The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031984	Acinetobacter haemolyticus strain AN3 chromosome, complete genome	3338454	1045195	1056403	3338454		Bacillus_phage(33.33%)	10	NA	NA
WP_005084655.1|1045195_1047319_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.5	2.7e-29
WP_004639933.1|1047331_1048522_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_160126989.1|1048615_1049215_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.7	1.9e-20
WP_160127419.1|1049261_1049822_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	52.4	7.4e-11
WP_004639928.1|1049938_1050781_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	4.5e-36
WP_160126990.1|1050900_1051569_-	class I SAM-dependent methyltransferase	NA	W8CYT3	Bacillus_phage	40.2	2.7e-23
WP_171061203.1|1051704_1052361_-	peptidase M15	NA	NA	NA	NA	NA
WP_004639922.1|1052536_1052866_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_160126991.1|1053114_1053654_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160126992.1|1053763_1056403_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.9	1.8e-35
>prophage 2
NZ_CP031984	Acinetobacter haemolyticus strain AN3 chromosome, complete genome	3338454	1132061	1171183	3338454	transposase,integrase	Stenotrophomonas_phage(25.0%)	34	1124995:1125011	1149615:1149631
1124995:1125011	attL	AAAAACAATAAAACTTA	NA	NA	NA	NA
WP_005089480.1|1132061_1133273_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.0	1.7e-65
WP_005089481.1|1133282_1134053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005089483.1|1134115_1134382_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_005089484.1|1134574_1135471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005089486.1|1135717_1138180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005196402.1|1138500_1139424_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_005089494.1|1139541_1140300_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_100222603.1|1140438_1141528_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_005089495.1|1141654_1142224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005089497.1|1142272_1142689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005089499.1|1142740_1142890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005089501.1|1142899_1143178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005089503.1|1143208_1143370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005089505.1|1143914_1144148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005089506.1|1144187_1145207_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	40.9	3.2e-60
WP_005089507.1|1145371_1146511_+	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	36.2	2.6e-42
WP_005089510.1|1146625_1147522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005196403.1|1148363_1149698_-	hypothetical protein	NA	NA	NA	NA	NA
1149615:1149631	attR	AAAAACAATAAAACTTA	NA	NA	NA	NA
WP_005089519.1|1149709_1150360_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_171065224.1|1150543_1152262_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_005089522.1|1152278_1154291_+	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	27.6	4.0e-38
WP_005089524.1|1154300_1154912_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_005196404.1|1154925_1157574_+	sensor histidine kinase KdpD	NA	B5LWN0	Feldmannia_species_virus	26.8	6.2e-15
WP_005196405.1|1157585_1158287_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_005089528.1|1158399_1159803_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_005089529.1|1159812_1160037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005089530.1|1160122_1160902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004640153.1|1162247_1162640_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_160126997.1|1162570_1163128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125316763.1|1163167_1164333_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
WP_100223911.1|1164867_1165943_-|transposase	IS3 family transposase	transposase	A0A1Y1CDP3	Human_T-cell_leukemia_virus	26.2	6.9e-05
WP_017394790.1|1166325_1168401_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_161403080.1|1168874_1168994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017394793.1|1170250_1171183_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	42.1	4.2e-59
>prophage 3
NZ_CP031984	Acinetobacter haemolyticus strain AN3 chromosome, complete genome	3338454	1339108	1400351	3338454	capsid,protease,tRNA,transposase	Mollivirus(11.11%)	58	NA	NA
WP_075315484.1|1339108_1339732_+|protease	metalloprotease secretion chaperone CpaB	protease	NA	NA	NA	NA
WP_100833730.1|1339733_1340315_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160127019.1|1340442_1341933_+	SmvA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_075315486.1|1342012_1342702_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_160127020.1|1342818_1343706_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160127021.1|1343702_1344296_-	septum formation protein Maf	NA	NA	NA	NA	NA
WP_004639395.1|1344295_1344679_-	DUF2237 domain-containing protein	NA	NA	NA	NA	NA
WP_160127022.1|1344818_1346006_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_160127023.1|1346171_1346399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082757.1|1346448_1346832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075315490.1|1347048_1347627_+	nitroreductase	NA	NA	NA	NA	NA
WP_004639390.1|1347671_1348745_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_160127024.1|1348873_1349329_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_160127025.1|1349368_1350508_+	general secretion pathway protein GspL	NA	NA	NA	NA	NA
WP_100833723.1|1350507_1350987_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_004639386.1|1351105_1352113_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_160127026.1|1352114_1352708_+	CvpA family protein	NA	NA	NA	NA	NA
WP_075315493.1|1352748_1354287_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.0	7.3e-85
WP_171502990.1|1354381_1356271_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_035375233.1|1356288_1357086_+	PaaX family transcriptional regulator	NA	NA	NA	NA	NA
WP_005090264.1|1357209_1358193_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_100833720.1|1358228_1358642_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_100833719.1|1358766_1359543_+	tellurium resistance protein	NA	NA	NA	NA	NA
WP_004639377.1|1359555_1360686_+	toxic anion resistance protein	NA	K4F9M7	Cronobacter_phage	25.3	1.1e-24
WP_160127028.1|1360711_1361632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833717.1|1361753_1363319_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	29.9	5.6e-24
WP_160126557.1|1363368_1364594_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	6.0e-21
WP_167365849.1|1364678_1364852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171055746.1|1365092_1365350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100833715.1|1365421_1366588_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	61.1	6.1e-124
WP_075315500.1|1366969_1368958_+	transketolase	NA	NA	NA	NA	NA
WP_100833714.1|1369018_1369426_-	OsmC family protein	NA	NA	NA	NA	NA
WP_100833713.1|1369532_1370624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100833712.1|1370894_1371476_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_075315503.1|1371555_1372095_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004638831.1|1372126_1372384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004638832.1|1372642_1373176_-	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_160123947.1|1373335_1374070_+	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_017394697.1|1374111_1374339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005080993.1|1374587_1375673_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_075315505.1|1376337_1380102_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004638843.1|1380302_1380794_+	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_008942576.1|1380915_1382073_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075315506.1|1382119_1383616_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_004638847.1|1384184_1384559_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_160127029.1|1384655_1385681_-	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004638852.1|1385810_1386251_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_100833710.1|1386250_1388101_-	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	25.7	2.7e-25
WP_160127030.1|1388291_1390148_+|capsid	phage capsid protein	capsid	A0A1D8EQB5	Escherichia_phage	36.9	7.5e-108
WP_075315510.1|1390760_1392020_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_100833708.1|1392137_1392674_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_004638863.1|1392677_1393358_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_075315511.1|1393364_1394567_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_160127031.1|1394759_1396466_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.1	3.4e-14
WP_004638870.1|1396534_1396852_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075315513.1|1397383_1397950_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005090724.1|1398322_1398823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004907077.1|1399418_1400351_-|transposase	IS5-like element ISAha3 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.1	1.8e-57
>prophage 4
NZ_CP031984	Acinetobacter haemolyticus strain AN3 chromosome, complete genome	3338454	3112927	3182699	3338454	tRNA,transposase,integrase	uncultured_Caudovirales_phage(12.5%)	59	3131444:3131489	3210731:3210776
WP_075316385.1|3112927_3114727_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075316386.1|3115029_3115641_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_075316544.1|3115699_3116353_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_075316387.1|3116449_3116848_-	OsmC family protein	NA	NA	NA	NA	NA
WP_075316388.1|3116844_3117792_-	pirin family protein	NA	NA	NA	NA	NA
WP_075316389.1|3117945_3118209_-	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_075316390.1|3118360_3118852_-	flavin reductase	NA	NA	NA	NA	NA
WP_004637464.1|3119037_3120066_-	methionine synthase	NA	NA	NA	NA	NA
WP_017395373.1|3120093_3121095_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_075316392.1|3121445_3121658_+	zf-TFIIB domain-containing protein	NA	NA	NA	NA	NA
WP_160127368.1|3121809_3122418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075316393.1|3122392_3123274_-	DNA cytosine methyltransferase	NA	F2Y1T1	Organic_Lake_phycodnavirus	43.8	1.6e-60
WP_004637461.1|3123276_3124845_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	8.7e-25
WP_171055760.1|3125292_3126519_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_160127369.1|3126576_3126945_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_004637457.1|3127077_3127500_-	DoxX family protein	NA	NA	NA	NA	NA
WP_004637456.1|3127724_3128366_+	DedA family protein	NA	NA	NA	NA	NA
WP_005085714.1|3128389_3128980_-	LysE family transporter	NA	NA	NA	NA	NA
WP_004637453.1|3129192_3129579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160127370.1|3129591_3130431_-	AAA family ATPase	NA	V5UP47	Mycobacterium_phage	25.1	3.2e-10
WP_160127371.1|3130512_3130905_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_017395392.1|3130914_3131223_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
3131444:3131489	attL	CTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCA	NA	NA	NA	NA
WP_000587224.1|3131945_3132173_-	helix-turn-helix transcriptional regulator	NA	S5MTW4	Brevibacillus_phage	50.0	1.1e-08
WP_000122748.1|3132285_3132495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000201379.1|3132514_3133696_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	30.1	3.6e-39
WP_001084945.1|3133688_3133940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024436051.1|3134005_3134548_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_001095014.1|3134558_3135305_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	37.4	4.7e-45
WP_000419013.1|3135669_3137454_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000524156.1|3137440_3138463_-	PD-(D/E)XK motif protein	NA	NA	NA	NA	NA
WP_016164858.1|3138446_3141272_-	Z1 domain-containing protein	NA	NA	NA	NA	NA
WP_000555597.1|3141298_3142792_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000704433.1|3142784_3145031_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2I7SAT0	Vibrio_phage	30.1	6.2e-24
WP_016164859.1|3145328_3146864_+	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	26.5	2.7e-18
WP_000267701.1|3147492_3148554_-	HNH endonuclease	NA	A0A2I2MUI7	uncultured_Caudovirales_phage	61.6	6.6e-77
WP_016164861.1|3148540_3149740_-	class I SAM-dependent methyltransferase	NA	A0A2H4J5G6	uncultured_Caudovirales_phage	79.3	5.1e-33
WP_000506884.1|3149891_3150221_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001282337.1|3150320_3150635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171455464.1|3150780_3150927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016164862.1|3151162_3151834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004527.1|3151833_3154161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000096773.1|3154144_3157360_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000557620.1|3157450_3157813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001060549.1|3157936_3160297_+	DEAD/DEAH box helicase family protein	NA	W8W2E1	Invertebrate_iridovirus	29.2	1.3e-32
WP_001005874.1|3160583_3160892_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016164863.1|3160888_3162178_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_016164864.1|3162195_3165543_-	DEAD/DEAH box helicase	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	31.4	3.0e-51
WP_016164865.1|3166873_3167794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005064486.1|3167816_3168749_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.9	5.0e-60
WP_000734101.1|3168861_3169182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733361.1|3169305_3169689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000672051.1|3169713_3170478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002159601.1|3170569_3171178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010326927.1|3171712_3172738_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_000693745.1|3173095_3175051_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	41.1	2.1e-129
WP_010326927.1|3175449_3176475_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_000543471.1|3177064_3177562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160127372.1|3177558_3179739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033773.1|3179735_3182699_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3210731:3210776	attR	CTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCA	NA	NA	NA	NA
