA
WP_075674059.1|3633277_3634660_-	amino acid permease	NA	NA	NA	NA	NA
WP_006533085.1|3635325_3635712_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075674060.1|3635839_3636646_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_159241983.1|3636948_3638295_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_075674062.1|3638405_3639245_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	30.9	3.8e-11
WP_075674063.1|3639344_3640817_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_075674064.1|3642160_3642394_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	65.6	1.7e-14
WP_075674065.1|3642496_3642886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069367593.1|3642982_3643165_-	YoaH family protein	NA	NA	NA	NA	NA
WP_159364084.1|3643277_3644663_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	37.4	1.0e-37
WP_075674067.1|3644649_3645213_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_006533102.1|3647452_3648040_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_109418890.1|3648122_3648938_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_023581865.1|3649085_3649499_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_075674135.1|3649734_3650181_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	32.0	3.2e-09
WP_075674136.1|3650436_3651021_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	32.9	8.6e-10
WP_075674137.1|3651094_3651913_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_159364085.1|3656176_3657040_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	53.9	1.2e-87
WP_159364086.1|3657043_3657628_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.1	1.9e-41
WP_159364087.1|3657599_3658322_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	31.5	1.4e-33
WP_159364088.1|3658324_3660262_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	59.2	3.7e-110
WP_159364089.1|3660265_3660823_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	64.1	2.8e-66
WP_159364090.1|3660815_3662000_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	65.1	5.5e-149
WP_036935273.1|3661989_3662325_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.0	2.9e-31
WP_159364091.1|3662336_3664853_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	46.9	3.6e-129
WP_036935269.1|3665040_3665310_-	phage gene	NA	A5X9I7	Aeromonas_virus	49.4	9.6e-17
WP_159364092.1|3665418_3665793_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.2	3.3e-23
WP_159364093.1|3665792_3666125_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_036935263.1|3666121_3666415_-|holin	holin	holin	C7BGD7	Burkholderia_phage	52.9	1.1e-16
WP_036907273.1|3666432_3666885_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	62.6	1.2e-48
WP_159364094.1|3666884_3668003_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	64.9	6.9e-133
WP_159364095.1|3668017_3668716_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	58.9	2.9e-65
WP_060557611.1|3668712_3669201_-|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	26.6	1.6e-06
WP_159364096.1|3669197_3669689_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	53.3	2.6e-36
WP_159364097.1|3669748_3670453_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.0	2.5e-64
WP_159364098.1|3670458_3671490_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	69.5	1.8e-132
WP_159364099.1|3671505_3672351_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	44.3	2.9e-51
WP_159364100.1|3674369_3675341_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	65.6	1.5e-128
WP_036935239.1|3675337_3675646_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	60.4	3.7e-28
WP_159364101.1|3675669_3675831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364102.1|3676149_3678246_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	50.0	2.1e-207
WP_159364103.1|3678342_3678921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364104.1|3678988_3679246_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_159364105.1|3679322_3679670_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	41.8	1.2e-16
WP_159364106.1|3679681_3680110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364107.1|3680274_3680784_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	49.7	1.3e-38
WP_159364108.1|3680816_3681047_-	regulator	NA	NA	NA	NA	NA
WP_159364109.1|3681194_3681785_+	phage repressor protein	NA	F1BUN8	Cronobacter_phage	33.1	8.6e-26
>prophage 8
NZ_CP047286	Proteus cibarius strain G11 chromosome, complete genome	4006850	3816308	3822702	4006850	holin,lysis	Burkholderia_phage(28.57%)	8	NA	NA
WP_075674210.1|3816308_3816767_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.6	7.4e-25
WP_075674211.1|3816829_3817282_-	hypothetical protein	NA	B5M9T3	Pseudomonas_phage	33.8	1.1e-12
WP_075674212.1|3817292_3818780_-	DUF3383 domain-containing protein	NA	Q6IWV2	Burkholderia_phage	30.8	1.9e-58
WP_159241950.1|3818788_3819301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075674214.1|3819396_3819846_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	31.1	4.3e-09
WP_075674215.1|3819842_3820247_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	4.5e-26
WP_075674216.1|3820239_3820548_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	55.4	3.1e-27
WP_075674218.1|3821964_3822702_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	46.3	1.8e-57
>prophage 1
NZ_CP047288	Proteus cibarius strain G11 plasmid p152, complete sequence	152824	7885	61250	152824	transposase,integrase	Escherichia_phage(20.0%)	56	10924:10940	62174:62190
WP_000267723.1|7885_9994_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001029679.1|9980_10802_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
10924:10940	attL	TTGTCCGCCCACAATGA	NA	NA	NA	NA
WP_048821757.1|11070_12024_-|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.2	9.6e-27
WP_159364220.1|12317_12602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547991.1|12641_12896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547954.1|12970_13174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071547955.1|13653_13797_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_071547956.1|14312_15227_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_071547957.1|15230_15518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071547958.1|15521_17453_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_159364221.1|17445_18717_-	hypothetical protein	NA	Q6NE04	Leptospira_phage	36.8	6.3e-66
WP_001067855.1|18717_19422_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000612791.1|19652_20516_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|20553_20799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015058183.1|20928_21177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|21267_22059_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000800531.1|23238_23571_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|23740_24532_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|24624_25884_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|26145_26937_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|26994_27603_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|27698_28541_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000845048.1|28707_29721_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|29923_30274_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|30399_30960_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_159364222.1|30962_33914_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_046788546.1|33922_34324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|34408_35113_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|36037_36922_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|37138_38353_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|38380_38686_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|38797_40291_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|40321_40573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|40466_40769_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|40855_41671_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_085940648.1|41760_42850_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_006581703.1|43047_43533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|45343_46096_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|46517_47543_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|47771_48548_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_063840321.1|49508_50063_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|50193_51024_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|51161_51794_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|51878_52331_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|52553_52901_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|52894_53734_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_159364223.1|53861_54362_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067855.1|55159_55864_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|56088_56292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|56419_57259_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|57252_57600_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|57763_58555_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000777554.1|58571_59045_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_070342364.1|59041_59887_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_000071896.1|60272_60809_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|60923_61250_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
62174:62190	attR	TTGTCCGCCCACAATGA	NA	NA	NA	NA
>prophage 2
NZ_CP047288	Proteus cibarius strain G11 plasmid p152, complete sequence	152824	135068	145052	152824	transposase	Escherichia_phage(50.0%)	8	NA	NA
WP_038999265.1|135068_135644_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.2	4.9e-26
WP_001118645.1|136118_137042_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
WP_089617520.1|137195_138402_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_032306837.1|138543_139170_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.5	1.1e-79
WP_033550846.1|139172_140000_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	37.9	2.7e-17
WP_159364227.1|140038_142462_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	45.5	5.4e-199
WP_159364228.1|142544_143192_+	hypothetical protein	NA	A0A077SLS7	Escherichia_phage	33.8	4.1e-13
WP_159364229.1|143384_145052_+	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	28.3	1.7e-39
