The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047602	Thermoanaerobacterium aotearoense strain SCUT27 chromosome, complete genome	2668690	3906	65251	2668690	transposase,tRNA,protease	Bacillus_phage(27.78%)	58	NA	NA
WP_014757490.1|3906_5283_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_014757489.1|5291_7163_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_014757488.1|7167_7890_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_014757487.1|7907_8354_+	NUDIX hydrolase	NA	A0A1L2CUR5	Pectobacterium_phage	32.4	2.2e-05
WP_014757486.1|8462_9266_+	nucleoid occlusion protein	NA	S5VSZ7	Leptospira_phage	37.6	1.1e-15
WP_038068383.1|9353_10133_+	ParA family protein	NA	Q8JL10	Natrialba_phage	34.3	3.8e-21
WP_014757484.1|10125_10965_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	34.6	4.2e-18
WP_014757483.1|11062_12361_+	[FeFe] hydrogenase H-cluster radical SAM maturase HydE	NA	NA	NA	NA	NA
WP_014757482.1|12382_13528_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	31.8	1.9e-16
WP_014757481.1|13559_14063_+	DUF4446 family protein	NA	NA	NA	NA	NA
WP_014757480.1|14070_14943_+	diacylglycerol kinase family lipid kinase	NA	NA	NA	NA	NA
WP_014757479.1|15028_15850_+	cyanophycinase	NA	NA	NA	NA	NA
WP_014757478.1|15849_18477_+	cyanophycin synthetase	NA	A0A0B5IYG7	Pandoravirus	28.1	2.5e-08
WP_014757477.1|18478_19033_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	30.2	1.4e-14
WP_014757476.1|19170_19704_+	CvpA family protein	NA	NA	NA	NA	NA
WP_014757475.1|19721_20600_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_044983942.1|20577_20790_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_014757473.1|20855_21143_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_014757472.1|21165_21612_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	49.0	1.4e-28
WP_013789106.1|21624_21891_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_014757471.1|21952_22249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014757470.1|22271_23171_+	DUF2232 domain-containing protein	NA	NA	NA	NA	NA
WP_014757469.1|23207_25175_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_014757468.1|25174_25618_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_013789101.1|25683_27012_+	replicative DNA helicase	NA	O80281	Escherichia_phage	45.5	2.6e-102
WP_014757467.1|27028_27706_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_014757466.1|28085_29336_+	magnesium transporter	NA	NA	NA	NA	NA
WP_014757465.1|29342_30578_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_014757464.1|30704_31379_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.5	8.6e-38
WP_014757463.1|31378_32746_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_014757462.1|32825_32996_+	DUF1427 family protein	NA	NA	NA	NA	NA
WP_014757461.1|33048_34293_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	65.5	2.2e-10
WP_014757460.1|34279_34696_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_014757459.1|34692_35460_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_014757458.1|35733_37116_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014757457.1|37132_38419_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	38.4	6.2e-77
WP_014757454.1|40381_40996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014757453.1|41348_42116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038068384.1|42119_42392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014757451.1|42554_43118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102789862.1|43538_43772_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_160175232.1|43725_43980_+|transposase	transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.4	4.4e-11
WP_014757449.1|44474_45149_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	2.7e-39
WP_014757448.1|45247_46603_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.1	3.5e-22
WP_014757447.1|47234_48056_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_014757434.1|48478_49771_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.4	1.1e-28
WP_014757444.1|50243_51062_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_014757443.1|51064_52093_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_014757442.1|52463_53744_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_014757441.1|54123_55005_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_038069654.1|55037_55829_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014757439.1|55889_57380_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_038069650.1|57524_59006_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014757437.1|59009_60275_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014757436.1|60276_60642_+	DUF1667 domain-containing protein	NA	NA	NA	NA	NA
WP_014757434.1|61525_62818_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.4	1.1e-28
WP_014757433.1|63289_64462_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014757073.1|64810_65251_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	38.3	1.6e-21
>prophage 2
NZ_CP047602	Thermoanaerobacterium aotearoense strain SCUT27 chromosome, complete genome	2668690	77386	108741	2668690	transposase,integrase,protease	Bacillus_phage(44.44%)	27	81139:81157	84421:84439
WP_160175253.1|77386_78073_+|protease	serine protease	protease	A0A2H4JE36	uncultured_Caudovirales_phage	34.2	1.3e-28
WP_014757417.1|78270_78450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102789860.1|78503_78806_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014757415.1|78802_79675_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	37.3	1.7e-41
WP_014757414.1|79735_80509_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	52.5	1.1e-65
81139:81157	attL	TTTTATTTCTTTACATAAT	NA	NA	NA	NA
WP_014757412.1|81208_82441_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_014757409.1|85499_85823_+	AzlD domain-containing protein	NA	NA	NA	NA	NA
84421:84439	attR	ATTATGTAAAGAAATAAAA	NA	NA	NA	NA
WP_014757408.1|85904_86588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014757407.1|86831_87047_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_014757406.1|87120_87792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014757405.1|87853_88906_-	DUF1646 domain-containing protein	NA	NA	NA	NA	NA
WP_014757402.1|90652_91945_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.4	1.1e-28
WP_014757401.1|92419_92674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014757400.1|92815_94486_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_014757399.1|94641_95253_-	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_014757398.1|95392_96835_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_014757397.1|96831_97812_-	ATP-binding protein	NA	H7BWC4	unidentified_phage	34.8	3.0e-15
WP_014757396.1|97804_98776_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_014757395.1|98957_100196_+	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	50.9	8.4e-23
WP_014757394.1|100329_101145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014757393.1|101151_101847_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.5	1.1e-40
WP_014757392.1|101836_103534_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	33.9	5.7e-38
WP_014757391.1|103678_104074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014757390.1|104086_105331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014757389.1|105346_106165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014757388.1|106288_107539_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_038068644.1|107619_108741_+|protease	trypsin-like serine protease	protease	W5SAB9	Pithovirus	30.3	4.6e-12
>prophage 3
NZ_CP047602	Thermoanaerobacterium aotearoense strain SCUT27 chromosome, complete genome	2668690	667613	679018	2668690		Synechococcus_phage(22.22%)	11	NA	NA
WP_014759414.1|667613_669068_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	8.2e-102
WP_014759413.1|669080_670619_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	33.3	5.7e-21
WP_014759412.1|670692_670980_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_084214979.1|670969_671278_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_014759410.1|671714_673163_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.9	3.7e-46
WP_014759409.1|673242_673734_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	45.9	5.0e-27
WP_014759408.1|673733_674441_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	42.0	8.7e-41
WP_014759407.1|674450_675848_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.5	8.8e-61
WP_014759406.1|675864_676875_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	47.4	7.5e-70
WP_014759405.1|676871_677480_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.0	6.4e-24
WP_014759404.1|677491_679018_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.3	6.0e-71
>prophage 4
NZ_CP047602	Thermoanaerobacterium aotearoense strain SCUT27 chromosome, complete genome	2668690	790248	829086	2668690	portal,capsid,tail,integrase,terminase,protease,tRNA,head	Bacillus_phage(22.22%)	57	804293:804352	838757:838849
WP_014759303.1|790248_791358_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_014759302.1|791427_792129_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_014759301.1|792147_793104_+	class I mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_014759300.1|793420_794047_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_014759299.1|794400_794610_+	DUF3006 domain-containing protein	NA	Q0H256	Geobacillus_phage	46.9	3.0e-10
WP_014759298.1|794621_795542_+	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	54.1	8.0e-79
WP_014759297.1|795620_796691_+	glycoside hydrolase	NA	NA	NA	NA	NA
WP_013787622.1|796813_797590_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_014759296.1|797642_798131_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_013787624.1|798146_798716_+	LemA family protein	NA	NA	NA	NA	NA
WP_014759295.1|798728_799532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759294.1|799528_800551_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_013787627.1|800721_800943_+	NifU family protein	NA	NA	NA	NA	NA
WP_014759293.1|801054_802554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759292.1|802565_802712_+	small, acid-soluble spore protein, alpha/beta type	NA	NA	NA	NA	NA
WP_014759291.1|802754_803504_+	NAD-dependent protein deacylase	NA	S5M4R0	Bacillus_phage	31.5	7.3e-30
WP_013298441.1|803586_803790_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	60.0	4.3e-17
804293:804352	attL	GAGGTCTGCAAAACCTTTATCTCCAGTTCGAATCTGGATGCCGCCTCCATATTTATTCAA	NA	NA	NA	NA
WP_014759290.1|804437_805568_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	43.3	8.6e-75
WP_014759289.1|805710_806052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014759288.1|806075_808073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014759287.1|808190_808580_-	helix-turn-helix transcriptional regulator	NA	X5JA02	Clostridium_phage	37.9	7.2e-13
WP_038069695.1|808732_808978_+	helix-turn-helix transcriptional regulator	NA	A0A142LP09	Marinitoga_camini_virus	45.9	2.0e-05
WP_014759285.1|808993_809239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759284.1|809215_809572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014759283.1|809642_809933_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_014759282.1|809946_810159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759281.1|810172_810373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759280.1|810436_810871_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY71	Clostridium_phage	42.0	1.3e-23
WP_014759278.1|811080_811296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759277.1|811317_811509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759276.1|811508_812258_+	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	64.7	4.6e-56
WP_014759275.1|812257_812458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759274.1|812540_813413_+	hypothetical protein	NA	H7BWC5	unidentified_phage	44.2	4.2e-21
WP_014759273.1|813415_813952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759272.1|813953_814154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759271.1|814157_814559_+	hypothetical protein	NA	A0A1B1P7V7	Bacillus_phage	37.5	6.3e-12
WP_014759270.1|814562_814763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759269.1|814762_814951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038069720.1|815094_815457_+	hypothetical protein	NA	E5DV93	Deep-sea_thermophilic_phage	42.6	3.0e-13
WP_014759267.1|815456_815636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759266.1|815673_816165_+	DUF1492 domain-containing protein	NA	I3VYX3	Thermoanaerobacterium_phage	43.9	5.0e-27
WP_014759265.1|816319_817225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014759264.1|817302_817794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160175239.1|817845_818208_+	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	62.2	9.9e-33
WP_014759262.1|818235_818589_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	45.5	3.9e-18
WP_014759261.1|818595_820239_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	53.9	5.0e-172
WP_051408282.1|820253_821507_+|portal	phage portal protein	portal	A0A0A8WJ25	Clostridium_phage	36.7	8.1e-66
WP_084214976.1|821721_822432_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	58.7	4.0e-54
WP_014759258.1|822445_823663_+|capsid	phage major capsid protein	capsid	A0A1B0YA73	Lactobacillus_phage	22.8	1.2e-10
WP_014759257.1|823679_823970_+|head,tail	phage gp6-like head-tail connector protein	head,tail	R9TMB7	Paenibacillus_phage	63.6	7.9e-25
WP_044984080.1|823983_824283_+|head	phage head closure protein	head	R9TPZ2	Paenibacillus_phage	40.5	2.2e-09
WP_044984078.1|824335_824665_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	28.5	1.8e-09
WP_014759254.1|824661_824985_+	hypothetical protein	NA	A0A2I7SC10	Paenibacillus_phage	40.6	2.3e-12
WP_014759253.1|824985_825558_+|tail	phage major tail protein, phi13 family	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	39.2	8.3e-26
WP_014759252.1|825571_825868_+	hypothetical protein	NA	A0A288WGA9	Bacillus_phage	36.9	1.0e-06
WP_014759251.1|826074_826503_+	hypothetical protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.2	1.2e-05
WP_014759250.1|826548_829086_+|tail	phage tail tape measure protein	tail	A0A142KC22	Gordonia_phage	41.7	5.7e-34
838757:838849	attR	GAGGTCTGCAAAACCTTTATCTCCAGTTCGAATCTGGATGCCGCCTCCATATTTATTCAAGCGATATCAAGCCTTTCATGGCTTTTATTTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP047602	Thermoanaerobacterium aotearoense strain SCUT27 chromosome, complete genome	2668690	1383400	1393139	2668690	tRNA	Wolbachia_phage(16.67%)	10	NA	NA
WP_014758727.1|1383400_1385224_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.9	8.2e-75
WP_014758726.1|1385234_1386185_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_013788022.1|1386227_1386482_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_014758725.1|1386549_1387347_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_038068767.1|1387343_1387805_+	ribonuclease HI	NA	A0A0H3UZB5	Geobacillus_virus	50.7	5.7e-33
WP_014758723.1|1387896_1388880_+	tyrosine recombinase XerC	NA	S5M9V8	Brevibacillus_phage	27.7	9.3e-17
WP_014758722.1|1388938_1389562_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	54.2	1.9e-15
WP_014758721.1|1389585_1390872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014758720.1|1390876_1391767_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	44.7	9.2e-56
WP_014758719.1|1391843_1393139_-|tRNA	asparagine--tRNA ligase	tRNA	L7RCX2	Acanthamoeba_polyphaga_moumouvirus	34.3	4.6e-64
>prophage 6
NZ_CP047602	Thermoanaerobacterium aotearoense strain SCUT27 chromosome, complete genome	2668690	2468326	2478448	2668690		Hokovirus(28.57%)	9	NA	NA
WP_014757667.1|2468326_2469682_-	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	31.1	1.7e-21
WP_014757666.1|2469920_2471342_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	29.1	4.2e-18
WP_014757665.1|2471343_2472027_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.2	2.9e-49
WP_013786968.1|2472116_2473067_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.8	2.1e-45
WP_014757664.1|2473069_2474443_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	38.2	4.8e-35
WP_013786966.1|2474552_2474834_-	septation protein SpoVG	NA	NA	NA	NA	NA
WP_014757663.1|2475035_2475854_-	pur operon repressor	NA	A0A1X9I6E2	Streptococcus_phage	28.5	2.1e-06
WP_014757662.1|2476011_2477409_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_013786963.1|2477434_2478448_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.7	8.7e-26
>prophage 7
NZ_CP047602	Thermoanaerobacterium aotearoense strain SCUT27 chromosome, complete genome	2668690	2641526	2650395	2668690	tRNA	Staphylococcus_phage(50.0%)	8	NA	NA
WP_014757518.1|2641526_2642798_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	49.5	8.2e-98
WP_013786854.1|2643063_2643600_-	signal peptidase I	NA	NA	NA	NA	NA
WP_014757517.1|2643999_2645064_+	sporulation integral membrane protein YtvI	NA	NA	NA	NA	NA
WP_014757516.1|2645107_2645578_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.2	7.3e-44
WP_014757515.1|2645601_2646792_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	50.6	1.3e-108
WP_014757514.1|2646806_2647427_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.5	1.3e-32
WP_160175256.1|2647435_2648506_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.1	2.7e-54
WP_014757512.1|2648739_2650395_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.2	1.8e-65
