The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	2663	46500	4820620	tail,portal,capsid,head,holin,lysis,protease,integrase	Enterobacteria_phage(40.62%)	65	23638:23652	48457:48471
WP_040078671.1|2663_3407_-|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.2	4.3e-147
WP_047083320.1|3417_4116_-|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	5.2e-131
WP_000847280.1|4115_4445_-|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_137528191.1|4441_7021_-|tail	phage tail tape measure protein	tail	S5MBY3	Escherichia_phage	85.4	0.0e+00
WP_000533402.1|7001_7415_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479116.1|7441_7873_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000235046.1|7886_8639_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	1.0e-132
WP_000683079.1|8646_9042_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_024213759.1|9038_9614_-|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	9.8e-51
WP_001204554.1|9629_9983_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201501.1|9975_10359_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522591.1|10409_11438_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|11495_11843_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_001253979.1|11879_13385_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_040078097.1|13374_14967_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.5e-186
WP_000259002.1|14963_15170_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_040078692.1|17052_17559_-	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	3.7e-33
WP_001109015.1|18269_18812_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	100.0	1.1e-99
WP_032209690.1|19013_19451_-|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_032209664.1|19453_19603_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	81.6	2.1e-13
WP_032209662.1|19602_20169_-	antirepressor	NA	A0A0H4IQ87	Shigella_phage	97.9	1.7e-103
WP_032209661.1|20442_20976_-	lysozyme	NA	A0A088CC28	Shigella_phage	99.4	1.3e-102
WP_000284506.1|20980_21196_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_032209659.1|21690_23655_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	78.5	2.5e-295
23638:23652	attL	ATAGTATTTAAATGT	NA	NA	NA	NA
WP_032209658.1|23898_24222_+	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	99.1	7.7e-61
WP_032209657.1|24518_24788_-	Shiga toxin Stx2d subunit B	NA	Q5TJL5	Enterobacteria_phage	98.9	1.3e-42
WP_033801441.1|24799_25759_-	Shiga toxin Stx2d subunit A	NA	Q6DWN9	Enterobacteria_phage	99.7	1.1e-174
WP_033801428.1|26141_26294_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	98.0	1.2e-19
WP_001204883.1|26542_26977_-	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	99.3	2.4e-81
WP_033801429.1|26969_27164_-	protein ninH	NA	A0A088CC23	Shigella_phage	98.4	2.7e-29
WP_033801430.1|27163_27526_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	98.3	3.5e-62
WP_000002243.1|27522_27813_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_033801431.1|27812_28535_-	DNA-binding protein	NA	Q4A1A3	Enterobacteria_phage	98.3	1.0e-129
WP_000835350.1|28609_29533_-	antirepressor protein	NA	A5VW58	Enterobacteria_phage	92.8	1.1e-163
WP_000335901.1|30254_31304_-	hypothetical protein	NA	Q8HA04	Enterobacteria_phage	100.0	1.7e-181
WP_033801433.1|31485_32013_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	98.3	3.1e-99
WP_000814577.1|32009_32456_-	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	99.3	2.1e-80
WP_001281772.1|32412_32649_-	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000103679.1|32659_32875_-	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001000127.1|33006_33285_-	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000145931.1|33355_33646_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788839.1|33642_34344_-	Replication protein P	NA	Q6H9X6	Enterobacteria_phage	100.0	4.5e-130
WP_000185456.1|34340_35279_-	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_137528175.1|35311_35608_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	99.0	4.4e-47
WP_000064148.1|35746_35980_-	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	100.0	8.0e-36
WP_000428098.1|36093_36798_+	helix-turn-helix transcriptional regulator	NA	A0A0P0ZE37	Stx2-converting_phage	100.0	1.1e-133
WP_137528176.1|36858_37200_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	98.2	1.2e-61
WP_001207140.1|37270_37705_+	hypothetical protein	NA	A4KWT5	Enterobacteria_phage	100.0	1.2e-77
WP_001278657.1|37701_38322_+	hypothetical protein	NA	A4KWT4	Enterobacteria_phage	99.5	6.2e-51
WP_001479835.1|38792_39176_+	hypothetical protein	NA	A0A0P0ZBT9	Stx2-converting_phage	100.0	2.3e-64
WP_000167595.1|39234_39705_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000776961.1|39848_40160_+	superinfection exclusion protein	NA	A0A0N7BTN9	Escherichia_phage	98.1	4.6e-55
WP_001198861.1|40232_40397_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|40365_40509_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_000995439.1|40583_40880_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_032168747.1|40885_41671_+	phage recombination protein Bet	NA	A0A0N7C1T0	Escherichia_phage	100.0	9.7e-150
WP_000186866.1|41667_42348_+	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000682315.1|42344_42527_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000548531.1|42499_42691_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001447493.1|42701_42983_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000763383.1|43081_43303_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_000457723.1|44526_44769_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_033801438.1|44772_44907_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.2	6.0e-20
WP_001193437.1|44925_45180_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_033801439.1|45213_46500_+|integrase	site-specific integrase	integrase	H6WZF6	Escherichia_phage	99.5	3.8e-252
48457:48471	attR	ACATTTAAATACTAT	NA	NA	NA	NA
>prophage 2
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	424388	434890	4820620		Escherichia_phage(55.56%)	11	NA	NA
WP_001141322.1|424388_425045_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|425095_425863_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847979.1|426058_426967_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	3.0e-118
WP_000590403.1|426963_428226_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|428222_428861_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136925.1|428865_429642_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104459.1|429730_431095_+	GntP family transporter	NA	NA	NA	NA	NA
WP_159394827.1|431188_432010_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	2.9e-32
WP_001272590.1|432229_433369_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|433508_434135_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|434128_434890_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 3
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	712025	759501	4820620	transposase,integrase	Escherichia_phage(18.75%)	35	719579:719610	775255:775286
WP_001562954.1|712025_712946_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	39.5	2.5e-40
WP_000168284.1|712994_713555_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	61.1	7.1e-54
WP_000805406.1|713570_713774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159394836.1|713864_714332_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_159394837.1|715010_717053_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	32.7	4.1e-43
WP_001135462.1|717055_717760_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_159394838.1|717805_718690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159394839.1|719090_719372_+	hypothetical protein	NA	NA	NA	NA	NA
719579:719610	attL	GTAAGCGTAAACTGACCGCCGTATGTAGCCAT	NA	NA	NA	NA
WP_000435660.1|719664_720090_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
WP_000624701.1|720086_720437_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_044186286.1|720467_722081_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	4.0e-166
WP_137524217.1|722429_723674_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_137524216.1|723691_724159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137524215.1|724162_724576_-	hypothetical protein	NA	G9L661	Escherichia_phage	86.5	4.7e-55
WP_159394840.1|724590_725199_-	DUF2857 family protein	NA	NA	NA	NA	NA
WP_137524218.1|725195_725921_-	DUF2786 domain-containing protein	NA	A0A219VHD3	Ochrobactrum_phage	27.4	7.1e-06
WP_044705516.1|725913_727647_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_086218508.1|727646_729014_-	replicative DNA helicase	NA	O80281	Escherichia_phage	54.6	9.6e-121
WP_001562671.1|729006_729357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137526749.1|729361_730264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137526751.1|730499_730709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001562674.1|731041_731929_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033801469.1|732265_733528_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	2.6e-80
WP_000344106.1|733979_737495_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_085947917.1|737891_739165_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_159394841.1|739409_740687_+	hemagglutinin	NA	B0FIT1	Escherichia_phage	39.4	8.4e-10
WP_001238642.1|741116_741692_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000483811.1|742069_742297_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|745124_746397_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000345347.1|747974_749231_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705928.1|749243_749531_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000916811.1|749546_749990_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416157.1|750260_751292_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000593013.1|752660_754505_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	31.3	8.1e-14
WP_085947917.1|758228_759501_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
775255:775286	attR	ATGGCTACATACGGCGGTCAGTTTACGCTTAC	NA	NA	NA	NA
>prophage 4
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	1534154	1541674	4820620	transposase	Stx2-converting_phage(33.33%)	8	NA	NA
WP_001328257.1|1534154_1535084_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	38.1	1.4e-51
WP_000745631.1|1535537_1535636_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001237092.1|1535657_1535912_+|transposase	transposase	transposase	S5WIU1	Leptospira_phage	60.3	3.5e-16
WP_032142224.1|1536805_1537177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001189111.1|1537485_1538994_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000435660.1|1539257_1539683_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
WP_000624701.1|1539679_1540030_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_044186286.1|1540060_1541674_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	4.0e-166
>prophage 5
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	2129575	2193950	4820620	transposase	Enterobacteria_phage(45.45%)	43	NA	NA
WP_085947917.1|2129575_2130848_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_033801589.1|2131767_2131866_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_001315616.1|2131867_2132650_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|2132952_2133873_+	ribokinase	NA	NA	NA	NA	NA
WP_000998353.1|2133900_2135217_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000107474.1|2135228_2136242_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_062871511.1|2136661_2136946_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	8.6e-24
WP_000345347.1|2137162_2138419_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705928.1|2138431_2138719_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_085947770.1|2139028_2140397_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000916809.1|2140394_2140625_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_000416157.1|2140895_2141927_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	8.0e-19
WP_000198472.1|2142766_2143996_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_000091658.1|2143992_2144724_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_000020242.1|2144723_2145188_-	3-hydroxy-fatty acyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_137528085.1|2145184_2146354_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_000597708.1|2146355_2146940_-	DUF3261 domain-containing protein	NA	NA	NA	NA	NA
WP_000180199.1|2146936_2149255_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_000670566.1|2149223_2149829_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000930894.1|2149825_2150248_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000115632.1|2150251_2151928_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_001323876.1|2151918_2152272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001077064.1|2152258_2153617_-	acyl-CoA synthetase	NA	NA	NA	NA	NA
WP_001442994.1|2153613_2154195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132059.1|2154199_2154451_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_001148680.1|2154462_2154720_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_001499180.1|2154694_2155516_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_001442995.1|2155512_2156235_-	beta-ketoacyl synthase chain length factor	NA	NA	NA	NA	NA
WP_000273203.1|2156275_2157334_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000833174.1|2157398_2157788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|2165112_2166225_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000821922.1|2167130_2168399_+	TolC family protein	NA	NA	NA	NA	NA
WP_000835435.1|2168403_2170551_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	27.4	7.7e-24
WP_001368290.1|2170610_2171858_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_159394863.1|2172142_2184517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000525231.1|2184594_2186463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700771.1|2186726_2187929_+	hypothetical protein	NA	Q9MCI8	Enterobacteria_phage	62.2	3.9e-41
WP_000935975.1|2188056_2188263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165713.1|2188325_2188802_+	LuxR family transcriptional regulator	NA	Q9LA52	Enterobacteria_phage	45.8	2.0e-28
WP_085949152.1|2189033_2190306_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000422741.1|2191533_2191959_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|2191955_2192306_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_033801454.1|2192336_2193950_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	3.4e-181
>prophage 6
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	2204736	2260848	4820620	transposase,tRNA,integrase	Stx2-converting_phage(20.0%)	53	2213560:2213574	2246929:2246943
WP_135402100.1|2204736_2204907_-|transposase	transposase	transposase	A0A1B0Z042	Pseudomonas_phage	52.7	2.7e-09
WP_000878009.1|2205672_2206692_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071525616.1|2206833_2207025_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001367505.1|2207006_2207264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001498920.1|2207437_2207653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094250091.1|2207850_2209057_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	3.9e-97
WP_033801582.1|2209224_2209482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000401037.1|2209550_2211248_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_001228923.1|2211342_2212479_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.3	1.4e-117
2213560:2213574	attL	CACCGGAAGTCTTCC	NA	NA	NA	NA
WP_040078340.1|2214624_2215362_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|2215677_2216950_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_024165538.1|2217423_2217804_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
WP_000612591.1|2217800_2218148_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_159394864.1|2218197_2219742_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.4	3.7e-294
WP_000147021.1|2220434_2221478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218780.1|2221733_2222999_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	7.6e-80
WP_001188520.1|2223378_2223954_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_159394865.1|2223990_2225688_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|2225663_2226002_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|2226117_2227419_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|2227536_2228973_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|2229309_2229786_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|2229801_2231058_-	L-methionine/branched-chain amino acid exporter YjeH	NA	NA	NA	NA	NA
WP_001026276.1|2231333_2231627_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2231670_2233317_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|2233454_2233808_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008040.1|2234010_2234880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940549.1|2235274_2236303_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|2236344_2236911_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|2236962_2237088_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|2237198_2237345_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|2237520_2237838_+	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
WP_001238378.1|2237834_2238368_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001336292.1|2238456_2239590_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|2239652_2240012_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|2240022_2240418_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|2240428_2241163_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192973.1|2241155_2242964_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|2243288_2244266_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_159394866.1|2244484_2245987_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000342867.1|2246038_2246353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276180.1|2246349_2246664_+	YjeO family protein	NA	NA	NA	NA	NA
WP_001236847.1|2246692_2250016_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
2246929:2246943	attR	GGAAGACTTCCGGTG	NA	NA	NA	NA
WP_000934920.1|2250037_2251006_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041964.1|2251102_2252155_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|2252249_2252795_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|2253537_2253591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|2253573_2254713_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001295189.1|2254711_2256259_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|2256230_2256692_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990333.1|2256710_2258048_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|2258057_2259905_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|2259897_2260848_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	2366468	2373027	4820620	transposase	Rhizobium_phage(16.67%)	7	NA	NA
WP_000594911.1|2366468_2367293_+	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000227281.1|2367341_2367914_-	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000747102.1|2368014_2368365_+|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_001254876.1|2368284_2369436_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000177060.1|2370487_2370745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|2371302_2372070_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|2372070_2373027_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
>prophage 8
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	2802953	2855296	4820620	capsid,transposase	Escherichia_phage(42.86%)	38	NA	NA
WP_044186286.1|2802953_2804567_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	4.0e-166
WP_089585588.1|2805368_2805566_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	67.6	2.8e-05
WP_033801591.1|2807245_2807704_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	2.1e-11
WP_033801592.1|2808931_2809687_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	43.2	4.5e-43
WP_001380818.1|2814198_2814426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801596.1|2815254_2815779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001544461.1|2816662_2816899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001544462.1|2817304_2817883_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000555344.1|2817887_2818847_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_000377254.1|2819346_2819841_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_136747666.1|2819893_2820079_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033801593.1|2820123_2820414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077774619.1|2820452_2821334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072033197.1|2821337_2821520_-	rubredoxin	NA	NA	NA	NA	NA
WP_001544468.1|2821512_2821719_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_000334881.1|2822878_2823151_+	hydrogenase 3 maturation protein HypC	NA	NA	NA	NA	NA
WP_001212982.1|2823150_2824272_+	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_040077633.1|2824268_2825228_+	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_001544480.1|2833175_2833388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001544483.1|2834771_2835470_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001544484.1|2835474_2836890_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102091.1|2836900_2837620_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000544015.1|2837669_2839226_-	L-lactate permease	NA	NA	NA	NA	NA
WP_039002503.1|2841636_2842749_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000587091.1|2842799_2842955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137528131.1|2843248_2843644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001544489.1|2844432_2844780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001317493.1|2846098_2846881_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_033801556.1|2846877_2847900_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	5.0e-199
WP_001449594.1|2848052_2848217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801555.1|2848308_2849049_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_033801554.1|2849038_2849968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|2850429_2851703_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_077774627.1|2852439_2852676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801629.1|2852668_2853007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801630.1|2853676_2853892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801631.1|2853888_2854248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801632.1|2854264_2855296_+|capsid	phage capsid E family protein	capsid	NA	NA	NA	NA
>prophage 9
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	3463933	3481114	4820620	portal,capsid,head,terminase,protease,transposase,integrase	uncultured_Caudovirales_phage(83.33%)	22	3457886:3457902	3467615:3467631
3457886:3457902	attL	TTGCGTGATGCCCGTTT	NA	NA	NA	NA
WP_047083650.1|3463933_3465172_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.7	1.8e-126
WP_024213440.1|3465581_3465776_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	7.7e-16
WP_159394876.1|3465869_3466592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000226784.1|3466579_3466777_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_159394877.1|3466769_3467234_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_047083146.1|3467226_3467454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039060797.1|3467459_3467759_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
3467615:3467631	attR	TTGCGTGATGCCCGTTT	NA	NA	NA	NA
WP_001672401.1|3467755_3469888_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.1	3.1e-174
WP_047083326.1|3470260_3470512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064579075.1|3470508_3470919_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_064579076.1|3470929_3471202_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001475695.1|3471490_3472648_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.6e-137
WP_001450925.1|3472703_3473261_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.2e-61
WP_122994292.1|3473298_3474474_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	80.2	1.1e-184
WP_001020674.1|3474470_3474809_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000137526.1|3474805_3475099_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	63.9	1.4e-32
WP_001145905.1|3475098_3475539_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_039002503.1|3475905_3477018_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_159394878.1|3477186_3477534_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	80.7	1.9e-49
WP_000127882.1|3477517_3479179_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.2	5.7e-277
WP_062881264.1|3479192_3479474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|3480793_3481114_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 10
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	3878748	3953043	4820620	tail,portal,capsid,head,holin,lysis,tRNA,transposase,integrase	Escherichia_phage(41.67%)	84	3920643:3920665	3947884:3947906
WP_022581818.1|3878748_3879867_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.3	2.1e-81
WP_000003742.1|3879835_3880105_-	excisionase	NA	NA	NA	NA	NA
WP_022581375.1|3880166_3882569_-	exonuclease	NA	V5UQJ3	Shigella_phage	57.9	8.3e-176
WP_022581374.1|3882661_3882850_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|3882846_3883035_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_028985920.1|3883819_3884188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380321.1|3884199_3884352_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	1.9e-06
WP_001444087.1|3884623_3884911_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001090455.1|3884914_3885103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444086.1|3885132_3885540_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000548554.1|3885647_3885926_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	41.0	9.7e-12
WP_000705386.1|3885909_3886431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054520.1|3886411_3887377_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	5.0e-55
WP_000790459.1|3887383_3888124_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.1	6.2e-114
WP_064506729.1|3888153_3888915_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	5.3e-76
WP_000017341.1|3888911_3889229_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	75.0	1.4e-35
WP_053294093.1|3889225_3889531_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	92.1	1.7e-49
WP_022581296.1|3889678_3889861_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	93.3	3.8e-25
WP_001289995.1|3890026_3890542_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	9.5e-37
WP_001398985.1|3890775_3890988_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	67.1	6.4e-16
WP_032212035.1|3891154_3891427_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.9e-12
WP_159394885.1|3891428_3892475_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	3.0e-106
WP_000904153.1|3892487_3892847_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.7	5.6e-36
WP_000640044.1|3892855_3893416_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	5.6e-67
WP_000917750.1|3893633_3893831_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_137533926.1|3893981_3895040_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	92.0	5.2e-191
WP_159394886.1|3895899_3897864_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	78.3	7.2e-295
WP_000284510.1|3898358_3898574_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_040077999.1|3898578_3899112_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	4.8e-100
WP_097413197.1|3899385_3899958_+	hypothetical protein	NA	A0A088CD55	Shigella_phage	87.9	2.0e-96
WP_123005786.1|3899957_3900104_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	84.8	4.7e-10
WP_032209690.1|3900106_3900544_+|lysis	lysis protein	lysis	A0A0P0ZFH2	Escherichia_phage	97.9	4.7e-69
WP_024193020.1|3900743_3901262_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	99.4	5.5e-93
WP_040078692.1|3902099_3902606_+	DNA-packaging protein	NA	O64316	Escherichia_phage	47.9	3.7e-33
WP_000259002.1|3904488_3904695_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_040078097.1|3904691_3906284_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	4.5e-186
WP_001253979.1|3906273_3907779_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.0e-99
WP_000256823.1|3907815_3908163_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|3908220_3909249_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201501.1|3909300_3909684_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|3909676_3910030_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_024213759.1|3910045_3910621_+|tail	tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	9.8e-51
WP_137533907.1|3910617_3911013_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	84.0	1.4e-59
WP_137533908.1|3911020_3911773_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	94.4	1.4e-129
WP_001563055.1|3911786_3912209_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.1	1.4e-70
WP_040078669.1|3912235_3912649_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	84.2	4.9e-44
WP_159394887.1|3912629_3915242_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	90.7	0.0e+00
WP_000847280.1|3915238_3915568_+|tail	phage tail protein	tail	S5MW28	Escherichia_phage	99.1	1.2e-58
WP_047083320.1|3915567_3916266_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.8	5.2e-131
WP_040078671.1|3916276_3917020_+|tail	phage tail protein	tail	S5MQI8	Escherichia_phage	97.2	4.3e-147
WP_159394888.1|3917795_3921263_+	DUF1983 domain-containing protein	NA	S5MW25	Escherichia_phage	98.6	0.0e+00
3920643:3920665	attL	TTCATGAACGACGTGTTCCTGAA	NA	NA	NA	NA
WP_000078853.1|3921461_3921602_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	95.7	2.9e-17
WP_052920791.1|3921746_3923474_+|tail	phage tail protein	tail	S5MDN9	Escherichia_phage	98.6	1.4e-230
WP_000547694.1|3923515_3924187_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	99.6	5.4e-125
WP_022581964.1|3924351_3924681_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000799399.1|3924845_3925709_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000359434.1|3927077_3928304_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|3928352_3929474_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000735412.1|3929549_3931010_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|3931009_3931681_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|3931849_3933220_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|3933223_3933865_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|3933900_3935007_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|3935060_3935522_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|3935531_3936185_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|3936356_3937607_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_077774558.1|3937720_3938107_-|integrase	tyrosine-type recombinase/integrase	integrase	O21927	Phage_21	100.0	5.7e-63
WP_085949152.1|3938091_3939365_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	1.7e-172
WP_000088653.1|3940188_3940425_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|3940564_3940804_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763364.1|3940851_3941070_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000084449.1|3941223_3942288_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	65.1	2.0e-134
WP_045148846.1|3942284_3942464_-	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	84.4	6.0e-15
WP_072193391.1|3942402_3942651_+	replication protein O	NA	A0A1I9LJP3	Stx_converting_phage	98.7	1.8e-41
WP_000788890.1|3942647_3943349_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
WP_021570487.1|3943345_3943648_+	phage exclusion protein Ren	NA	M1FPD5	Enterobacteria_phage	96.7	1.0e-43
WP_001070442.1|3943715_3944048_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001348591.1|3944096_3944246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021570486.1|3944303_3945830_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.5	1.0e-30
WP_029785662.1|3945941_3946241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000990013.1|3946499_3947009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097297.1|3947105_3947207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|3949761_3951034_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
3947884:3947906	attR	TTCATGAACGACGTGTTCCTGAA	NA	NA	NA	NA
WP_001486524.1|3952458_3953043_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.9	3.2e-105
>prophage 11
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	4143365	4267167	4820620	tail,portal,capsid,holin,transposase,terminase,lysis,protease,bacteriocin,integrase	Shigella_phage(38.53%)	145	4202617:4202633	4240345:4240361
WP_001260865.1|4143365_4144187_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4144286_4144370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|4144462_4144798_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|4145194_4146448_-	MFS transporter	NA	NA	NA	NA	NA
WP_040077666.1|4146554_4147448_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159394893.1|4147582_4148803_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|4148927_4149623_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|4149575_4150868_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|4151026_4151641_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|4151683_4152538_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000254426.1|4152539_4153094_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.7	1.4e-62
WP_001367379.1|4153131_4154295_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	99.5	1.1e-226
WP_124034985.1|4154150_4154597_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	73.1	4.2e-41
WP_000497813.1|4154556_4154808_-	DUF4222 domain-containing protein	NA	A0A088CBN9	Shigella_phage	100.0	1.3e-39
WP_000187058.1|4155053_4155734_-	YqaJ viral recombinase family protein	NA	V5UT69	Shigella_phage	100.0	2.1e-132
WP_000100828.1|4155730_4156516_-	phage recombination protein Bet	NA	A0A088CBI3	Shigella_phage	98.5	2.9e-146
WP_000995032.1|4156521_4156818_-	host-nuclease inhibitor protein Gam	NA	V5URU8	Shigella_phage	93.9	5.8e-47
WP_159394894.1|4156814_4158746_-	exodeoxyribonuclease VIII	NA	A0A088CD28	Shigella_phage	87.1	9.6e-308
WP_000661407.1|4158993_4159380_-	hypothetical protein	NA	V5USC5	Shigella_phage	72.7	3.2e-45
WP_032211321.1|4159460_4159637_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	67.2	1.4e-16
WP_000560232.1|4159630_4159852_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	3.4e-36
WP_000189936.1|4160312_4160522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005958.1|4160490_4160850_-	hypothetical protein	NA	A0A088CBI5	Shigella_phage	74.4	7.0e-39
WP_024217718.1|4160881_4161595_-	hypothetical protein	NA	A0A088CC14	Shigella_phage	99.2	1.0e-126
WP_000088198.1|4161598_4161871_-	hypothetical protein	NA	A0A088CD31	Shigella_phage	100.0	3.3e-41
WP_021499206.1|4162264_4163035_-	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	99.6	3.4e-147
WP_001068241.1|4163119_4163347_+	hypothetical protein	NA	A0A088CE43	Shigella_phage	100.0	5.4e-37
WP_021499205.1|4163490_4163787_+	bacteriophage CII family protein	NA	A0A088CBI6	Shigella_phage	98.0	4.4e-47
WP_000438870.1|4163801_4164020_+	hypothetical protein	NA	A0A088CC17	Shigella_phage	100.0	1.1e-21
WP_024175270.1|4164040_4165117_+	DNA-binding protein	NA	V5URT9	Shigella_phage	97.5	1.4e-204
WP_000790393.1|4165123_4165864_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	99.6	1.2e-138
WP_001141105.1|4166674_4167118_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	4.6e-56
WP_000550489.1|4167130_4167631_+	hypothetical protein	NA	A0A2L1IV82	Escherichia_phage	81.5	1.2e-23
WP_024166112.1|4167945_4168191_+	hypothetical protein	NA	A0A088CC19	Shigella_phage	96.3	2.0e-37
WP_033817292.1|4168245_4168527_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	100.0	3.7e-43
WP_033817291.1|4168555_4168873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159394895.1|4169194_4169863_+	ORF6N domain-containing protein	NA	A0A088CD42	Shigella_phage	84.7	5.4e-101
WP_159394896.1|4170050_4170689_+	hypothetical protein	NA	A0A1B0VMI8	Pseudomonas_phage	45.0	4.9e-43
WP_159394897.1|4170660_4171062_+	recombination protein NinB	NA	A0A088CBP6	Shigella_phage	84.9	2.4e-48
WP_078180628.1|4171058_4171235_+	NinE family protein	NA	Q4A1A6	Enterobacteria_phage	100.0	3.6e-28
WP_060612288.1|4171231_4172230_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	47.0	5.1e-95
WP_060612289.1|4172172_4172349_+	protein ninF	NA	G9L691	Escherichia_phage	96.5	6.9e-24
WP_060612292.1|4172341_4172908_+	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	98.9	4.3e-107
WP_112917137.1|4172882_4173485_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.1e-92
WP_000144767.1|4173481_4173676_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001205745.1|4173668_4174103_+	hypothetical protein	NA	A0A0P0ZGJ3	Escherichia_phage	99.3	2.4e-81
WP_000691354.1|4174607_4175555_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|4175564_4175834_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_159394898.1|4176339_4178280_+	DUF1737 domain-containing protein	NA	A0A2L1IV62	Escherichia_phage	95.7	0.0e+00
WP_000142786.1|4178413_4178593_+	DUF1378 family protein	NA	A0A088CBQ0	Shigella_phage	94.9	3.2e-24
WP_001290208.1|4178633_4178879_+	DUF826 domain-containing protein	NA	A0A088CE63	Shigella_phage	100.0	8.5e-20
WP_000284506.1|4178955_4179171_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_064562793.1|4179175_4179709_+	lysozyme	NA	V5USG4	Shigella_phage	97.2	4.3e-101
WP_063105129.1|4179983_4180556_+	antirepressor	NA	A0A088CD55	Shigella_phage	90.0	3.7e-98
WP_000455400.1|4180555_4180705_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	98.0	5.3e-17
WP_159394899.1|4180712_4181150_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	97.9	1.1e-70
WP_159394900.1|4181352_4181904_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	99.5	2.9e-100
WP_052920645.1|4182982_4184689_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	98.9	0.0e+00
WP_112917128.1|4184688_4186833_+|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	99.9	0.0e+00
WP_000345015.1|4186990_4187998_+	hypothetical protein	NA	A0A0P0ZGF7	Escherichia_phage	100.0	2.3e-180
WP_000214467.1|4188021_4189236_+|capsid	N4-gp56 family major capsid protein	capsid	A0A0N7KZY1	Escherichia_phage	100.0	1.7e-233
WP_001140444.1|4189290_4189680_+	hypothetical protein	NA	V5UT93	Shigella_phage	100.0	9.9e-63
WP_001290743.1|4189730_4190192_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829202.1|4190175_4190739_+	hypothetical protein	NA	A0A0P0ZGG2	Escherichia_phage	100.0	4.1e-102
WP_000207918.1|4190738_4191389_+	hypothetical protein	NA	A0A0H4J3F2	Shigella_phage	100.0	3.5e-121
WP_000547693.1|4193789_4194461_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	100.0	1.4e-125
WP_112917129.1|4195005_4196631_+	hypothetical protein	NA	A0A0P0ZG99	Escherichia_phage	99.6	0.0e+00
WP_112917126.1|4196627_4197896_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	99.8	1.9e-219
WP_000455635.1|4197910_4198189_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001373155.1|4198194_4198812_+	hypothetical protein	NA	A0A088CBQ8	Shigella_phage	99.5	1.5e-121
WP_047199914.1|4198935_4199670_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A088CE87	Shigella_phage	100.0	6.7e-137
WP_044191818.1|4199900_4200038_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	1.2e-18
WP_000035557.1|4200097_4200499_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_112917124.1|4200593_4201247_+	hypothetical protein	NA	Q08J74	Stx2-converting_phage	95.9	4.5e-108
WP_001404559.1|4201249_4201696_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	99.3	1.2e-75
WP_096849986.1|4201705_4201978_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	92.3	1.6e-11
WP_159394901.1|4201988_4203254_+	hypothetical protein	NA	A0A088CBK4	Shigella_phage	93.8	2.5e-216
4202617:4202633	attL	GGGAAAAAACGATAAAA	NA	NA	NA	NA
WP_000628744.1|4212099_4213026_-	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	100.0	7.3e-181
WP_155120833.1|4213022_4213355_-	hypothetical protein	NA	V5URG6	Shigella_phage	99.1	2.9e-63
WP_024199259.1|4213539_4214490_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	100.0	2.8e-183
WP_000020908.1|4214476_4214761_-	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	100.0	1.2e-46
WP_000763355.1|4214757_4214979_-	TraR/DksA family transcriptional regulator	NA	V5USD3	Shigella_phage	98.6	2.9e-35
WP_000211516.1|4215026_4215650_-	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	100.0	1.0e-114
WP_024199258.1|4215899_4216187_-	hypothetical protein	NA	A0A088CEA0	Shigella_phage	98.9	3.5e-49
WP_000213043.1|4216592_4216706_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	72.0	2.1e-05
WP_001340362.1|4216716_4219140_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_077774536.1|4219200_4220310_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	47.1	1.8e-85
WP_033801271.1|4220541_4221873_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033801270.1|4222366_4222735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040078129.1|4223165_4223681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199921.1|4223670_4224171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033801274.1|4224494_4224986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000207512.1|4225070_4226060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072300573.1|4226745_4228203_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	6.7e-120
WP_001300836.1|4228401_4228707_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|4228814_4229525_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|4229527_4230088_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|4230122_4230464_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|4230598_4230925_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|4231130_4232345_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|4232356_4233376_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|4233433_4233544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000876958.1|4233563_4234844_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	3.3e-155
WP_001296941.1|4234878_4235115_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_137528113.1|4235202_4236834_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	4.3e-59
WP_001254932.1|4237197_4238349_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001310834.1|4239912_4240269_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_000955178.1|4241575_4241758_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
4240345:4240361	attR	GGGAAAAAACGATAAAA	NA	NA	NA	NA
WP_159394902.1|4241935_4243261_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000435660.1|4243332_4243758_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
WP_000624701.1|4243754_4244105_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_044186286.1|4244135_4245749_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	4.0e-166
WP_001301033.1|4246226_4246559_-	protein FlxA	NA	NA	NA	NA	NA
WP_085947917.1|4246860_4248134_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_072033201.1|4248130_4248403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000534858.1|4248427_4248667_+	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_000323025.1|4248666_4248954_+	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000813254.1|4249025_4249181_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001300563.1|4249376_4250489_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000980994.1|4250746_4250998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012304870.1|4251064_4251343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001265198.1|4251344_4252394_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_001047135.1|4252407_4253160_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|4253437_4253527_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|4253581_4253794_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|4254094_4254310_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|4255063_4255279_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_137528057.1|4255283_4255595_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.6	7.7e-26
WP_001071769.1|4256120_4256618_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_000066495.1|4256980_4257193_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|4257203_4257392_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|4257394_4257460_+	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_001309517.1|4257539_4257695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|4257866_4258040_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_033801485.1|4258191_4258602_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	78.7	5.5e-56
WP_001368374.1|4258659_4258893_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000453589.1|4259281_4259827_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.2	9.5e-88
WP_071524888.1|4260077_4260386_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000885600.1|4260385_4260961_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	1.8e-105
WP_094250091.1|4261016_4262224_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	3.9e-97
WP_000086522.1|4262409_4263000_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000836768.1|4263315_4263549_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4263617_4263731_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|4264334_4265618_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_159394903.1|4265706_4267167_+	fructuronate reductase	NA	G8DCZ3	Micromonas_pusilla_virus	29.5	7.3e-42
>prophage 12
NZ_CP041749	Escherichia coli strain NCCP 15955 chromosome, complete genome	4820620	4599914	4657350	4820620	transposase,tRNA,protease	Stx2-converting_phage(23.81%)	58	NA	NA
WP_000672380.1|4599914_4602302_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|4602316_4603300_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|4603584_4603629_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|4603751_4604108_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001700733.1|4604453_4604996_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|4604999_4606928_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_134162507.1|4607451_4609350_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
WP_001142445.1|4609521_4609629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771391.1|4609681_4610440_-	YdiY family protein	NA	NA	NA	NA	NA
WP_000251727.1|4610726_4611656_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000146159.1|4611756_4612047_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000267650.1|4612152_4613013_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000222163.1|4613053_4613590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106833.1|4613736_4614405_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_001297653.1|4614567_4615158_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001010696.1|4615290_4616682_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_001310874.1|4616685_4617489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001241561.1|4617777_4618041_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_113843733.1|4618223_4620485_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	5.1e-143
WP_000440471.1|4620742_4621492_-	chitin disaccharide deacetylase	NA	NA	NA	NA	NA
WP_000078757.1|4621504_4622857_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_001301288.1|4622961_4623801_-	transcriptional regulator ChbR	NA	NA	NA	NA	NA
WP_001280505.1|4624055_4624901_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839249.1|4624985_4625183_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_159394908.1|4625194_4625686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854716.1|4625682_4626057_-	toxin	NA	NA	NA	NA	NA
WP_001285595.1|4626146_4626515_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692304.1|4626571_4626811_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	9.2e-11
WP_001186727.1|4626873_4627350_-	RadC family protein	NA	NA	NA	NA	NA
WP_000213717.1|4627365_4627851_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	4.0e-13
WP_033801547.1|4627942_4628761_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	38.7	6.7e-45
WP_052920134.1|4629087_4632210_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069665.1|4632541_4633414_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000282123.1|4633744_4633927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435660.1|4634221_4634647_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	9.5e-35
WP_000624701.1|4634643_4634994_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_044186286.1|4635024_4636638_+|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	4.0e-166
WP_000422678.1|4636751_4637081_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	67.0	1.0e-23
WP_000374056.1|4637430_4637886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001053339.1|4637976_4639218_-	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000547256.1|4639749_4641036_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000301246.1|4641121_4641697_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.1	5.1e-31
WP_000116676.1|4641765_4642344_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	4.3e-06
WP_000255081.1|4642392_4643433_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	47.7	3.8e-77
WP_000007449.1|4643455_4643911_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001054784.1|4643933_4645091_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000254138.1|4645090_4645672_-	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.6	4.1e-12
WP_001280121.1|4647059_4648202_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	34.5	2.9e-30
WP_001039671.1|4648194_4648968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182421.1|4648969_4650049_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	1.2e-38
WP_000797373.1|4650048_4651005_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506900.1|4651015_4652224_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|4652241_4652709_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000950653.1|4653288_4653681_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_032315306.1|4653687_4654599_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	44.6	1.3e-25
WP_159394864.1|4655031_4656576_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.4	3.7e-294
WP_000612591.1|4656625_4656973_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_096958237.1|4656969_4657350_-|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	98.4	1.6e-65
