The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	75597	143671	4957978	transposase,tRNA,integrase	Escherichia_phage(16.67%)	60	65350:65363	107417:107430
65350:65363	attL	CTAAATCCTGGGAT	NA	NA	NA	NA
WP_000868887.1|75597_76815_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	28.3	6.3e-15
WP_000019077.1|77018_78383_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_000378281.1|78524_80171_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_001307474.1|80173_80431_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239725.1|80394_80754_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|80770_80911_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000059093.1|81571_82972_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673478.1|82976_84077_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
WP_000060085.1|84224_85298_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072047.1|85326_87741_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	2.2e-115
WP_001054589.1|87759_88656_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001687378.1|88770_89964_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.7	2.1e-47
WP_000061259.1|89977_91240_-	MFS transporter	NA	NA	NA	NA	NA
WP_000985572.1|91545_92391_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_000174317.1|92651_93341_+	D-galactonate utilization transcriptional regulator DgoR	NA	NA	NA	NA	NA
WP_000127125.1|93337_94216_+	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_001198742.1|94199_94817_+	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_022742849.1|94813_95962_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	33.4	6.1e-52
WP_000253524.1|96046_97384_+	MFS transporter	NA	NA	NA	NA	NA
WP_000106953.1|97409_100145_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.2	1.4e-33
WP_001202030.1|100224_101265_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001562512.1|101237_101930_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	3.8e-17
WP_001230254.1|102059_103244_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_000790665.1|103233_105786_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.7	1.1e-72
WP_000595421.1|105778_106411_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_108630416.1|106608_108000_+	c-type cytochrome	NA	NA	NA	NA	NA
107417:107430	attR	CTAAATCCTGGGAT	NA	NA	NA	NA
WP_000888541.1|108005_108623_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|108619_109279_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|109330_110068_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|110064_110277_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|110273_110753_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|110749_112681_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|112677_113235_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_050935642.1|113231_114275_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000809945.1|114396_115623_+	DUF3748 domain-containing protein	NA	NA	NA	NA	NA
WP_001541156.1|115624_115960_-	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_001532742.1|116266_116680_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	37.0	1.0e-17
WP_001246919.1|116789_117218_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	1.7e-15
WP_001067858.1|118360_119065_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000166966.1|119240_119564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041644.1|119835_120030_+	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_001067858.1|120392_121097_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_159413219.1|121443_122238_-	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_159413220.1|122580_123609_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_159413247.1|123609_123969_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000957857.1|123983_124172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|124181_125381_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_159413221.1|125579_125750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086524841.1|126347_127364_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	54.9	9.8e-86
WP_046889172.1|128234_129401_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	95.6	2.8e-222
WP_102752373.1|129400_130354_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	68.7	2.0e-117
WP_159413222.1|133700_133910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102752375.1|134118_134601_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102752380.1|136161_137142_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_102752377.1|137131_138400_+	MFS transporter	NA	NA	NA	NA	NA
WP_045898923.1|139543_139855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102752378.1|139851_140271_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000957857.1|140774_140963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|140972_142172_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_159413223.1|142524_143671_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.5e-146
>prophage 2
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	147161	197429	4957978	transposase,integrase	Escherichia_phage(28.57%)	51	147110:147169	196673:197494
147110:147169	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067858.1|147161_147866_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_159413219.1|148212_149007_-	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_159413220.1|149349_150378_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_159413247.1|150378_150738_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000957857.1|150752_150941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|150950_152150_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_159413221.1|152348_152519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086524841.1|153116_154133_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	54.9	9.8e-86
WP_046889172.1|155003_156170_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	95.6	2.8e-222
WP_102752373.1|156169_157123_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	68.7	2.0e-117
WP_159413222.1|160468_160678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102752375.1|160886_161369_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_102752380.1|162929_163910_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_102752377.1|163899_165168_+	MFS transporter	NA	NA	NA	NA	NA
WP_045898923.1|166311_166623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102752378.1|166619_167039_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000957857.1|167542_167731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|167740_168940_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_159413223.1|169292_170439_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.5e-146
WP_001067858.1|171595_172300_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000077926.1|173193_173475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|173524_173716_-	hypothetical protein	NA	E5FFJ6	Burkholderia_phage	58.5	1.4e-09
WP_001371937.1|173807_174179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|174521_174914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|175517_175811_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|175815_177141_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|177201_177408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|177509_177920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572439.1|177932_178748_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_001043843.1|179001_179427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|179975_180284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|180299_181157_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	38.7	1.8e-11
WP_001194555.1|181218_181422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|182110_182815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018321.1|183108_183924_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_000480968.1|184259_185096_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|185095_185899_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_024131419.1|186005_186143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000134999.1|186312_186954_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000948429.1|188353_189553_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000957857.1|189562_189751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000454193.1|190264_190615_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|190817_191831_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|191975_192473_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|192584_192875_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|192880_193672_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|193835_194183_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|194176_195016_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|195143_195644_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001381192.1|195612_196605_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067858.1|196724_197429_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
196673:197494	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGTTGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGTGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCG	NA	NA	NA	NA
>prophage 3
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	1762358	1791944	4957978	holin,protease,tail	Salmonella_phage(33.33%)	31	NA	NA
WP_000781589.1|1762358_1762853_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1763266_1763758_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1763747_1764011_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1764007_1766494_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1766500_1767196_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1767182_1768052_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1768167_1768617_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1768626_1769229_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1769249_1769867_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|1769863_1770523_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1770574_1771312_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1771308_1771521_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1771517_1771997_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1771993_1773925_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1773921_1774479_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_022742763.1|1774475_1775519_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1775562_1776210_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1776939_1777503_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1777694_1777898_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1778200_1778992_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1779288_1779492_+|tail	tail protein	tail	NA	NA	NA	NA
WP_159413236.1|1779660_1782027_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1782355_1783345_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1783359_1783728_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1783756_1785088_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1785384_1785714_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1786306_1787548_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1787550_1788078_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1788455_1788899_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000884778.1|1791122_1791413_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1791440_1791944_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 4
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	1863826	1872997	4957978	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1863826_1864774_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824855.1|1864757_1865489_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1865469_1865577_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1865636_1866368_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1866590_1868276_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1868272_1868992_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1869038_1869506_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1869562_1870093_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1870264_1870723_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1870963_1872997_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 5
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	1941300	1951806	4957978		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1941300_1942704_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1942881_1943775_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1944151_1945237_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1945236_1946136_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1946183_1947062_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1947062_1947614_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1947619_1948612_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1948608_1949382_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1949386_1950466_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1950492_1951806_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 6
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	2038509	2088574	4957978	holin,plate,head,terminase,portal,integrase,tail,protease,capsid	Salmonella_phage(85.94%)	68	2033087:2033101	2049217:2049231
2033087:2033101	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|2038509_2038983_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001738920.1|2039630_2039921_-	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_000598920.1|2040292_2041090_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|2041381_2042371_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|2042372_2042615_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_001061334.1|2042639_2043209_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_020899398.1|2043212_2043794_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_000224241.1|2043804_2044062_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_000215886.1|2044063_2044597_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000008351.1|2044667_2045207_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080416.1|2045343_2046171_-	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000997191.1|2046228_2046600_-	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_023891434.1|2047139_2047364_+	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_001067432.1|2047326_2047665_-	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_001020636.1|2047870_2048566_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|2048663_2048888_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|2048916_2049471_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
2049217:2049231	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|2049467_2050625_+	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000061500.1|2050842_2051661_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|2051662_2052145_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|2052144_2053038_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001241579.1|2053034_2053424_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_020899399.1|2053440_2054301_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_020899400.1|2054308_2055298_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899401.1|2055311_2056064_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_001624505.1|2056214_2056472_+	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_001283169.1|2056617_2057004_+	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_000422366.1|2056990_2057272_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001624504.1|2057271_2057886_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_001530346.1|2057882_2058275_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001379492.1|2058737_2059070_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001135098.1|2059120_2059471_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_000929171.1|2059596_2060091_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_000605609.1|2061831_2062014_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_020899404.1|2062013_2063255_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_001193639.1|2063232_2063883_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257526.1|2063897_2065103_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_000601352.1|2065153_2065354_+	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000927378.1|2065356_2065680_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702410.1|2065676_2066081_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_001135699.1|2066052_2066565_+	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000779216.1|2066561_2067122_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_000497740.1|2067125_2067290_+	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_001007996.1|2067279_2068776_+|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000515952.1|2068775_2069132_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588854.1|2069128_2069455_+|tail	phage tail assembly protein	tail	A0A192Y6C5	Salmonella_phage	100.0	1.3e-52
WP_000785390.1|2069539_2071468_+|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_000863827.1|2071501_2072842_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_001066630.1|2072838_2073897_+|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_001273648.1|2073896_2074430_+|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_000605051.1|2074434_2074848_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_000785578.1|2074840_2075920_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_001207832.1|2075922_2076510_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_020899405.1|2076496_2078059_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_022742744.1|2078028_2078634_+|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_000836773.1|2078747_2078981_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_122815478.1|2079055_2079169_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000842532.1|2079216_2079630_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_001093793.1|2079626_2079839_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000500831.1|2081032_2081194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|2081320_2081740_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|2081742_2083011_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|2083465_2083678_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2083688_2083877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|2084137_2085334_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|2085983_2086283_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|2086374_2087070_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|2087143_2088574_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 7
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	2192616	2236204	4957978	lysis,head,transposase,terminase,integrase,tail	Edwardsiella_phage(20.0%)	63	2189548:2189562	2225961:2225975
2189548:2189562	attL	ACTGCTGGATAACGT	NA	NA	NA	NA
WP_000856224.1|2192616_2192847_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2192984_2193359_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979702.1|2193359_2194235_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2194251_2194605_+	YebY family protein	NA	NA	NA	NA	NA
WP_022742740.1|2194987_2196067_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_001575998.1|2196041_2196320_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_077907869.1|2196380_2196617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139359.1|2196907_2197087_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
WP_023139358.1|2197697_2198030_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	72.7	8.5e-15
WP_001033921.1|2198022_2198343_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_001534364.1|2198378_2199209_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_022742735.1|2199201_2201892_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_000799627.1|2202032_2202368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|2202443_2202650_-	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000103933.1|2202653_2202929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024135672.1|2203189_2203369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001574209.1|2203798_2204197_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001033911.1|2204295_2204550_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001534383.1|2204536_2205031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742734.1|2205074_2206082_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	1.8e-124
WP_157872077.1|2205993_2206536_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_022742732.1|2206548_2206944_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_023139357.1|2206940_2207213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|2207419_2207572_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_024150651.1|2207764_2208070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742730.1|2208133_2208733_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_021000145.1|2208729_2208924_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_023139355.1|2208920_2209232_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	6.1e-39
WP_023139354.1|2209571_2209913_+	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_023139353.1|2210461_2211391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139352.1|2211868_2212075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742726.1|2212065_2212611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|2212888_2213347_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001526513.1|2213513_2213816_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001208103.1|2213793_2214282_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	2.1e-57
WP_085983312.1|2214302_2214743_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.3	3.5e-56
WP_001113128.1|2214968_2215151_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_022742724.1|2215221_2215974_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_022742723.1|2215939_2217361_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_023139350.1|2217360_2218881_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	7.5e-106
WP_000552017.1|2218921_2219611_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023139349.1|2219607_2220954_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_001525451.1|2220955_2221438_+	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_001031915.1|2221437_2222466_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001748493.1|2222469_2222817_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_023139348.1|2222823_2223279_+	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.0	1.2e-19
WP_022742718.1|2223272_2223857_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_001748490.1|2223853_2224219_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
WP_000094504.1|2224203_2224749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001748488.1|2224729_2226214_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
2225961:2225975	attR	ACGTTATCCAGCAGT	NA	NA	NA	NA
WP_000016414.1|2226214_2226661_+	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_000101348.1|2226660_2227065_+	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000228831.1|2227106_2227289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742717.1|2227272_2229444_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_022742716.1|2229440_2230151_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_000890115.1|2230150_2230453_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_000122818.1|2230449_2231319_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_022742715.1|2231299_2231977_+	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.5	4.6e-31
WP_001191865.1|2231989_2232346_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_022742714.1|2232342_2233584_+	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	4.5e-101
WP_022742713.1|2233585_2234188_+	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_022742712.1|2234177_2235629_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_022742711.1|2235628_2236204_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.9e-95
>prophage 8
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	3027906	3126712	4957978	holin,lysis,terminase,portal,integrase,tRNA,tail,protease	Salmonella_phage(44.23%)	95	3052000:3052019	3123785:3123804
WP_000938191.1|3027906_3028587_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|3029207_3029867_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|3029953_3030283_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|3030279_3030561_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|3030609_3031389_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859419.1|3031414_3031963_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|3032177_3033389_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|3033446_3033764_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|3033808_3034225_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|3034395_3035058_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|3035152_3035611_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|3035646_3037701_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|3037824_3038271_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|3038289_3040443_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|3040429_3041035_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|3041251_3041761_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|3042117_3043170_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|3043241_3043694_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|3043879_3045640_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|3045708_3046227_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|3046326_3046494_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|3046749_3047313_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|3047309_3048950_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|3048954_3050208_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|3050222_3052130_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
3052000:3052019	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|3052142_3054251_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_001220671.1|3055454_3055997_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_022742665.1|3056162_3057173_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|3057380_3059993_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|3060419_3060611_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|3060881_3061568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|3061552_3061852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|3061920_3062547_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|3063194_3064163_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_022742661.1|3064638_3065220_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.5	3.3e-94
WP_000178849.1|3067710_3067953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246065.1|3071413_3072118_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_022742655.1|3072762_3073458_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
WP_000877926.1|3073547_3074081_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|3074197_3074695_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|3074793_3075126_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|3075122_3078110_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|3078189_3078519_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|3078515_3078914_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|3078959_3079709_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|3079720_3080122_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|3080118_3080685_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|3080665_3080965_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|3080957_3081281_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|3081371_3083453_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|3083376_3084894_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|3084920_3085127_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|3085123_3087262_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|3087218_3087752_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|3087959_3088439_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|3088456_3088909_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|3088892_3089222_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|3089497_3090184_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3090544_3090994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3091129_3091255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508330.1|3091428_3091647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742653.1|3091813_3092611_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.2e-151
WP_001617856.1|3092600_3092747_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|3092743_3093355_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000807548.1|3094248_3094470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3094581_3094815_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|3095105_3095396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3095473_3095785_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3095781_3096129_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3096139_3096889_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3096891_3097875_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3097959_3098334_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|3098299_3098539_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3098658_3099069_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989002.1|3099118_3099379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|3099371_3099530_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|3099551_3099851_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_022742652.1|3099977_3102863_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|3102825_3103983_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3104025_3104265_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3104305_3104554_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|3104598_3105891_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|3106085_3107288_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000544849.1|3109045_3110260_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3110576_3111038_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3111238_3112639_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000977713.1|3113245_3114337_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000462653.1|3114521_3115712_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_001109471.1|3115773_3116421_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|3116448_3116997_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925872.1|3117256_3119098_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_022742649.1|3119442_3123909_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
3123785:3123804	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_000060025.1|3123908_3124613_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_050953833.1|3124593_3125916_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|3125908_3126712_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	3176774	3185506	4957978	transposase,protease	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3176774_3178029_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3178492_3178951_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3179142_3181419_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3181449_3181770_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3182093_3182315_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3182444_3184391_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201751.1|3184387_3185506_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 10
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	3778426	3823370	4957978	lysis,terminase,portal,coat,integrase,protease	Enterobacteria_phage(76.92%)	66	3769820:3769836	3832585:3832601
3769820:3769836	attL	ACGCGAATTTCAATATC	NA	NA	NA	NA
WP_000915528.1|3778426_3778789_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703639.1|3778785_3779718_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000671496.1|3779707_3781165_+	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000532177.1|3783361_3783610_+	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_071533035.1|3783630_3783924_-	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_001029860.1|3784062_3786039_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_000246977.1|3786038_3787475_-	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_000964904.1|3787485_3788175_-	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000627593.1|3788177_3788633_-	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000774917.1|3788632_3789334_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_001122420.1|3789337_3790756_-	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_001166103.1|3790715_3791216_-	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_000538670.1|3791199_3791760_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001196937.1|3791800_3793093_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000433855.1|3793092_3794004_-	scaffold protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
WP_000774652.1|3794017_3796195_-|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000417860.1|3796194_3797694_-|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000729923.1|3797671_3798160_-	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_001687044.1|3798163_3798568_-	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_001140562.1|3798567_3798957_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_000808099.1|3798960_3799203_-	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_000877028.1|3799425_3799956_-	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_001687043.1|3800168_3800636_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_024136257.1|3800632_3801130_-	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_000286100.1|3801107_3801311_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047566.1|3801740_3802514_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000219133.1|3802510_3802690_-	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_000149882.1|3802670_3802874_-	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000036320.1|3802870_3803095_-	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_001108073.1|3803091_3803703_-	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000950963.1|3803695_3803872_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001532927.1|3803864_3804206_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000113770.1|3804208_3804385_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_000679703.1|3804351_3804525_-	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000736891.1|3804521_3804959_-	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_001036030.1|3805032_3805302_-	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_001248410.1|3805298_3806675_-	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_000539342.1|3806671_3807493_-	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001103492.1|3807675_3807957_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000182204.1|3808067_3808283_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_000712403.1|3808393_3809083_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_001532928.1|3809247_3810327_+	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000834175.1|3810365_3810569_-	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_000216178.1|3810932_3811235_+	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_001066179.1|3811247_3811835_-	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000213982.1|3812048_3812243_+	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_159413243.1|3812326_3812971_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	99.5	2.5e-50
WP_000713613.1|3813004_3813292_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_000776963.1|3813567_3813882_+	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000141641.1|3813966_3814125_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3814105_3814294_+	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902092.1|3814283_3814427_+	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_001046968.1|3814423_3815131_+	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_001253476.1|3815130_3815415_+	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001111291.1|3815461_3815755_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001214777.1|3815765_3815936_+	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_000812203.1|3815932_3816442_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_071533029.1|3816438_3816672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025617570.1|3816658_3817303_+	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_000371199.1|3817302_3817587_+	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_000002104.1|3817579_3817864_+	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_155675089.1|3817932_3818073_+	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000051897.1|3818302_3819466_+|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000893231.1|3819671_3820922_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_001285275.1|3820933_3822037_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043675.1|3822317_3823370_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
3832585:3832601	attR	ACGCGAATTTCAATATC	NA	NA	NA	NA
>prophage 11
NZ_CP041976	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 chromosome, complete genome	4957978	4576696	4619464	4957978	plate,tRNA,tail	Burkholderia_phage(47.37%)	45	NA	NA
WP_001182237.1|4576696_4577695_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4577782_4579093_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4579339_4579855_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4579953_4580163_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4580184_4580298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4580294_4581620_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4581798_4582407_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4582515_4582884_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4583054_4585475_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4585573_4586446_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4586459_4586957_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4587137_4588055_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4588218_4589577_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4589665_4590775_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695417.1|4591136_4592327_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4592458_4594003_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4594017_4594908_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4595073_4595484_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_022742864.1|4595626_4597723_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4597722_4598460_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4598456_4599125_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4599158_4599401_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4599843_4601493_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4601837_4603187_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4603319_4603667_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4604242_4604530_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4604532_4605138_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4605150_4605465_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4605624_4606080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4606076_4606274_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4606263_4607691_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4607690_4608215_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4608266_4608584_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4608543_4608672_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_159413245.1|4608768_4610118_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
WP_159413246.1|4610289_4611123_+	hypothetical protein	NA	A4JWL0	Burkholderia_virus	48.9	4.4e-44
WP_001269716.1|4612074_4612284_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4612271_4613315_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4613324_4614047_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4614374_4614737_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703632.1|4614733_4615663_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_001095011.1|4615662_4617210_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4617373_4617733_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4617723_4618839_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4618831_4619464_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
>prophage 1
NZ_CP041974	Salmonella enterica subsp. enterica serovar Typhimurium strain NCCP 16207 plasmid unnamed1, complete sequence	113858	3153	12449	113858	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|3153_3570_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|3753_4089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|4145_4712_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|4743_5685_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|6099_7305_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_001541561.1|7301_8279_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_022743179.1|8360_9635_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.9	3.9e-156
WP_000925627.1|9634_10057_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|10567_11038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|11030_11387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|11768_12449_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
