The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047606	Citrobacter sp. LUTT5 chromosome, complete genome	5034577	761713	831670	5034577	plate,tRNA,protease,integrase	Cronobacter_phage(14.29%)	53	774881:774899	829091:829109
WP_044713759.1|761713_762139_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_044713761.1|762141_763977_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_071684649.1|763943_764990_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_121540789.1|765006_766305_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_044713763.1|766301_766835_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_160179770.1|766837_768181_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_044713767.1|768185_768995_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_071698371.1|769003_771739_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.7	8.2e-87
WP_044713771.1|771735_772491_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_071684645.1|772495_773917_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_160179772.1|773940_777465_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
774881:774899	attL	AGCTGAAAGCCTTCTGGCA	NA	NA	NA	NA
WP_160179775.1|777475_778843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044713777.1|778845_779325_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_044713779.1|779524_780382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130715120.1|782019_782343_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_130715145.1|782777_783149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160179777.1|783609_783783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130715121.1|783986_784535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130715122.1|784535_788642_-	type IV secretion protein Rhs	NA	S5W9C6	Leptospira_phage	32.8	1.9e-07
WP_160179779.1|788709_790821_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	7.3e-27
WP_130715124.1|793005_794502_+	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_130715148.1|794600_795257_+	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_130715125.1|795253_798541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136345910.1|798542_799691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130715127.1|799789_801862_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_160179782.1|801939_806133_+	hypothetical protein	NA	A0A2H4PQT3	Staphylococcus_phage	29.7	1.0e-75
WP_160180768.1|806207_806327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088903068.1|806421_806883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048213204.1|809085_809643_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	53.5	1.8e-20
WP_088903070.1|809850_811110_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	44.6	1.3e-82
WP_130715130.1|811454_812162_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_160179784.1|812630_814766_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_003027130.1|814819_816076_-	nucleoside permease	NA	NA	NA	NA	NA
WP_049001609.1|816287_817373_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
WP_003027126.1|817459_817729_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_003846351.1|817756_818809_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003027117.1|818969_819689_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_003027115.1|819688_820015_+	YggL family protein	NA	NA	NA	NA	NA
WP_003838208.1|820064_820784_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_044713806.1|820972_822019_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_130715132.1|822135_823143_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_130715133.1|823205_824342_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_003027104.1|824334_824928_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_003027101.1|824935_825226_-	YggU family protein	NA	NA	NA	NA	NA
WP_003027097.1|825222_825789_-	YggT family protein	NA	NA	NA	NA	NA
WP_049015284.1|825807_826512_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003027090.1|826529_827510_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_003027087.1|827506_827923_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_127649121.1|827922_828558_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_003027083.1|828597_829545_-	glutathione synthase	NA	NA	NA	NA	NA
829091:829109	attR	TGCCAGAAGGCTTTCAGCT	NA	NA	NA	NA
WP_003027080.1|829564_830296_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016150969.1|830370_831078_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_160179786.1|831172_831670_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP047606	Citrobacter sp. LUTT5 chromosome, complete genome	5034577	1199867	1269519	5034577	head,tail,plate,lysis,tRNA,transposase,terminase,capsid,portal,integrase	Salmonella_phage(77.78%)	67	1206467:1206513	1241590:1241636
WP_160179893.1|1199867_1201035_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	88.8	2.7e-164
WP_160179896.1|1201113_1203399_+	hypothetical protein	NA	A0A1L2BY82	Clostridium_phage	27.7	1.0e-53
WP_160179898.1|1203795_1204365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160179900.1|1204370_1204769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160179902.1|1205022_1206264_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.9	8.5e-100
1206467:1206513	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_121540383.1|1206630_1207641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121540382.1|1207642_1208662_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.3	4.6e-192
WP_121540381.1|1208664_1209297_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	59.5	3.1e-66
WP_000102106.1|1209416_1209659_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_121540380.1|1209691_1210201_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	97.6	4.0e-88
WP_121540379.1|1210208_1210544_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	91.1	4.6e-24
WP_097485628.1|1210587_1210836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097485629.1|1210915_1211257_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	87.6	1.3e-50
WP_121540378.1|1211324_1211558_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	97.4	8.3e-33
WP_016150819.1|1211557_1211785_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	3.3e-34
WP_121540377.1|1211781_1212642_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	77.6	1.5e-124
WP_160179904.1|1212632_1215041_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	94.6	0.0e+00
WP_001376441.1|1215199_1215388_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	95.2	2.0e-24
WP_121540375.1|1215897_1218549_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_121540374.1|1218647_1218890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121540373.1|1219020_1220070_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.5	1.9e-156
WP_017382378.1|1220069_1221833_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.7	3.2e-312
WP_121540371.1|1221982_1222810_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	67.1	4.5e-73
WP_118938596.1|1222825_1223974_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	69.1	1.6e-132
WP_160179907.1|1223977_1224631_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	55.7	2.6e-55
WP_014884903.1|1224729_1225197_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_000868184.1|1225196_1225400_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_014884902.1|1225403_1225619_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_014884901.1|1225599_1226115_+	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	1.8e-72
WP_044704129.1|1226111_1226540_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	84.3	1.2e-56
WP_014884898.1|1226635_1227067_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
WP_121540366.1|1227059_1227506_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.5	1.2e-59
WP_121540365.1|1227530_1228736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121540364.1|1228818_1229397_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	4.8e-106
WP_121540363.1|1229393_1229753_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	95.0	1.2e-57
WP_121540362.1|1229739_1230648_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	93.4	1.2e-148
WP_121540361.1|1230640_1231246_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	97.0	1.0e-114
WP_160179909.1|1231242_1232601_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.9	1.1e-135
WP_063922550.1|1232602_1233043_+|tail	phage tail protein	tail	A0A0F7LDZ0	Escherichia_phage	55.5	1.0e-39
WP_063922551.1|1233014_1233437_-|tail	phage tail protein	tail	A0A0M4S6V4	Salmonella_phage	76.3	3.1e-25
WP_121540359.1|1233439_1233820_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	53.8	8.6e-11
WP_001397632.1|1233849_1234407_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	83.5	2.5e-83
WP_121540358.1|1234490_1235663_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	2.5e-210
WP_001397630.1|1235672_1236188_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	96.5	1.3e-89
WP_001397629.1|1236242_1236545_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	96.0	1.0e-43
WP_001397628.1|1236559_1236679_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	6.7e-15
WP_121540357.1|1236671_1239608_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	76.2	0.0e+00
WP_000980407.1|1239604_1240090_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	97.7	2.7e-65
WP_121540356.1|1240086_1241187_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	95.4	9.3e-191
WP_000980498.1|1241255_1241474_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_085951585.1|1242027_1243191_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
1241590:1241636	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_160179911.1|1243198_1245385_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.8	3.2e-17
WP_160179913.1|1245381_1246791_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_160179924.1|1246891_1258138_-	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_003031211.1|1258719_1259202_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
WP_071524313.1|1259344_1259800_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_057102097.1|1259783_1260080_+	RnfH family protein	NA	NA	NA	NA	NA
WP_003826401.1|1260130_1260475_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_032937967.1|1260624_1262286_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003031220.1|1262371_1263250_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_003031221.1|1263372_1263966_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_008324538.1|1264015_1265305_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_003031224.1|1265323_1266115_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_003031226.1|1266280_1267642_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003031228.1|1267891_1268140_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_003031230.1|1268158_1268707_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003031232.1|1268751_1269519_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP047606	Citrobacter sp. LUTT5 chromosome, complete genome	5034577	1791280	1799699	5034577	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_130714513.1|1791280_1792228_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.8	1.5e-08
WP_003844383.1|1792211_1792943_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003027354.1|1792923_1793031_-	protein YohO	NA	NA	NA	NA	NA
WP_003844381.1|1793082_1793814_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
WP_003027348.1|1794039_1795725_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
WP_003840155.1|1795721_1796441_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_003027346.1|1796487_1796958_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
WP_003840158.1|1797000_1797459_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
WP_003844377.1|1797665_1799699_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
>prophage 4
NZ_CP047606	Citrobacter sp. LUTT5 chromosome, complete genome	5034577	1837967	1847546	5034577	tRNA,protease	Bacillus_phage(28.57%)	8	NA	NA
WP_003036815.1|1837967_1839914_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
WP_003036813.1|1839988_1840213_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
WP_003036810.1|1840536_1840857_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_003036804.1|1840887_1843164_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
WP_130714518.1|1843434_1844796_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.9	4.1e-204
WP_003841759.1|1844955_1845288_-	YegP family protein	NA	NA	NA	NA	NA
WP_003036797.1|1845423_1846146_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
WP_003841761.1|1846142_1847546_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.6	3.9e-32
>prophage 5
NZ_CP047606	Citrobacter sp. LUTT5 chromosome, complete genome	5034577	2009728	2047393	5034577	head,protease,tail,terminase,capsid,portal,integrase	Salmonella_phage(27.08%)	54	2005830:2005845	2044358:2044373
2005830:2005845	attL	ATTCAGCGAAGGAATA	NA	NA	NA	NA
WP_071692372.1|2009728_2010739_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	86.9	1.0e-172
WP_065944714.1|2010738_2010966_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	88.0	4.6e-36
WP_130714547.1|2011004_2011256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180785.1|2011248_2011728_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	67.2	3.6e-46
WP_142972720.1|2012112_2012313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180124.1|2013000_2013453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130714549.1|2013449_2014280_-	chromosome partitioning protein ParB	NA	K7PKM7	Enterobacterial_phage	84.0	5.0e-120
WP_094790214.1|2014279_2014693_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	73.5	6.2e-47
WP_151564552.1|2015442_2015658_-	hypothetical protein	NA	A0A193GYF6	Enterobacter_phage	46.5	2.3e-13
WP_160180129.1|2015902_2016550_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.5	9.3e-74
WP_032207801.1|2016654_2016852_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.7	1.9e-17
WP_160180131.1|2016877_2017342_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	90.1	5.8e-70
WP_160180134.1|2017582_2017768_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	65.4	1.3e-12
WP_065944720.1|2017751_2018696_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	81.2	6.4e-148
WP_160180136.1|2018698_2019142_+	hypothetical protein	NA	U5P0U0	Shigella_phage	30.7	8.2e-13
WP_160180138.1|2019141_2019810_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	80.1	4.0e-96
WP_003833987.1|2019796_2020015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160180140.1|2020016_2020334_+	LexA family transcriptional regulator	NA	K7PHB4	Enterobacterial_phage	56.7	2.4e-27
WP_069891578.1|2020333_2020723_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	66.7	3.5e-44
WP_003833980.1|2020739_2021465_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.1	9.8e-56
WP_160180142.1|2021461_2022451_+	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	71.4	3.8e-143
WP_160180144.1|2022465_2023044_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	55.6	9.3e-49
WP_096878852.1|2023122_2023602_-	hypothetical protein	NA	F1C594	Cronobacter_phage	56.7	4.2e-39
WP_016150433.1|2023850_2024129_+	hypothetical protein	NA	K7PGZ9	Enterobacteria_phage	95.7	4.3e-44
WP_160180146.1|2024100_2024649_+	glycoside hydrolase family protein	NA	K7PM52	Enterobacteria_phage	91.8	1.5e-96
WP_160180788.1|2024645_2025161_+	DUF2514 family protein	NA	A0A291LBG9	Klebsiella_phage	49.4	1.2e-07
WP_160180149.1|2025287_2026157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160180151.1|2026332_2026683_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	79.3	1.0e-50
WP_136346206.1|2026840_2027338_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.6	3.3e-63
WP_136346205.1|2027341_2029093_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	71.6	9.7e-259
WP_136346204.1|2029103_2029289_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	59.3	9.9e-13
WP_136346203.1|2029288_2030518_+|portal	phage portal protein	portal	U5P411	Shigella_phage	82.7	1.3e-204
WP_136346202.1|2030504_2031158_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.0	7.9e-105
WP_136346201.1|2031171_2032380_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.9	2.8e-188
WP_160180153.1|2032418_2032649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160180155.1|2032645_2032969_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.0	1.7e-20
WP_129610256.1|2032978_2033317_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	7.8e-40
WP_071684539.1|2033313_2033763_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.9	1.9e-65
WP_160180157.1|2033759_2034107_+	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	73.9	2.7e-43
WP_142972601.1|2034164_2034869_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	73.9	7.5e-93
WP_100272253.1|2034896_2035268_+|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	86.8	1.9e-55
WP_100272254.1|2035279_2035570_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	90.6	1.8e-40
WP_038642089.1|2035628_2035808_+	hypothetical protein	NA	K7PH36	Enterobacterial_phage	84.7	6.2e-20
WP_160180159.1|2035853_2039138_+|tail	phage tail tape measure protein	tail	K7PKG1	Enterobacteria_phage	69.2	0.0e+00
WP_136346210.1|2039272_2039509_+	hypothetical protein	NA	S4TNM6	Salmonella_phage	87.1	2.5e-21
WP_136346195.1|2039486_2039702_-	hypothetical protein	NA	H6WRW0	Salmonella_phage	78.9	1.9e-23
WP_136346194.1|2039866_2040460_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	96.4	1.4e-108
WP_086539181.1|2040459_2041044_+	hypothetical protein	NA	S4TND4	Salmonella_phage	96.4	7.8e-104
WP_023993424.1|2041050_2041449_+	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
WP_136346193.1|2041448_2044166_+	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	91.0	0.0e+00
WP_160180161.1|2044168_2045113_+	hypothetical protein	NA	H6WRW5	Salmonella_phage	64.9	2.4e-115
2044358:2044373	attR	TATTCCTTCGCTGAAT	NA	NA	NA	NA
WP_160180163.1|2045122_2046544_+|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	50.5	4.5e-113
WP_000497432.1|2046682_2046925_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	3.4e-29
WP_130714570.1|2047003_2047393_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	72.9	3.9e-51
>prophage 6
NZ_CP047606	Citrobacter sp. LUTT5 chromosome, complete genome	5034577	2763526	2824927	5034577	head,tail,tRNA,holin,coat,terminase,integrase	Cronobacter_phage(23.53%)	88	2777143:2777165	2825108:2825130
WP_003836641.1|2763526_2764306_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
WP_016150131.1|2764302_2765745_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
WP_003836643.1|2765806_2766520_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_003836644.1|2766836_2767301_-	lipoprotein nlpC	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
WP_003030567.1|2767378_2768128_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	9.3e-09
WP_049014469.1|2768127_2768679_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_003832584.1|2768739_2769720_-	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
WP_003030571.1|2769873_2770173_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_003030574.1|2770177_2772565_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003832580.1|2772580_2773564_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_152659856.1|2773763_2773895_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_003030578.1|2773933_2774290_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003030583.1|2774345_2774543_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_048997935.1|2774639_2775182_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_003832572.1|2775185_2777114_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.8	4.4e-127
2777143:2777165	attL	ACACGTAAGATCACATACAAAGA	NA	NA	NA	NA
WP_160180276.1|2777568_2778621_-	acyltransferase family protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.9	1.1e-36
WP_160180279.1|2778757_2780488_-	hypothetical protein	NA	S4TTP7	Salmonella_phage	49.6	1.2e-136
WP_160180281.1|2780545_2783023_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	87.3	0.0e+00
WP_160180283.1|2783009_2783402_-	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	89.7	8.7e-67
WP_121567062.1|2783398_2783863_-	HNH endonuclease	NA	Q6XQF0	Escherichia_phage	40.1	3.4e-25
WP_160180285.1|2783939_2784410_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	94.2	4.8e-80
WP_160180287.1|2784409_2784907_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	87.3	2.0e-84
WP_097759335.1|2784944_2785175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180289.1|2785183_2788123_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	40.3	5.6e-118
WP_160180292.1|2788180_2788741_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	36.3	3.7e-18
WP_160180294.1|2788991_2789663_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	49.6	2.2e-54
WP_160180296.1|2789720_2790464_-	DNA breaking-rejoining protein	NA	F1C5E5	Cronobacter_phage	84.6	2.6e-72
WP_160180299.1|2790528_2790912_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	8.9e-40
WP_160180301.1|2790908_2791349_-	HK97 gp10 family phage protein	NA	A0A1V0E5P5	Salmonella_phage	52.6	1.0e-31
WP_160180303.1|2791351_2791702_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	64.3	2.9e-37
WP_160180306.1|2791705_2791942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180307.1|2791945_2792098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063615163.1|2792094_2792265_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	48.2	6.5e-11
WP_057780789.1|2792264_2792645_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	4.1e-29
WP_160180308.1|2792647_2792896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180309.1|2792905_2794003_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	73.6	3.2e-151
WP_160180310.1|2794014_2794446_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.4e-41
WP_160180311.1|2794449_2795835_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	63.4	4.2e-164
WP_160180313.1|2795894_2796161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180315.1|2796223_2797222_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	67.7	7.1e-113
WP_160180317.1|2797148_2798624_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	60.4	7.6e-156
WP_160180320.1|2798634_2800197_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	89.2	1.3e-291
WP_160180322.1|2800193_2800766_-|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	82.4	1.6e-69
WP_160180324.1|2800798_2801017_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_160180797.1|2801064_2801301_+	ATP-dependent RNA helicase HrpA	NA	NA	NA	NA	NA
WP_160180326.1|2801312_2801516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152960167.1|2801671_2802190_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	96.5	1.8e-91
WP_160180328.1|2802449_2802656_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	79.4	2.9e-21
WP_160180330.1|2802881_2803331_-	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	85.9	4.8e-69
WP_099530457.1|2803317_2803647_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	94.5	9.3e-54
WP_160180331.1|2804384_2804999_-	hypothetical protein	NA	A0A1V0E5R2	Salmonella_phage	81.3	3.4e-94
WP_103770175.1|2804995_2805142_-	YlcG family protein	NA	NA	NA	NA	NA
WP_160180332.1|2805138_2805336_-	hypothetical protein	NA	M9NZE6	Enterobacteria_phage	83.1	2.6e-27
WP_160180333.1|2805332_2805695_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	79.7	1.4e-50
WP_160180334.1|2805691_2805982_-	DUF1364 family protein	NA	K7PGZ6	Enterobacteria_phage	88.4	2.0e-44
WP_160180335.1|2805974_2806145_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	61.8	2.2e-11
WP_049003308.1|2806137_2806587_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	51.4	2.4e-36
WP_106672185.1|2807040_2807298_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	80.3	1.4e-28
WP_049003300.1|2807736_2808009_-	hypothetical protein	NA	A0A220IH78	Escherichia_phage	69.7	2.6e-25
WP_160180336.1|2808005_2808593_-	hypothetical protein	NA	E5DV63	Deep-sea_thermophilic_phage	42.4	1.8e-28
WP_160180337.1|2808596_2809853_-	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	56.4	3.0e-28
WP_160180339.1|2810506_2810968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180341.1|2810964_2811504_-	hypothetical protein	NA	A0A193GYL1	Enterobacter_phage	54.7	8.4e-28
WP_103856794.1|2811500_2811800_-	protein ren	NA	M1FPD5	Enterobacteria_phage	53.7	8.8e-19
WP_160180343.1|2811801_2812491_-	phage replication protein	NA	G8C7U6	Escherichia_phage	93.9	3.2e-125
WP_160180800.1|2812487_2813453_-	replication protein	NA	K7PGZ0	Enterobacteria_phage	94.1	2.9e-71
WP_160180344.1|2813636_2814179_-	regulator	NA	M9NZI6	Enterobacteria_phage	87.2	8.6e-81
WP_045338826.1|2814208_2814436_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	54.9	4.0e-16
WP_045338824.1|2814471_2815227_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	58.3	2.3e-76
WP_160180345.1|2815238_2815826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160180346.1|2816262_2816604_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	98.2	6.0e-56
WP_160180347.1|2816593_2816797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180348.1|2817185_2817566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160180349.1|2817717_2817927_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	91.3	2.8e-32
WP_160180350.1|2817997_2818966_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	77.6	5.0e-55
WP_160180351.1|2818973_2819258_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	90.4	4.7e-46
WP_160180352.1|2819275_2820022_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	65.8	1.8e-65
WP_160180354.1|2820018_2820636_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	57.8	1.2e-59
WP_160180356.1|2820632_2821061_+	regulator	NA	M9NYX4	Enterobacteria_phage	95.1	1.7e-71
WP_160180358.1|2821057_2821210_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	44.2	3.6e-05
WP_160180361.1|2821206_2821758_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.2	7.0e-54
WP_121567097.1|2821754_2821973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160180363.1|2822070_2822289_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	64.3	2.9e-19
WP_160180365.1|2822285_2823008_+	hypothetical protein	NA	A0A077KCB2	Edwardsiella_phage	47.9	5.0e-52
WP_160180367.1|2822985_2823225_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	74.4	2.8e-28
WP_103856776.1|2823234_2823420_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	52.0	1.1e-06
WP_032936075.1|2823524_2823761_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	53.7	3.3e-13
WP_160180369.1|2823718_2824927_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R9B6	Salmonella_phage	76.9	2.5e-181
2825108:2825130	attR	ACACGTAAGATCACATACAAAGA	NA	NA	NA	NA
>prophage 7
NZ_CP047606	Citrobacter sp. LUTT5 chromosome, complete genome	5034577	2916100	2924192	5034577	transposase	uncultured_Caudovirales_phage(44.44%)	10	NA	NA
WP_003846689.1|2916100_2916586_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	3.0e-08
WP_049015173.1|2917428_2918589_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	4.6e-39
WP_003030760.1|2918699_2919125_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
WP_160180382.1|2919137_2920427_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.4	7.1e-166
WP_106902544.1|2920471_2920792_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	45.7	8.5e-20
WP_160180385.1|2920877_2921576_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	6.5e-89
WP_138828399.1|2921652_2921886_-	DNA polymerase V	NA	A0A222YZE2	Escherichia_phage	80.3	8.6e-22
WP_003840850.1|2921964_2922207_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
WP_003030767.1|2922296_2922806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003030769.1|2922941_2924192_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
>prophage 8
NZ_CP047606	Citrobacter sp. LUTT5 chromosome, complete genome	5034577	3818401	3872443	5034577	integrase,capsid,protease	Enterobacteria_phage(50.0%)	54	3803677:3803691	3858835:3858849
3803677:3803691	attL	CTTGAACTGACCCAG	NA	NA	NA	NA
WP_160180576.1|3818401_3818983_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_003847722.1|3818988_3819393_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_160180577.1|3819389_3820247_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_061549903.1|3820335_3821880_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_061549904.1|3821891_3823028_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003838732.1|3823041_3823131_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_044699247.1|3823183_3823897_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160180578.1|3824089_3825559_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003838738.1|3825682_3826132_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_130714953.1|3826299_3827304_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.8e-23
WP_057101187.1|3827456_3828908_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_057101186.1|3828920_3830102_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_057101185.1|3830266_3831745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180579.1|3832339_3833074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180581.1|3833361_3835695_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	81.7	0.0e+00
WP_160180583.1|3835709_3836030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180585.1|3836026_3836254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160180587.1|3836250_3836802_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	68.5	5.7e-32
WP_160180590.1|3836798_3837065_-	AlpA family phage regulatory protein	NA	Q7M299	Enterobacteria_phage	73.9	8.0e-32
WP_160180593.1|3837604_3838408_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_160180595.1|3838404_3838650_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	9.4e-19
WP_160180597.1|3838665_3839178_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	49.4	5.3e-32
WP_160180807.1|3839878_3841315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160180599.1|3841330_3842497_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.9	3.8e-142
WP_003029573.1|3842891_3844199_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	29.1	3.1e-07
WP_032296090.1|3844321_3844771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003847740.1|3844767_3844989_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003029576.1|3845123_3845888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003029579.1|3846349_3846970_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_003029581.1|3847025_3847682_-	hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	82.1	6.2e-09
WP_160180601.1|3847710_3848019_-	maltose acetyltransferase	NA	NA	NA	NA	NA
WP_077258089.1|3848528_3848699_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003029584.1|3848927_3849851_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_003029587.1|3850016_3851534_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_000345204.1|3851671_3853042_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_003029589.1|3853041_3854442_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.1	2.0e-20
WP_003029591.1|3854471_3855476_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_154818538.1|3856578_3856767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003847756.1|3856890_3857154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003847758.1|3857384_3857666_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003847761.1|3857700_3858270_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_003847763.1|3858375_3861225_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	6.9e-129
3858835:3858849	attR	CTGGGTCAGTTCAAG	NA	NA	NA	NA
WP_001446316.1|3861224_3861416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003847766.1|3861476_3863282_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	39.8	3.9e-93
WP_001275372.1|3863369_3863828_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_003847769.1|3863850_3864765_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_003847770.1|3864867_3865755_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_003847772.1|3865844_3866456_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_003847774.1|3866535_3867681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786814.1|3867670_3868111_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
WP_032948597.1|3868114_3869830_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_003847780.1|3869826_3870324_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_003847782.1|3870301_3871267_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003847784.1|3871291_3872443_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
