The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019288	Kordia antarctica strain IMCC3317 chromosome, complete genome	5500985	1049120	1065183	5500985	tail,plate	Shigella_phage(33.33%)	18	NA	NA
WP_160128226.1|1049120_1052213_-|plate	baseplate J/gp47 family protein	plate	NA	NA	NA	NA
WP_160128227.1|1052215_1052629_-	GPW/gp25 family protein	NA	E3SF05	Shigella_phage	31.0	7.9e-10
WP_160128228.1|1052632_1052923_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_160128229.1|1052944_1054687_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_160128230.1|1054683_1055445_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_160128231.1|1055447_1055603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160128232.1|1055602_1056076_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_160128233.1|1056081_1056519_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_160128234.1|1056604_1058527_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A1C3NFI6	Phage_NCTB	28.7	6.3e-09
WP_160128235.1|1058559_1059105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160128236.1|1059097_1059664_-	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_160128237.1|1059935_1060565_-	dTMP kinase	NA	S5VV47	Pseudomonas_phage	27.8	2.2e-11
WP_160128238.1|1061308_1061989_-	response regulator	NA	NA	NA	NA	NA
WP_160128239.1|1062001_1062796_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_160128240.1|1062795_1063461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160128241.1|1063478_1063853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160128242.1|1064087_1064609_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_160128243.1|1064661_1065183_+|tail	tail fiber protein	tail	NA	NA	NA	NA
>prophage 2
NZ_CP019288	Kordia antarctica strain IMCC3317 chromosome, complete genome	5500985	2978009	3041017	5500985	protease,integrase,transposase,tail	Acinetobacter_phage(14.29%)	52	2975074:2975093	3013103:3013122
2975074:2975093	attL	ATTCCTGCCTACGCAGGAAT	NA	NA	NA	NA
WP_160129810.1|2978009_2978858_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.8	1.5e-15
WP_160129811.1|2978860_2979253_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_160129812.1|2979486_2980221_-	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_160129813.1|2980222_2980861_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_160129814.1|2980998_2982315_+	adenosylhomocysteinase	NA	NA	NA	NA	NA
WP_160129815.1|2982861_2984559_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160129816.1|2984636_2984810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129817.1|2984926_2985832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129818.1|2986184_2987861_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_160129819.1|2988236_2988422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129820.1|2988562_2989318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160129821.1|2989465_2990185_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_160129822.1|2990181_2991186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160129823.1|2991231_2992146_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	29.7	6.6e-25
WP_160129824.1|2992390_2994523_+	peptidase M3	NA	NA	NA	NA	NA
WP_160129825.1|2994845_2995106_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_160129826.1|2995148_2995787_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_160129827.1|2995869_2996316_-	DUF4199 family protein	NA	NA	NA	NA	NA
WP_160129828.1|2996485_2997814_+	insulinase family protein	NA	NA	NA	NA	NA
WP_160129829.1|2997821_2999915_+	insulinase family protein	NA	A0A1E1EST3	Acanthamoeba_castellanii_mimivirus	22.9	1.0e-12
WP_160129830.1|2999992_3000880_-	EamA family transporter	NA	NA	NA	NA	NA
WP_160129831.1|3001011_3001557_+	cation transporter	NA	NA	NA	NA	NA
WP_160129832.1|3002058_3004539_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_160129833.1|3004802_3006014_+	SufS family cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.9	1.1e-96
WP_160129834.1|3006271_3007309_+|protease	zinc metalloprotease	protease	A0A2K9KZL9	Tupanvirus	31.0	1.1e-20
WP_160129835.1|3007402_3007861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129836.1|3007913_3008336_+	SufE family protein	NA	NA	NA	NA	NA
WP_160129837.1|3008350_3008677_+	DUF59 domain-containing protein	NA	NA	NA	NA	NA
WP_160129838.1|3008685_3009192_+	DUF2480 family protein	NA	NA	NA	NA	NA
WP_160129839.1|3009309_3010233_+	DUF3078 domain-containing protein	NA	NA	NA	NA	NA
WP_160129840.1|3010496_3011351_-	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_160129841.1|3012377_3013016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129842.1|3013127_3015527_-	hypothetical protein	NA	NA	NA	NA	NA
3013103:3013122	attR	ATTCCTGCCTACGCAGGAAT	NA	NA	NA	NA
WP_160129843.1|3015802_3017197_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_160129844.1|3017196_3017913_+	response regulator	NA	NA	NA	NA	NA
WP_160129845.1|3017931_3019158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129846.1|3019353_3019554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129847.1|3019635_3020847_-	GTPase HflX	NA	NA	NA	NA	NA
WP_160129848.1|3020931_3021894_+	endonuclease	NA	NA	NA	NA	NA
WP_160129849.1|3021986_3027437_+	gliding motility-associated C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_160129850.1|3027493_3028411_+	PorP/SprF family type IX secretion system membrane protein	NA	NA	NA	NA	NA
WP_160129851.1|3028431_3030312_+	OmpA family protein	NA	NA	NA	NA	NA
WP_160129852.1|3030425_3030818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129853.1|3030827_3033416_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_160129854.1|3033415_3034093_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_160129855.1|3034217_3035042_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_160129856.1|3035257_3036175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129857.1|3036328_3037180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129858.1|3037466_3038042_+	DUF4255 domain-containing protein	NA	NA	NA	NA	NA
WP_160129859.1|3038041_3038857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160129860.1|3038909_3040490_+|tail	phage tail sheath family protein	tail	J9PVC2	Bacillus_phage	37.6	7.0e-22
WP_160129861.1|3040555_3041017_+|tail	phage tail protein	tail	T2KSM5	uncultured_phage	45.0	2.0e-22
>prophage 3
NZ_CP019288	Kordia antarctica strain IMCC3317 chromosome, complete genome	5500985	3338723	3347689	5500985		Bacillus_phage(33.33%)	8	NA	NA
WP_160130092.1|3338723_3340163_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	40.6	3.7e-78
WP_160130093.1|3340175_3340721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160130094.1|3340740_3341943_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	A0A127AXI2	Bacillus_phage	27.2	9.0e-30
WP_160130095.1|3341951_3343079_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.3	1.7e-30
WP_160130096.1|3343109_3344369_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	27.1	8.5e-23
WP_160131923.1|3344358_3345354_-	GDP-mannose 4,6-dehydratase	NA	A0A2K9L4U8	Tupanvirus	49.8	3.2e-81
WP_160130097.1|3345758_3346556_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_160130098.1|3346615_3347689_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	30.7	2.9e-27
