The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	74612	126260	3550511	tRNA,transposase	Faecalibacterium_phage(23.08%)	44	NA	NA
WP_010326927.1|74612_75638_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_160140320.1|76243_77333_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004683633.1|78102_79707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004683632.1|79699_81223_-	TniQ family protein	NA	NA	NA	NA	NA
WP_004683630.1|81236_82883_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010326927.1|84161_85187_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_004683627.1|86044_86878_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
WP_008942100.1|87031_88870_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7J689	Paramecium_bursaria_Chlorella_virus	44.5	5.4e-127
WP_008942101.1|88882_90247_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	33.5	1.0e-29
WP_008942102.1|90269_90791_-	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
WP_008942103.1|90768_91686_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_004679125.1|91700_92150_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_004637206.1|92153_92624_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	52.0	1.1e-31
WP_008942104.1|92635_93757_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	36.2	1.4e-56
WP_004637204.1|94041_95316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005087273.1|95402_96623_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_004637201.1|97030_97366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004637199.1|97508_97988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942106.1|98093_98534_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_008942107.1|98687_99893_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	33.8	1.1e-43
WP_008942108.1|99995_100844_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_008942109.1|100840_101692_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_079283381.1|102756_103782_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_008942111.1|104013_104313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004641656.1|104685_104895_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	61.4	1.5e-17
WP_004641653.1|105411_106302_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017396432.1|106396_106849_+	PACE efflux transporter	NA	NA	NA	NA	NA
WP_004641648.1|106915_108271_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.1	7.0e-31
WP_004641646.1|108279_108990_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	36.7	2.3e-33
WP_008942114.1|109240_109918_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005088723.1|110222_111050_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008942115.1|111096_112464_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_008942116.1|112564_113719_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_008942117.1|114038_114479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942118.1|114578_115886_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_004641631.1|115903_116461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004641629.1|116487_117027_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	36.4	3.1e-22
WP_017396323.1|117210_118788_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_005088717.1|118859_119357_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_004641622.1|119415_120762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160140321.1|121024_121633_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004641617.1|121629_123513_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.6	6.4e-99
WP_160140322.1|123737_125078_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_076612069.1|125170_126260_+|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	132227	184456	3550511	transposase	Bacillus_phage(37.5%)	48	NA	NA
WP_160140320.1|132227_133318_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_160140324.1|133796_134729_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	7.1e-59
WP_160140325.1|135274_136012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160140326.1|136092_136641_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017396331.1|136965_137691_-	ion channel protein Tsx	NA	NA	NA	NA	NA
WP_004641598.1|138059_138419_+	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_004641595.1|138558_139104_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_171502757.1|139134_139902_+	transporter	NA	NA	NA	NA	NA
WP_160140328.1|139979_141833_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_160140329.1|141835_142531_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017396427.1|142572_143760_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.9	1.2e-21
WP_005087216.1|144042_144954_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005087215.1|145143_145581_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004641582.1|145644_145995_-	arsenate reductase	NA	NA	NA	NA	NA
WP_008942133.1|146434_147259_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_004641579.1|147300_147951_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_160140331.1|148543_149263_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_125316763.1|149541_150706_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
WP_160140332.1|150657_151356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160140449.1|151358_152261_-	DUF4747 family protein	NA	NA	NA	NA	NA
WP_005087201.1|152483_152936_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160140333.1|153115_153598_+	redoxin domain-containing protein	NA	A0A1S7DM81	Molluscum_contagiosum_virus	31.2	1.7e-11
WP_160140334.1|153823_154768_+	glutathione synthase	NA	NA	NA	NA	NA
WP_160140335.1|155019_156117_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_005088688.1|156130_157576_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_160140336.1|157615_158542_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_005087191.1|158546_159404_+	FtsQ-type POTRA domain-containing protein	NA	NA	NA	NA	NA
WP_004641555.1|159469_160732_+	cell division protein FtsA	NA	NA	NA	NA	NA
WP_076612069.1|160875_161966_-|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_151211472.1|162186_163362_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_004641551.1|163528_164431_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_004641549.1|164529_164970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004641547.1|165076_165760_+	M23 family metallopeptidase	NA	G3MBP9	Bacillus_virus	40.1	2.4e-19
WP_005087187.1|165965_168683_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_160140337.1|168685_170653_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_005087184.1|170792_171074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942147.1|171335_171911_+	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_160140338.1|172014_174138_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_004641535.1|174359_175166_+	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_160140339.1|175290_175656_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_004641532.1|175795_177262_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.4	2.7e-89
WP_004641530.1|177388_178726_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_160140340.1|178738_179395_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_160140341.1|179395_181096_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.9	9.3e-65
WP_160140342.1|181167_182545_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.9	4.7e-75
WP_160140343.1|182612_183533_-	putative porin	NA	NA	NA	NA	NA
WP_017395860.1|183621_184026_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_017395859.1|184117_184456_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	212262	263994	3550511	integrase,transposase	Acinetobacter_phage(25.0%)	34	233370:233384	269299:269313
WP_125316763.1|212262_213428_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
WP_160140344.1|214554_216030_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_076612069.1|216436_217526_+|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_125316907.1|219339_219756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017396150.1|219891_220050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125316908.1|220024_220399_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_125316909.1|220465_220645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125316763.1|220726_221891_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
WP_151800621.1|223527_228471_+	DEAD/DEAH box helicase family protein	NA	A0A2H4UTW8	Bodo_saltans_virus	26.7	1.1e-36
WP_151800620.1|229184_230384_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_107908897.1|230392_230944_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	52.2	3.1e-46
233370:233384	attL	TTATGTCTGGCGAAA	NA	NA	NA	NA
WP_125316797.1|234395_235391_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_125316798.1|235399_236686_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_160140345.1|236734_237916_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_125316800.1|237917_239075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_118903275.1|239283_240231_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_118903277.1|240310_240487_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_118903279.1|240643_242212_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	26.5	4.5e-21
WP_118903281.1|242204_242942_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	28.6	1.2e-19
WP_100223916.1|243553_244719_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.2	3.4e-50
WP_017396719.1|245343_246777_+	amino acid permease	NA	NA	NA	NA	NA
WP_008941075.1|246834_248337_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.6	9.2e-16
WP_008941076.1|248491_249784_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	1.3e-26
WP_008941077.1|249780_251229_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_171057917.1|251291_252272_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004641467.1|252295_252922_-	hydrolase	NA	NA	NA	NA	NA
WP_005088628.1|253207_254068_+	pirin family protein	NA	NA	NA	NA	NA
WP_005088626.1|254503_255802_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008941079.1|255803_256631_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_125316763.1|257927_259093_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
WP_005088612.1|259641_260079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005088610.1|260075_261938_-	DEAD/DEAH box helicase family protein	NA	A0A0K1LKN7	Rhodobacter_phage	22.8	2.5e-10
WP_160124150.1|262041_262527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017396498.1|262794_263994_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	4.7e-79
269299:269313	attR	TTTCGCCAGACATAA	NA	NA	NA	NA
>prophage 4
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	543630	594485	3550511	protease,transposase	Bacillus_virus(16.67%)	39	NA	NA
WP_008941235.1|543630_544941_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.5	1.9e-126
WP_004640925.1|545101_545818_+	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_008941237.1|545886_547143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941238.1|547293_548820_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_008941239.1|549002_549863_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004640918.1|550042_550951_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017396528.1|550981_551587_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_008941241.1|551682_553002_-	MFS transporter	NA	NA	NA	NA	NA
WP_008941242.1|553025_555158_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_004640913.1|555184_556360_-	acetate kinase	NA	NA	NA	NA	NA
WP_004640911.1|556662_557928_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.3	7.6e-96
WP_076612069.1|558280_559370_+|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_161412355.1|559488_560775_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_005086744.1|560846_561689_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005086742.1|561977_563000_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_004640902.1|563248_565432_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	47.7	7.5e-176
WP_115736073.1|565532_566757_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	3.5e-21
WP_004640900.1|566821_567265_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_004640897.1|567353_568022_-	LrgB family protein	NA	NA	NA	NA	NA
WP_004640895.1|568032_568395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941244.1|568469_569807_-	GTPase HflX	NA	NA	NA	NA	NA
WP_004640892.1|569881_570022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005088259.1|570221_571052_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_005088257.1|571044_572673_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_005088255.1|572774_573785_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_005088253.1|573841_574321_-	OmpA family protein	NA	NA	NA	NA	NA
WP_005086724.1|574329_575553_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_005088251.1|575558_576020_-	YfiR family protein	NA	NA	NA	NA	NA
WP_005089101.1|582067_583144_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_005089103.1|583346_584510_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_005089105.1|584523_584928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005089107.1|584993_585503_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004669660.1|585499_586099_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_115736361.1|586290_588096_+	DUF1446 domain-containing protein	NA	NA	NA	NA	NA
WP_115736362.1|588114_589041_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_160140349.1|589670_590459_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.2	1.4e-42
WP_004678526.1|590445_591147_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_115736364.1|592469_593306_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_160140320.1|593394_594485_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	824514	936752	3550511	protease,integrase,tRNA,transposase	Enterobacteria_phage(22.22%)	94	903286:903301	941813:941828
WP_160140324.1|824514_825447_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	7.1e-59
WP_017396747.1|825454_826222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017394993.1|826281_829179_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	5.3e-145
WP_017394992.1|829430_830111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017394991.1|830235_830898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017394990.1|830910_831717_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171502758.1|831912_832095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017394988.1|832140_832581_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005083051.1|832590_832941_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_004640437.1|833051_834509_-	multidrug efflux RND transporter AdeIJK outer membrane channel subunit AdeK	NA	NA	NA	NA	NA
WP_004640435.1|834508_837685_-	multidrug efflux RND transporter permease subunit AdeJ	NA	NA	NA	NA	NA
WP_005083049.1|837697_838921_-	AdeA/AdeI family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005083047.1|838907_839558_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004640429.1|839719_841762_-	site-specific recombinase	NA	NA	NA	NA	NA
WP_005083044.1|841775_842753_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_005083041.1|843200_843512_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_004640422.1|843530_843785_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_026070327.1|843850_844720_-	pirin family protein	NA	NA	NA	NA	NA
WP_017394986.1|845012_845708_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_017394985.1|845826_846591_+	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_004640409.1|846693_847965_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.8	1.6e-93
WP_017394984.1|848032_849409_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_005083031.1|849555_850026_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004640404.1|850039_850420_-	VOC family protein	NA	NA	NA	NA	NA
WP_004640401.1|850435_850816_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004640399.1|850932_851490_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_005089425.1|851551_852964_-	APC family permease	NA	NA	NA	NA	NA
WP_017394982.1|853249_854434_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005083027.1|854436_854970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017394981.1|855052_855706_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_005083022.1|855878_856166_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_004640390.1|856304_858185_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.1	1.1e-39
WP_004640386.1|858528_858735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004640385.1|858807_859332_+	YecA family protein	NA	NA	NA	NA	NA
WP_017394980.1|859459_860065_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017394979.1|860167_861043_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005089432.1|861114_861765_-	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_005083015.1|861780_862401_-	DedA family protein	NA	NA	NA	NA	NA
WP_004640374.1|862538_863471_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_005089435.1|863581_864070_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_004640370.1|864136_865411_-	citrate (Si)-synthase	NA	NA	NA	NA	NA
WP_004640364.1|866313_866715_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_005083003.1|866714_867080_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_026056325.1|867089_868985_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_005083000.1|868999_869710_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004640354.1|870405_873258_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_004640352.1|873257_874445_+	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_004640350.1|874504_875938_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.5	1.0e-40
WP_004640348.1|876074_877241_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_004640347.1|877253_878144_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	31.6	4.9e-17
WP_076612069.1|878527_879617_+|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_005091342.1|880030_881071_+|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	82.7	7.7e-171
WP_005089440.1|881352_883065_-	flotillin family protein	NA	NA	NA	NA	NA
WP_017395176.1|883099_883744_-	YqiJ family protein	NA	NA	NA	NA	NA
WP_079283381.1|883856_884882_+|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_004640323.1|885248_886262_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004640320.1|886430_887348_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_017395177.1|887391_888282_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.3	2.9e-33
WP_005064486.1|890695_891628_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.9	5.0e-60
WP_020846310.1|891910_892843_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_017394871.1|893190_893892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017394872.1|893907_894645_-|protease	metalloprotease	protease	NA	NA	NA	NA
WP_017394873.1|894727_895042_+	MGMT family protein	NA	NA	NA	NA	NA
WP_004640302.1|895221_895659_-	universal stress protein	NA	NA	NA	NA	NA
WP_004640300.1|895884_896511_-	CatB-related O-acetyltransferase	NA	NA	NA	NA	NA
WP_125316763.1|896774_897939_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
WP_004640296.1|898166_898643_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005084359.1|898735_901969_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_004640293.1|901983_903123_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	NA	NA	NA	NA
903286:903301	attL	TTAATTATTAAATAGA	NA	NA	NA	NA
WP_004640291.1|903483_904026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004640289.1|904074_904611_-	DOMON-like domain-containing protein	NA	NA	NA	NA	NA
WP_004640287.1|904616_904943_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_008941571.1|905207_905858_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_004640283.1|905995_907891_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	46.8	2.6e-108
WP_017394875.1|908024_908915_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_076612069.1|908994_910085_-|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_017394876.1|910189_910948_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_008941568.1|911066_912677_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_020846310.1|913351_914284_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_017395170.1|917458_918172_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026070343.1|918620_919223_+	nicotinamide mononucleotide transporter	NA	A0A0S1S1B4	Klebsiella_phage	26.9	5.7e-09
WP_017395172.1|919272_920412_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_017395173.1|920618_922232_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_008941561.1|922573_925675_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_004640257.1|925954_927292_+	magnesium transporter	NA	NA	NA	NA	NA
WP_004640255.1|927368_927947_+	DUF4112 domain-containing protein	NA	NA	NA	NA	NA
WP_004640254.1|928010_928916_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_161414322.1|929133_929910_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	53.7	9.2e-36
WP_004640251.1|930493_931399_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.2	3.1e-91
WP_076612069.1|931524_932614_+|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_004640249.1|932784_933168_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005084391.1|933214_934324_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_008941558.1|934698_935175_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_005089480.1|935540_936752_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	39.0	1.7e-65
941813:941828	attR	TCTATTTAATAATTAA	NA	NA	NA	NA
>prophage 6
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	981139	1016990	3550511	integrase,transposase	Enterobacteria_phage(40.0%)	32	985893:985909	1004890:1004906
WP_076612069.1|981139_982230_-|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_171061200.1|982271_982610_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
985893:985909	attL	AGGCTTTGTTGCACAAA	NA	NA	NA	NA
WP_005324694.1|985947_986880_+|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	1.4e-54
WP_005324696.1|987109_987340_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_005324697.1|987643_988516_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_005324702.1|988531_989884_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	67.1	4.9e-149
WP_100223928.1|989915_990506_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	54.2	4.9e-21
WP_005324707.1|990572_990956_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_005324717.1|991002_991755_-	pyrimidine utilization protein B	NA	NA	NA	NA	NA
WP_005064337.1|991751_992870_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_005324718.1|993229_993817_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_005324720.1|993813_994620_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_100223929.1|995746_996475_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_017395975.1|996725_998003_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	38.1	8.3e-74
WP_160140450.1|998212_998587_-|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	41.2	2.9e-11
WP_125316763.1|998675_999841_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
WP_160140351.1|999876_1000392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004640153.1|1000322_1000715_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017395511.1|1001215_1002520_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_118902211.1|1003920_1004853_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	5.5e-59
WP_004640243.1|1006172_1007132_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
1004890:1004906	attR	TTTGTGCAACAAAGCCT	NA	NA	NA	NA
WP_008941712.1|1007134_1007902_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004640238.1|1007931_1008195_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_008941713.1|1008315_1009086_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008941714.1|1009082_1009778_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_008941715.1|1009774_1010392_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.8	8.4e-16
WP_008941716.1|1010404_1011739_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	67.4	1.5e-30
WP_171057901.1|1011964_1013005_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008941718.1|1013014_1013806_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	37.3	1.6e-30
WP_005084443.1|1013802_1014684_+	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
WP_005084445.1|1014714_1015560_+	taurine dioxygenase	NA	NA	NA	NA	NA
WP_160140320.1|1015900_1016990_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	1052995	1086752	3550511	transposase	Enterobacteria_phage(30.0%)	37	NA	NA
WP_020846310.1|1052995_1053928_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_004777298.1|1054168_1055248_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	49.2	9.1e-90
WP_004757630.1|1055322_1055466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017395188.1|1055501_1056440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004640146.1|1056648_1057119_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017395187.1|1057126_1058020_+	EamA family transporter	NA	NA	NA	NA	NA
WP_004640143.1|1058034_1058619_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_005084477.1|1058644_1059880_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004640139.1|1059872_1060559_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	37.8	2.9e-33
WP_026070345.1|1060642_1063081_+	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	45.9	8.8e-16
WP_017395185.1|1063069_1064026_-	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_005089605.1|1064165_1065188_+	signal peptide peptidase SppA	NA	A0A2I6UH21	Salinibacter_virus	27.2	5.0e-13
WP_017395184.1|1065333_1066125_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_171061179.1|1066164_1066794_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.4	1.8e-29
WP_017395182.1|1066790_1067861_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.7	1.6e-78
WP_005089613.1|1067994_1069191_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004640121.1|1069211_1069910_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_020846310.1|1070367_1071300_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_080596003.1|1071310_1072435_+	rhombotarget A	NA	NA	NA	NA	NA
WP_160140352.1|1072464_1073397_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	2.7e-58
WP_151800552.1|1073438_1073732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121533679.1|1073693_1074260_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_004973749.1|1074249_1074705_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004640116.1|1076888_1077278_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_004640114.1|1077267_1077591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004640112.1|1077583_1078195_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004640110.1|1078353_1079130_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_005089620.1|1079181_1080156_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	35.5	7.3e-46
WP_004640107.1|1080332_1080521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004641816.1|1080561_1081125_-	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_004641814.1|1081147_1082431_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_151800549.1|1082530_1083679_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_004640103.1|1083682_1084135_-	protein TolR	NA	NA	NA	NA	NA
WP_004640101.1|1084134_1084833_-	protein TolQ	NA	NA	NA	NA	NA
WP_004640100.1|1084852_1085266_-	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017395859.1|1085917_1086256_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017395860.1|1086347_1086752_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	1096090	1224835	3550511	tRNA,transposase	Streptococcus_phage(12.12%)	115	NA	NA
WP_160140320.1|1096090_1097180_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_125316763.1|1097241_1098407_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
WP_171057131.1|1098994_1099288_+	NGG1p interacting factor NIF3	NA	NA	NA	NA	NA
WP_151800641.1|1099289_1100054_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_076612069.1|1100168_1101259_-|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_017394935.1|1101434_1103156_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_017394934.1|1103142_1104093_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_017394933.1|1104085_1106938_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.7	1.0e-10
WP_005089648.1|1107226_1108027_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_161401498.1|1108135_1108711_+	nicotinate-nicotinamide nucleotide adenylyltransferase	NA	A0A0X8WP26	Ralstonia_phage	31.3	4.5e-19
WP_005089651.1|1108728_1109649_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017394932.1|1109774_1109993_+	2-hydroxymuconate tautomerase family protein	NA	NA	NA	NA	NA
WP_017394931.1|1109994_1110372_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_004640067.1|1110381_1110744_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_017394928.1|1111446_1112604_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004640063.1|1112732_1113197_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_017394927.1|1113200_1113893_-	diphthine--ammonia ligase	NA	NA	NA	NA	NA
WP_026070319.1|1113990_1114413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026070318.1|1114443_1115124_-	7-cyano-7-deazaguanine synthase QueC	NA	M1PKZ7	Cellulophaga_phage	37.9	1.7e-30
WP_017394497.1|1115187_1115898_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	36.1	2.7e-34
WP_004640056.1|1116054_1116876_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017394924.1|1117171_1117924_+	ornithine uptake porin CarO type 5	NA	NA	NA	NA	NA
WP_005084556.1|1118020_1118944_-	CysB family HTH-type transcriptional regulator	NA	NA	NA	NA	NA
WP_004640050.1|1119100_1120174_-	sulfate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	5.6e-31
WP_005084559.1|1120178_1121063_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_171055805.1|1121059_1121872_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_008941789.1|1121964_1122567_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017394923.1|1122603_1123605_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017394921.1|1123855_1124668_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017394920.1|1124669_1125746_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017394919.1|1125746_1126352_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	42.1	1.6e-35
WP_026070317.1|1126447_1127287_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_017394917.1|1127283_1127982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100223934.1|1129525_1129861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100223933.1|1130158_1130500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171061211.1|1130577_1131213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171061212.1|1131331_1132969_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_017396379.1|1133312_1134689_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	7.6e-25
WP_017396378.1|1134799_1135255_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_004640031.1|1135408_1137226_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	2.2e-19
WP_017396377.1|1137300_1138164_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004640026.1|1138191_1138569_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_004640024.1|1138537_1139233_+	ribonuclease III	NA	A0A2K9R4Y7	Dishui_lake_phycodnavirus	33.2	6.8e-22
WP_005089671.1|1139237_1140263_+	GTPase Era	NA	NA	NA	NA	NA
WP_017396375.1|1140488_1141196_+	DNA repair protein RecO C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017396374.1|1141246_1141975_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_017396373.1|1141979_1142636_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017396372.1|1143048_1143480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004640010.1|1143841_1144261_+	GFA family protein	NA	NA	NA	NA	NA
WP_004640008.1|1144340_1145567_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_160140320.1|1145799_1146889_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004640006.1|1146968_1147148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017396371.1|1147203_1148364_-	S8 family peptidase	NA	A0A2K9L570	Tupanvirus	37.9	4.8e-28
WP_017396370.1|1148481_1149276_-	hypothetical protein	NA	A0A127KNK1	Pseudomonas_phage	48.7	1.5e-25
WP_035370230.1|1149343_1150963_-	S8 family peptidase	NA	A0A2K9L1P3	Tupanvirus	38.6	9.9e-32
WP_020846163.1|1151387_1153421_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_026056254.1|1153571_1154318_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	31.6	3.4e-11
WP_017396261.1|1154382_1154967_+	lipocalin family protein	NA	A0A2K9L662	Tupanvirus	34.1	5.0e-18
WP_160140320.1|1155110_1156200_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_004639993.1|1157449_1158907_+	glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017396262.1|1159045_1159789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017396263.1|1159794_1160469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008942049.1|1160584_1161805_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_004639988.1|1161884_1163018_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.7	1.4e-69
WP_005089685.1|1163088_1164726_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004639985.1|1164814_1165831_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_004639983.1|1165855_1166977_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	1.6e-28
WP_017396264.1|1167028_1167721_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_017396265.1|1167687_1168896_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_017396266.1|1168978_1170004_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_004639978.1|1170060_1170966_-	hydrogen peroxide-inducible genes activator	NA	NA	NA	NA	NA
WP_171061207.1|1170972_1171872_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017396268.1|1172004_1173186_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000760495.1|1173531_1173696_-	rubredoxin	NA	NA	NA	NA	NA
WP_005084625.1|1174048_1174486_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_004639969.1|1174646_1176173_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	39.4	2.9e-89
WP_017396269.1|1176325_1177777_+	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_005089695.1|1178103_1179012_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_017396270.1|1179057_1180671_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.4	5.8e-40
WP_004639959.1|1180868_1181384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004639957.1|1181432_1181696_+	ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_004639956.1|1181735_1183064_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_005084639.1|1183169_1184159_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_026070457.1|1184697_1186299_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_076612069.1|1186455_1187545_+|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_026070458.1|1187574_1188042_-	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_115736073.1|1188268_1189494_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	3.5e-21
WP_017395019.1|1189778_1191200_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.7	1.6e-54
WP_017395020.1|1191475_1192453_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.1	3.1e-36
WP_004639946.1|1192456_1192996_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_005084648.1|1193040_1193589_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_005084650.1|1193572_1194121_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_005089712.1|1194120_1194867_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.1e-21
WP_005089714.1|1195056_1196592_+	TolC family protein	NA	NA	NA	NA	NA
WP_017395023.1|1198724_1199915_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_118902211.1|1199922_1200855_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	5.5e-59
WP_017396178.1|1201056_1201656_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.7	6.5e-21
WP_017396177.1|1201648_1202263_+	acyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	52.4	8.1e-11
WP_017396176.1|1202379_1203222_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	3.4e-36
WP_026070448.1|1203341_1204010_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	40.2	2.7e-23
WP_171061203.1|1204145_1204802_-	peptidase M15	NA	NA	NA	NA	NA
WP_004639922.1|1204977_1205307_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017396173.1|1205555_1206095_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017396172.1|1206204_1208844_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	22.0	4.9e-36
WP_100223916.1|1210009_1211175_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.2	3.4e-50
WP_076612069.1|1211912_1213002_+|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_017395466.1|1215046_1215724_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_017395465.1|1215754_1216879_-	Fic family protein	NA	NA	NA	NA	NA
WP_017395464.1|1217807_1218026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026056278.1|1219494_1219722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004639899.1|1219866_1220097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639896.1|1220387_1220999_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	55.3	2.8e-48
WP_017395461.1|1221003_1222302_+	Y-family DNA polymerase	NA	A0A2H4JBL5	uncultured_Caudovirales_phage	46.4	2.2e-106
WP_017395460.1|1222468_1223569_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_100223916.1|1223670_1224835_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.2	3.4e-50
>prophage 9
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	1285379	1344411	3550511	integrase,transposase	uncultured_Caudovirales_phage(22.22%)	49	1283028:1283045	1299772:1299789
1283028:1283045	attL	AATTGATCCAAGCAAAAC	NA	NA	NA	NA
WP_008941997.1|1285379_1286402_+|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	43.8	6.4e-69
WP_008941996.1|1286426_1286729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941995.1|1286982_1287678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017395550.1|1288180_1289128_+	MobA/MobL family protein	NA	NA	NA	NA	NA
WP_008941993.1|1289220_1290075_-	hypothetical protein	NA	A0A2H4JC99	uncultured_Caudovirales_phage	32.2	3.5e-28
WP_016541972.1|1290058_1290406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016653653.1|1290909_1291263_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_017395552.1|1292111_1292720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017395553.1|1292750_1294331_+	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_004682117.1|1294347_1295589_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004682116.1|1295736_1296009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008941961.1|1296012_1296285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004678526.1|1296409_1297111_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_171402605.1|1297101_1297959_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017394803.1|1298064_1298847_+	NRDE family protein	NA	A0A0M3ZEJ9	Turkeypox_virus	27.3	7.2e-20
WP_017394804.1|1298989_1300582_+	alkaline phosphatase	NA	NA	NA	NA	NA
1299772:1299789	attR	AATTGATCCAAGCAAAAC	NA	NA	NA	NA
WP_005088296.1|1300602_1302138_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_017394805.1|1302216_1302867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076612069.1|1304434_1305524_+|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_080591920.1|1306228_1306405_+	glycohydrolase toxin TNT-related protein	NA	NA	NA	NA	NA
WP_008941952.1|1307678_1309604_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_002058090.1|1309822_1310305_+	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_002058125.1|1310329_1311322_+	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_002058083.1|1311357_1312437_+	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_016541979.1|1312447_1313011_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016541980.1|1313010_1314057_+	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_008941947.1|1314049_1314340_+	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_016541981.1|1314350_1315652_+	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017396274.1|1315734_1315977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076612069.1|1319342_1320433_-|transposase	IS4-like element ISAba33 family transposase	transposase	NA	NA	NA	NA
WP_008941939.1|1320867_1321353_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	55.4	4.1e-42
WP_008941938.1|1321537_1321693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941937.1|1321978_1322221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941936.1|1322314_1322521_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_008941935.1|1322618_1324100_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	31.5	1.3e-33
WP_008941934.1|1324099_1325299_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_017395925.1|1325383_1326529_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_008941922.1|1329088_1329538_-	cyanase	NA	NA	NA	NA	NA
WP_008303564.1|1329818_1330628_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_008941921.1|1330679_1332404_+	bifunctional protein-serine/threonine kinase/phosphatase	NA	D7F602	Apocheima_cinerarium_nucleopolyhedrovirus	23.0	6.9e-07
WP_005089862.1|1334163_1334340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125316763.1|1334669_1335834_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
WP_004639604.1|1335955_1336165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161403048.1|1336654_1336774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639601.1|1337549_1338233_-	pirin family protein	NA	NA	NA	NA	NA
WP_004639599.1|1338425_1339769_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	79.4	7.6e-54
WP_004639597.1|1339999_1340389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004639596.1|1340558_1342589_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_160140320.1|1343321_1344411_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	1640151	1662984	3550511	protease,transposase	uncultured_Mediterranean_phage(11.11%)	24	NA	NA
WP_005080553.1|1640151_1640565_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	47.1	9.0e-14
WP_004639237.1|1640777_1640900_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	NA	NA	NA	NA
WP_115736404.1|1640996_1643282_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.2	2.0e-163
WP_115736405.1|1643281_1643644_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	58.5	1.2e-25
WP_005080559.1|1644035_1645079_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A1Z1LZD8	Serratia_phage	45.7	7.9e-83
WP_115736406.1|1645137_1646058_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_115736407.1|1646078_1646618_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_115736408.1|1646693_1648766_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017396081.1|1648838_1649255_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_125316763.1|1649433_1650598_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
WP_160140451.1|1650620_1651280_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_115736409.1|1651301_1652390_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_115736410.1|1652461_1652902_-	internalin	NA	NA	NA	NA	NA
WP_115736411.1|1653270_1654908_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.8	2.8e-151
WP_004639225.1|1654940_1655798_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.4	1.1e-50
WP_004639224.1|1655889_1657179_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.5	1.1e-137
WP_004639223.1|1657308_1657674_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_115736412.1|1657663_1658371_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_005090442.1|1658497_1658974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017396077.1|1659032_1659797_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004639219.1|1659793_1660165_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_020846310.1|1660402_1661335_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_005080585.1|1661428_1661842_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_160140320.1|1661893_1662984_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	1680174	1717164	3550511	transposase	Escherichia_phage(40.0%)	25	NA	NA
WP_004678526.1|1680174_1680876_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_008942430.1|1681825_1682701_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_008942429.1|1682708_1683713_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_161412296.1|1683813_1684698_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_008942427.1|1684845_1685847_+	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_005080626.1|1685908_1686784_-	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_160140320.1|1687040_1688131_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_008942425.1|1688654_1689722_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_004639199.1|1689747_1691295_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_079283381.1|1691420_1692446_-|transposase	IS30-like element ISAba125 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_008942423.1|1694613_1696200_+	GH3 auxin-responsive promoter family protein	NA	NA	NA	NA	NA
WP_125316793.1|1696266_1697485_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	1.5e-77
WP_161417935.1|1697613_1698837_+	TolC family protein	NA	NA	NA	NA	NA
WP_008942421.1|1698848_1700018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115736415.1|1700322_1702527_+	OsmC domain/YcaO domain-containing protein	NA	NA	NA	NA	NA
WP_115736416.1|1702862_1703936_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004961928.1|1703951_1704782_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_115736417.1|1704857_1705496_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004639193.1|1705626_1706106_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_115736418.1|1706377_1707115_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_008942416.1|1707132_1707786_+	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_115736419.1|1707789_1711401_+	urea carboxylase	NA	NA	NA	NA	NA
WP_160140357.1|1711432_1712473_-|transposase	IS481 family transposase	transposase	A0A077SLK2	Escherichia_phage	82.4	6.1e-168
WP_020846310.1|1714183_1715116_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_160140320.1|1716074_1717164_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	2126672	2194765	3550511	protease,transposase,tRNA	Burkholderia_virus(21.43%)	56	NA	NA
WP_004638533.1|2126672_2127407_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_125316774.1|2127423_2128203_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_005082082.1|2128199_2128802_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_005082080.1|2128874_2130425_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_171057159.1|2131076_2131643_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_005082076.1|2131747_2132725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082071.1|2133101_2134421_-	adenylosuccinate synthase	NA	A0A2P1EKE7	Megavirus	36.5	1.1e-68
WP_005082069.1|2134481_2135648_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_005082067.1|2136003_2136372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005082064.1|2136452_2136767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005082062.1|2136800_2137826_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_171057157.1|2138081_2140730_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.1	2.0e-77
WP_004638520.1|2140793_2142074_+	aspartate kinase	NA	NA	NA	NA	NA
WP_005082058.1|2142306_2142570_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	9.1e-12
WP_005082056.1|2142621_2143188_-	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	44.7	2.8e-26
WP_004642122.1|2143227_2143608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004638518.1|2143824_2144379_+	cytochrome b	NA	NA	NA	NA	NA
WP_005082053.1|2144422_2145421_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_004638516.1|2145499_2146819_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.0	4.1e-60
WP_115736073.1|2147025_2148251_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	3.5e-21
WP_005082051.1|2148461_2148647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005082048.1|2148834_2151015_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_005091002.1|2151331_2151604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082046.1|2151780_2153838_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_115736073.1|2153928_2155153_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	3.5e-21
WP_125269079.1|2155482_2156701_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.9	2.4e-78
WP_160140452.1|2156751_2157666_+	AraC family transcriptional regulator ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005082042.1|2157761_2158385_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_005082041.1|2159143_2159476_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017394626.1|2159577_2161458_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_160140363.1|2161709_2162096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082037.1|2162294_2163197_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005091003.1|2163211_2164075_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_001086304.1|2164451_2164721_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005082034.1|2164803_2166378_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.0	9.2e-67
WP_004638502.1|2166483_2167770_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_005082033.1|2168373_2169246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005082032.1|2169314_2170340_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	39.0	1.5e-30
WP_004638497.1|2170336_2171032_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005082029.1|2171945_2172932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004638494.1|2173301_2174033_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004638493.1|2174331_2174538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004638491.1|2174853_2176236_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	31.4	4.5e-41
WP_005082028.1|2176310_2177147_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_005082027.1|2177169_2177889_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_085945696.1|2178028_2179248_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.9	2.4e-78
WP_005082026.1|2179313_2182163_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_005082025.1|2182381_2184652_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_005082023.1|2184745_2185975_+	multifunctional CCA addition/repair protein	NA	A0A0S1S197	Klebsiella_phage	42.7	8.8e-81
WP_005082022.1|2186030_2186906_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_005082020.1|2187045_2187798_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_005082019.1|2188298_2189123_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004638481.1|2189315_2190374_+	OmpW family protein	NA	NA	NA	NA	NA
WP_005082017.1|2190764_2192111_+	MFS transporter	NA	NA	NA	NA	NA
WP_017394374.1|2192193_2193405_+	alginate export family protein	NA	NA	NA	NA	NA
WP_115736073.1|2193539_2194765_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	33.1	3.5e-21
>prophage 13
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	2206080	2228168	3550511	transposase	Acinetobacter_phage(66.67%)	21	NA	NA
WP_160140324.1|2206080_2207013_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	7.1e-59
WP_164743271.1|2207077_2207335_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_160140453.1|2207426_2207783_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005091018.1|2207979_2209341_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_005091019.1|2209434_2210229_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_005082005.1|2210509_2211559_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	88.0	4.3e-169
WP_160140366.1|2211568_2212375_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	89.2	9.3e-132
WP_001055585.1|2212702_2213086_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000618091.1|2213082_2213418_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_005080957.1|2213492_2215076_+|transposase	IS66-like element ISAba25 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	9.4e-144
WP_100607972.1|2215705_2216835_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_026056331.1|2218039_2218729_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	82.1	1.2e-98
WP_017394508.1|2218819_2219368_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	94.5	6.4e-92
WP_004638451.1|2219382_2219745_+	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_160140367.1|2221532_2221937_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_160140453.1|2222028_2222385_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_160140368.1|2222695_2223166_-	DUF3015 family protein	NA	NA	NA	NA	NA
WP_008940950.1|2223355_2224120_-	DUF817 family protein	NA	NA	NA	NA	NA
WP_005091031.1|2224205_2225279_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_004638446.1|2225476_2226715_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_100607972.1|2227038_2228168_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	2269102	2330705	3550511	protease,transposase	Escherichia_phage(30.0%)	54	NA	NA
WP_160140372.1|2269102_2270322_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	6.9e-78
WP_017395805.1|2270563_2271910_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_005091071.1|2272424_2273180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008940937.1|2273182_2274343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160140453.1|2274473_2274830_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_160140367.1|2274921_2275326_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_160140373.1|2275373_2276852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091075.1|2276844_2277762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160140453.1|2277775_2278132_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_160140367.1|2278223_2278628_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_160140374.1|2278713_2281323_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	53.4	7.4e-287
WP_005091082.1|2281495_2282293_+	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_162920335.1|2282309_2282981_+	endonuclease III	NA	NA	NA	NA	NA
WP_005091085.1|2282977_2283160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171055741.1|2283221_2283884_-	adenylate kinase	NA	NA	NA	NA	NA
WP_004638396.1|2283957_2285271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005081912.1|2285332_2285851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004638394.1|2286092_2288078_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004638393.1|2288077_2288626_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_160140375.1|2288605_2289022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100607972.1|2289262_2290392_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_160140376.1|2291216_2291864_+	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_160140377.1|2291893_2294080_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_160140378.1|2294324_2295287_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	25.4	2.7e-21
WP_171055781.1|2295555_2296422_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.7	1.3e-14
WP_171502763.1|2296481_2297855_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_075315912.1|2297875_2299255_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_115736533.1|2299353_2300385_-	substrate-binding domain-containing protein	NA	A0A1B1IWY0	uncultured_Mediterranean_phage	40.1	2.5e-65
WP_125269079.1|2300832_2302052_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.9	2.4e-78
WP_017394961.1|2302248_2303301_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_160140380.1|2303375_2304908_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_160140381.1|2304911_2306282_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.3	4.5e-25
WP_005091100.1|2306749_2307451_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_075315916.1|2307500_2308133_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005081881.1|2308247_2308715_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_005091108.1|2308761_2309856_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_005091110.1|2309870_2310938_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_004638372.1|2311078_2311774_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_005081876.1|2311796_2312885_-	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_004638370.1|2313132_2313627_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222Z0F3	Streptomyces_phage	28.7	5.4e-05
WP_005091112.1|2313682_2316511_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.5e-22
WP_171057914.1|2316697_2317342_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_005081869.1|2317484_2317901_-	heme-binding protein	NA	NA	NA	NA	NA
WP_004638366.1|2318250_2319549_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_005091118.1|2319633_2320245_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_005081836.1|2320397_2320769_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_005091120.1|2320967_2322416_+	CYTH and CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_005091123.1|2322681_2323314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004638360.1|2323417_2323804_+	DUF3144 domain-containing protein	NA	NA	NA	NA	NA
WP_005091128.1|2323864_2324830_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_005091130.1|2324995_2327764_-	insulinase family protein	NA	NA	NA	NA	NA
WP_005091132.1|2327903_2328722_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_160140382.1|2328947_2329466_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_087486619.1|2329486_2330705_+|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
>prophage 15
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	2335137	2392444	3550511	protease,transposase	Enterobacteria_phage(27.27%)	49	NA	NA
WP_020846310.1|2335137_2336070_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_008940922.1|2336323_2338555_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_004638351.1|2339032_2339431_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_008940921.1|2339588_2341292_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_017396684.1|2341458_2342775_+	D-alanyl-D-alanine carboxypeptidase PBP6B	NA	B6DZZ7	Stx2-converting_phage	38.2	3.2e-36
WP_008940919.1|2342868_2344155_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004638347.1|2344276_2344759_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_008940918.1|2344877_2346308_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	32.6	3.0e-56
WP_160132048.1|2346465_2347215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008940916.1|2347214_2348120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004638342.1|2348106_2349357_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_125316787.1|2349357_2351205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004638340.1|2351182_2352064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004638339.1|2352099_2353314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004638338.1|2353534_2354236_+	VIT family protein	NA	NA	NA	NA	NA
WP_075315936.1|2354442_2354901_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_005081790.1|2355054_2356488_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017395778.1|2356489_2357494_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_125316789.1|2357770_2358814_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_005091161.1|2358862_2360941_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004638331.1|2361096_2361768_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_004638330.1|2361866_2362670_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_017395776.1|2362931_2363360_+	VOC family protein	NA	NA	NA	NA	NA
WP_125316790.1|2363440_2365927_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_004638327.1|2365923_2366628_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.7e-33
WP_171287615.1|2366671_2367295_+	arylesterase	NA	NA	NA	NA	NA
WP_153568177.1|2367316_2367754_-	AAC(6')-Ighjkrstuvwx family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
WP_005081763.1|2367838_2368453_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_005091172.1|2368714_2369722_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005091177.1|2369746_2370754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005091179.1|2370788_2372828_-	ligand-gated channel protein	NA	A0A0P0I887	Acinetobacter_phage	30.7	2.3e-09
WP_005091180.1|2373002_2373641_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_004638319.1|2373794_2374412_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_005081751.1|2374627_2374807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008940900.1|2374855_2375842_-	EF-P lysine aminoacylase GenX	NA	A0A1V0SAC0	Catovirus	27.8	5.5e-25
WP_008940899.1|2375838_2376906_-	4-phosphoerythronate dehydrogenase	NA	A0A285PXZ1	Cedratvirus	31.4	1.7e-19
WP_005081744.1|2377097_2377472_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_005091188.1|2377527_2378265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160140453.1|2379541_2379898_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_160140367.1|2379989_2380394_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_160140385.1|2381002_2382109_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_160140386.1|2382102_2382702_+	DUF4276 family protein	NA	NA	NA	NA	NA
WP_020846310.1|2383717_2384650_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	1.8e-57
WP_004638311.1|2385093_2386728_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	60.6	2.1e-175
WP_004652030.1|2386785_2387076_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.4	2.2e-14
WP_004638309.1|2387267_2388020_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_160140388.1|2388000_2388939_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_004638306.1|2389335_2391165_+	phosphoenolpyruvate carboxykinase (GTP)	NA	NA	NA	NA	NA
WP_160140389.1|2391511_2392444_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.5	3.0e-57
>prophage 16
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	2499719	2559065	3550511	transposase,integrase,tRNA	uncultured_virus(20.0%)	50	2506147:2506163	2530248:2530264
WP_005091373.1|2499719_2500451_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_005091376.1|2500479_2501295_+	arginyltransferase	NA	NA	NA	NA	NA
WP_005091378.1|2501280_2501730_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_004638188.1|2501834_2502719_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_160140393.1|2502925_2503816_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_005081540.1|2504017_2505208_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.6	6.2e-15
WP_004638187.1|2505300_2507439_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	24.7	2.4e-49
2506147:2506163	attL	CATTTTTTCTTGGTCAG	NA	NA	NA	NA
WP_004638185.1|2507616_2508087_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_004638184.1|2508247_2508622_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_005091386.1|2508793_2510131_-	EcsC family protein	NA	NA	NA	NA	NA
WP_004638181.1|2510421_2511651_+	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_005091388.1|2511683_2512136_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_005081534.1|2512210_2512735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005081532.1|2512790_2512955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091392.1|2513799_2515425_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.7	4.8e-95
WP_005091394.1|2515417_2516449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005081519.1|2517385_2517649_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	56.2	3.1e-20
WP_004638166.1|2517650_2518142_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	44.9	5.3e-29
WP_005091398.1|2518458_2519706_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0P0IRB7	Acinetobacter_phage	56.9	2.9e-124
WP_005091401.1|2520183_2520549_-	copper-binding protein	NA	NA	NA	NA	NA
WP_005091403.1|2520582_2523729_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_005091405.1|2523742_2525242_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_005091408.1|2525241_2526546_-	TolC family protein	NA	NA	NA	NA	NA
WP_004678526.1|2526842_2527544_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_087486619.1|2529240_2530460_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
2530248:2530264	attR	CATTTTTTCTTGGTCAG	NA	NA	NA	NA
WP_004699719.1|2531093_2531351_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_005091417.1|2531361_2532657_-	cation transporter	NA	NA	NA	NA	NA
WP_004880426.1|2532741_2533146_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_005091419.1|2533195_2534077_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_005091421.1|2534063_2536043_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_005091424.1|2536120_2536423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002058525.1|2536571_2537255_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.2	2.1e-31
WP_005091426.1|2537244_2538621_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_004880442.1|2538694_2541040_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.1	1.8e-87
WP_005091429.1|2541317_2541698_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_005091431.1|2541765_2542647_+	CopD family protein	NA	NA	NA	NA	NA
WP_005091433.1|2542662_2542935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005091434.1|2543038_2543935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091435.1|2544078_2545218_-	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	43.0	6.7e-43
WP_005091436.1|2545447_2546521_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	38.5	1.0e-56
WP_005091437.1|2546577_2546877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087486619.1|2547093_2548313_-|transposase	IS3-like element ISAba19 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.5	1.8e-78
WP_005091439.1|2548797_2549673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091440.1|2549705_2550071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091441.1|2550071_2551196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091442.1|2551658_2552579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091443.1|2552682_2553681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118901380.1|2554086_2555245_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	39.1	1.5e-50
WP_125316813.1|2555213_2557688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004678526.1|2558363_2559065_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
>prophage 17
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	2614820	2685985	3550511	tRNA,transposase	uncultured_virus(28.57%)	58	NA	NA
WP_100833738.1|2614820_2615950_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_008941832.1|2616003_2617311_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	24.3	3.0e-18
WP_008941834.1|2617646_2618390_-	hydrolase	NA	NA	NA	NA	NA
WP_008941835.1|2618400_2618745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005081431.1|2618872_2619454_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_004638102.1|2619496_2619961_-	bacterioferritin	NA	NA	NA	NA	NA
WP_017396565.1|2620314_2621370_+	aldehyde reductase	NA	NA	NA	NA	NA
WP_008941837.1|2621425_2623453_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	38.6	1.6e-124
WP_008941838.1|2623525_2624563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008941839.1|2624870_2628329_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_005081419.1|2628339_2629035_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005081417.1|2629403_2630204_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_008941840.1|2630229_2630985_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_008941841.1|2631000_2631744_+	pantothenate kinase	NA	NA	NA	NA	NA
WP_017396564.1|2631713_2632286_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004638090.1|2633743_2635153_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_017396462.1|2635300_2636110_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_161412422.1|2636211_2637120_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_017396463.1|2637257_2638250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035374992.1|2640584_2641517_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	40.9	9.3e-59
WP_003653416.1|2641662_2642232_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.0	4.3e-75
WP_008941849.1|2642332_2642926_-	LysE family transporter	NA	NA	NA	NA	NA
WP_008941850.1|2643229_2643772_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_017394969.1|2643923_2644928_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_004678526.1|2645135_2645837_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_004638077.1|2646131_2647364_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_008941853.1|2647591_2648041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026056257.1|2648228_2648771_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004638073.1|2648872_2649370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017396445.1|2649462_2651532_+|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_008941856.1|2651782_2651983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160140396.1|2655731_2656616_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_026070424.1|2656652_2657855_+	aminoacetone oxidase family FAD-binding enzyme	NA	NA	NA	NA	NA
WP_004638069.1|2657919_2658093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035375201.1|2658378_2659941_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_005081354.1|2660166_2660367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005091558.1|2660572_2660995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113997656.1|2661029_2661791_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_005091563.1|2661899_2662784_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004678526.1|2663377_2664079_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_004638062.1|2664371_2664665_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_118903169.1|2664784_2665420_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_160140397.1|2665526_2667023_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_004638059.1|2667026_2668625_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_004638058.1|2668626_2670522_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_004638057.1|2670518_2670827_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_171055772.1|2670826_2671345_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_004638055.1|2671344_2671887_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_004638054.1|2671905_2672922_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_005091568.1|2672925_2675610_-	NADH-quinone oxidoreductase subunit NuoG	NA	NA	NA	NA	NA
WP_005091570.1|2675621_2676950_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_004638051.1|2676946_2677456_-	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_004638050.1|2677468_2679256_-	NADH-quinone oxidoreductase subunit C/D	NA	NA	NA	NA	NA
WP_004638049.1|2679344_2680022_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_171055685.1|2680028_2680508_-	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_160140320.1|2681006_2682096_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_118903171.1|2682168_2683587_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	36.3	2.6e-20
WP_080591894.1|2684956_2685985_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	2815538	2876857	3550511	tRNA,integrase,transposase	Staphylococcus_phage(14.29%)	52	2818319:2818335	2859594:2859610
WP_010326927.1|2815538_2816564_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_160140455.1|2816576_2817599_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_160140400.1|2817681_2820438_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.5	2.7e-90
2818319:2818335	attL	GTTACAAAAGCATCATT	NA	NA	NA	NA
WP_160140401.1|2820667_2821663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085945696.1|2821710_2822929_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.9	2.4e-78
WP_151959128.1|2823205_2823562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160140402.1|2823681_2824293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151959082.1|2824317_2824956_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_160140403.1|2826012_2828088_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004914896.1|2828168_2828402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151831402.1|2829061_2829295_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_125316793.1|2829990_2831210_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	52.6	1.5e-77
WP_112987394.1|2831787_2832834_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	37.1	8.0e-59
WP_160140404.1|2832851_2833118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112987392.1|2833239_2834133_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_112987391.1|2834603_2835521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160140405.1|2835522_2836722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112987389.1|2836879_2837149_+	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_112987388.1|2837141_2838278_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8L8	uncultured_Caudovirales_phage	45.6	1.9e-90
WP_160140406.1|2838412_2839432_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_004637913.1|2839689_2840145_+	CHAP domain-containing protein	NA	D5GVH7	Campylobacter_virus	43.2	1.3e-13
WP_005092264.1|2840167_2840959_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	28.5	3.5e-14
WP_005092262.1|2841021_2842215_-	MFS transporter	NA	NA	NA	NA	NA
WP_005092261.1|2842320_2845077_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_005092259.1|2845202_2846018_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005092258.1|2846079_2846976_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_005092256.1|2847082_2847901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017396220.1|2847974_2849564_-	peptide chain release factor 3	NA	A0A2K9L2P9	Tupanvirus	32.9	1.1e-11
WP_017396219.1|2849746_2850751_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	26.7	1.5e-06
WP_160126664.1|2850774_2853909_-	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_160126666.1|2854003_2855227_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_160126667.1|2855228_2857985_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	40.0	1.2e-88
WP_017396215.1|2858149_2858851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017396214.1|2858837_2859281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017396213.1|2859277_2860378_-	hypothetical protein	NA	NA	NA	NA	NA
2859594:2859610	attR	AATGATGCTTTTGTAAC	NA	NA	NA	NA
WP_017396212.1|2860528_2860759_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_017396211.1|2860856_2861786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017396210.1|2861966_2863007_-	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	36.6	4.7e-43
WP_017396209.1|2863175_2864219_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	39.2	2.5e-60
WP_026070451.1|2864277_2864577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005002354.1|2864779_2865196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031995672.1|2865324_2867391_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_031995669.1|2868021_2868276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017394886.1|2868407_2868635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017394885.1|2868647_2869304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017394884.1|2870122_2870842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005146791.1|2870851_2871775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160140320.1|2871995_2873085_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_031995668.1|2873117_2874062_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_005083376.1|2874432_2874816_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_005080771.1|2874812_2875157_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_160140359.1|2875231_2876857_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	54.0	3.7e-143
>prophage 19
NZ_CP031991	Acinetobacter haemolyticus strain 2126ch chromosome, complete genome	3550511	3339687	3406974	3550511	transposase,integrase,tRNA	Faecalibacterium_phage(16.67%)	58	3358877:3358922	3421808:3421853
WP_115736213.1|3339687_3341487_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075316386.1|3341790_3342402_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_005085700.1|3342460_3343114_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_115736214.1|3343210_3343609_-	OsmC family protein	NA	NA	NA	NA	NA
WP_115736215.1|3343605_3344553_-	pirin family protein	NA	NA	NA	NA	NA
WP_080592133.1|3344706_3344889_-	DUF2798 domain-containing protein	NA	NA	NA	NA	NA
WP_005085705.1|3345121_3345613_-	flavin reductase	NA	NA	NA	NA	NA
WP_004637464.1|3345798_3346827_-	methionine synthase	NA	NA	NA	NA	NA
WP_115736216.1|3346854_3347856_-	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_160140407.1|3348223_3350662_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_004637461.1|3350710_3352279_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	8.7e-25
WP_171055760.1|3352726_3353953_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_005085711.1|3354010_3354379_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_004637457.1|3354511_3354934_-	DoxX family protein	NA	NA	NA	NA	NA
WP_115736218.1|3355158_3355800_+	DedA family protein	NA	NA	NA	NA	NA
WP_005085714.1|3355823_3356414_-	LysE family transporter	NA	NA	NA	NA	NA
WP_004637453.1|3356626_3357013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115736219.1|3357022_3357865_-	ParA family protein	NA	V5UP47	Mycobacterium_phage	24.3	4.2e-10
WP_115736220.1|3357945_3358338_-	SirB2 family protein	NA	NA	NA	NA	NA
WP_115736221.1|3358347_3358656_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
3358877:3358922	attL	CTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCA	NA	NA	NA	NA
WP_087540503.1|3359520_3359745_-	helix-turn-helix transcriptional regulator	NA	S5MTW4	Brevibacillus_phage	48.4	1.5e-07
WP_004858367.1|3359857_3360067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039047371.1|3360086_3361268_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	30.6	7.2e-40
WP_004858371.1|3361260_3361509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160140408.1|3361577_3362114_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_039047369.1|3362124_3362871_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	37.5	1.0e-44
WP_079270859.1|3363806_3364202_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_039047368.1|3364361_3366440_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004907087.1|3366552_3367821_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
WP_004985732.1|3367870_3369463_-	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_004985737.1|3369603_3370728_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004985739.1|3370729_3373486_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	3.4e-24
WP_004907097.1|3373482_3374541_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004985741.1|3374559_3375957_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010326927.1|3376440_3377466_+|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
WP_125316847.1|3378282_3379701_+	phosphate--AMP phosphotransferase	NA	NA	NA	NA	NA
WP_100834159.1|3380254_3380926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000004527.1|3380925_3383253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000557620.1|3386541_3386904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001060549.1|3387027_3389388_+	DEAD/DEAH box helicase family protein	NA	W8W2E1	Invertebrate_iridovirus	29.2	1.3e-32
WP_001005874.1|3389674_3389983_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016164863.1|3389979_3391269_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_160140409.1|3391286_3394634_-	SWIM zinc finger family protein	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	31.4	4.0e-51
WP_005092561.1|3395964_3396885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118902211.1|3396907_3397840_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.2	5.5e-59
WP_000734101.1|3397952_3398273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733361.1|3398396_3398780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160124306.1|3398804_3398942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040037.1|3398982_3399915_-|transposase	IS5-like element ISAha2 family transposase	transposase	Q1MVF0	Enterobacteria_phage	41.6	1.9e-59
WP_017396282.1|3400498_3401761_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_004985675.1|3401925_3402567_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004985679.1|3402667_3403066_-	OsmC family protein	NA	NA	NA	NA	NA
WP_004985681.1|3403062_3404010_-	pirin family protein	NA	NA	NA	NA	NA
WP_004985683.1|3404315_3404618_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_004985684.1|3404644_3405034_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_004985686.1|3405048_3405573_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160140410.1|3405742_3405958_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010326927.1|3405948_3406974_-|transposase	IS30 family transposase	transposase	A0A2K9V2S9	Faecalibacterium_phage	30.7	8.8e-26
3421808:3421853	attR	CTTGCCAAGGTTGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCA	NA	NA	NA	NA
>prophage 1
NZ_CP031993	Acinetobacter haemolyticus strain 2126ch plasmid pAhaem2126che, complete sequence	21807	0	7556	21807	transposase	Mycobacterium_phage(33.33%)	10	NA	NA
WP_005086339.1|0_936_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	41.7	2.0e-56
WP_017394741.1|1004_1550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151800612.1|1767_2295_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	28.8	4.8e-12
WP_044425274.1|2400_2649_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_035270373.1|2645_2981_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	45.7	3.1e-20
WP_005331680.1|3094_3943_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.2	1.1e-05
WP_005331677.1|4043_5279_+	alpha/beta fold hydrolase	NA	A0A0B5A484	Mycobacterium_phage	25.6	2.5e-11
WP_005091751.1|5492_5804_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_005091750.1|5766_6081_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_125316763.1|6390_7556_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	84.9	1.3e-137
