The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	0	42380	4694065	plate,tail,capsid,terminase,holin,head,protease,lysis,portal	Escherichia_phage(51.43%)	52	NA	NA
WP_160194470.1|0_2277_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.7	0.0e+00
WP_001774096.1|2455_3007_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	47.0	7.0e-38
WP_059329783.1|3100_4660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073487938.1|5012_6047_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	7.1e-201
WP_000156861.1|6046_7819_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085953.1|7992_8847_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_105907203.1|8905_9979_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.7	1.5e-201
WP_105907202.1|9982_10726_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	97.2	8.1e-122
WP_000988639.1|10825_11335_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_000846399.1|11334_11538_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|11541_11823_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|11822_12320_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_072657039.1|12334_12760_+	protein lysA	NA	U5N096	Enterobacteria_phage	95.0	4.0e-57
WP_072657038.1|12747_13173_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.9	7.2e-67
WP_072146842.1|13144_13318_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_000917188.1|13280_13748_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.1e-81
WP_001001786.1|13740_14193_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001093748.1|14259_14895_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	7.2e-111
WP_000127164.1|14891_15239_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121475.1|15243_16152_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	100.0	3.4e-162
WP_032200747.1|16144_16756_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	2.9e-117
WP_072657047.1|16752_17940_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	78.4	5.7e-154
WP_016245934.1|17896_18364_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	98.7	1.8e-82
WP_072657048.1|18335_18944_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	95.0	1.5e-105
WP_141010513.1|18943_19450_-|tail	phage tail protein	tail	K7P7Q7	Enterobacteria_phage	65.6	7.3e-50
WP_016237189.1|19480_19663_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.9	1.6e-10
WP_001286716.1|19722_20913_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|20925_21444_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|21500_21776_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|21808_21928_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_072656951.1|21920_24368_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	99.4	0.0e+00
WP_000978885.1|24382_24862_+|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_072656950.1|24861_26025_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.2	4.1e-205
WP_000468308.1|26106_26325_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|26561_27464_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|27644_28607_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|28926_29916_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001326656.1|30022_30778_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|30832_31600_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802216.1|31707_32307_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|32407_32848_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655989.1|33059_33359_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|33385_33814_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796332.1|33818_34565_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|34661_35672_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|35806_37315_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|37337_38183_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|38607_38853_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|38937_39423_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|39515_40442_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|40508_41840_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|41849_42380_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	59138	66381	4694065		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424840.1|59138_59801_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174077.1|59812_62314_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|62622_63702_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|63712_64033_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184811.1|64083_66381_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 3
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	83727	85572	4694065		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|83727_85572_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 4
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	94167	97220	4694065		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|94167_95118_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|96035_97220_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 5
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	101336	109665	4694065		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|101336_105365_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|105441_109665_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 6
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	118881	120645	4694065		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|118881_119553_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|119595_120186_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|120372_120645_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 7
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	126034	127624	4694065		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|126034_127624_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 8
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	144019	147703	4694065		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|144019_147703_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 9
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	166975	168091	4694065		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|166975_168091_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 10
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	177306	177915	4694065		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|177306_177915_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 11
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	184505	187053	4694065		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|184505_185921_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|185973_187053_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 12
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	191240	194853	4694065		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|191240_194063_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|194316_194853_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 13
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	198670	200020	4694065		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|198670_200020_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 14
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	205603	207562	4694065		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|205603_207562_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 15
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	217298	219446	4694065		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|217298_219446_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 16
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	224691	231060	4694065		Tetraselmis_virus(50.0%)	5	NA	NA
WP_072656883.1|224691_226677_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	4.9e-150
WP_001171687.1|226949_227879_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|227862_228558_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|228568_229549_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235257.1|229527_231060_-	D-allose import ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	4.8e-20
>prophage 17
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	237294	238844	4694065		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611405.1|237294_237975_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001075514.1|238085_238844_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 18
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	244456	245245	4694065		Cedratvirus(100.0%)	1	NA	NA
WP_001193409.1|244456_245245_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 19
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	250481	251984	4694065		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|250481_251984_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 20
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	273180	276392	4694065	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|273180_274698_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|274934_276392_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 21
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	285220	287414	4694065		Klebsiella_phage(33.33%)	4	NA	NA
WP_000691818.1|285220_285442_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	2.5e-10
WP_001186742.1|285528_286005_-	RadC family protein	NA	NA	NA	NA	NA
WP_042631074.1|286019_286505_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	1.5e-12
WP_077737897.1|286595_287414_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	39.6	1.0e-45
>prophage 22
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	297880	365852	4694065	integrase,tRNA,protease,transposase	Shigella_phage(18.75%)	63	297832:297891	341072:342406
297832:297891	attL	TACTAGACTGGCCCCCTGAATCTCCAGACAACCAATATCACTTAAATAAGTGATAGTCTT	NA	NA	NA	NA
WP_085947917.1|297880_299153_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001564247.1|299405_300005_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_021564611.1|300386_300770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013767.1|300766_301192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352149.1|304243_304993_+	molecular chaperone	NA	NA	NA	NA	NA
WP_001269817.1|304994_306059_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000350095.1|306101_306302_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_136360473.1|306570_307164_+	YqiJ family protein	NA	NA	NA	NA	NA
WP_049109781.1|308520_308832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110826409.1|308997_310270_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	3.6e-170
WP_076486551.1|310408_310957_+	fimbrial protein YehD	NA	NA	NA	NA	NA
WP_053270475.1|311012_311693_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_089615834.1|311710_314197_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_089615833.1|314207_315218_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001603498.1|315402_315624_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	94.5	8.1e-30
WP_053270478.1|315623_316001_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	92.0	2.7e-57
WP_089634553.1|316511_317774_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	1.0e-79
WP_001188520.1|318153_318729_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000068922.1|318765_320463_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_000883400.1|320438_320777_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000961959.1|320892_322194_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_000069437.1|322311_323748_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_001267448.1|324084_324561_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000015837.1|324576_325833_-	L-methionine/branched-chain amino acid exporter YjeH	NA	NA	NA	NA	NA
WP_001026276.1|326108_326402_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|326445_328092_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_000558209.1|328229_328583_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_001008040.1|328785_329655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000940549.1|330049_331078_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_000257278.1|331119_331686_+	elongation factor P	NA	NA	NA	NA	NA
WP_000977757.1|331737_331863_+	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000239596.1|331973_332120_+	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000118482.1|332295_332613_+	quaternary ammonium compound-resistance protein SugE	NA	NA	NA	NA	NA
WP_001238378.1|332609_333143_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_001336292.1|333231_334365_-	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000609663.1|334427_334787_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_000208757.1|334797_335193_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000829498.1|335203_335938_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001192973.1|335930_337739_-	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000004771.1|338063_339041_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001336293.1|339259_340762_+	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_160194473.1|340813_341077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|341120_342393_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001276180.1|342460_342775_+	YjeO family protein	NA	NA	NA	NA	NA
341072:342406	attR	TACTAGACTGGCCCCCTGAATCTCCAGACAACCAATATCACTTAAATAAGTGATAGTCTTAATACTAGTTTTTAGACTAGTCATTGGAGAACAGATGATTGATGTCTTAGGGCCGGAGAAACGCAGACGGCGTACCACACAGGAAAAGATCGCAATTGTTCAGCAGAGCTTTGAACCGGGGATGACGGTCTCCCTCGTTGCCCGGCAACATGGTGTAGCAGCCAGCCAGTTATTTCTCTGGCGTAAGCAATACCAGGAAGGAAGTCTTACTGCTGTCGCCGCCGGAGAACAGGTTGTTCCTGCCTCTGAACTTGCTGCCGCCATGAAGCAGATTAAAGAACTCCAGCGCCTGCTCGGCAAGAAAACGATGGAAAATGAACTCCTCAAAGAAGCCGTTGAATATGGACGGGCAAAAAAGTGGATAGCGCACGCGCCCTTATTGCCCGGGGATGGGGAGTAAGCTTAGTCAGCCGTTGTCTCCGGGTGTCGCGTGCGCAGTTGCACGTCATTCTCAGACGAACCGATGACTGGATGGATGGCCGCCGCAGTCGTCACACTGATGATACGGATGTGCTTCTCCGTATACACCATGTTATCGGAGAGCTGCCAACGTATGGTTATCGTCGGGTATGGGCGCTGCTTCGCAGACAGGCAGAACTTGATGGTATGCCTGCGATCAATGCCAAACGTGTTTACCGGATCATGCGCCAGAATGCGCTGTTGCTTGAGCGAAAACCTGCTGTACCGCCATCGAAACGGGCACATACAGGCAGAGTGGCCGTGAAAGAAAGCAATCAGCGATGGTGCTCTGACGGGTTCGAGTTCTGCTGTGATAACGGAGAGAGACTGCGTGTCACGTTCGCGCTGGACTGCTGTGATCGTGAGGCACTGCACTGGGCGGTCACTACCGGCGGCTTCAACAGTGAAACAGTACAGGACGTCATGCTGGGAGCGGTGGAACGCCGCTTCGGCAACGATCTTCCGTCGTCTCCAGTGGAGTGGCTGACGGATAATGGTTCATGCTACCGGGCTAATGAAACACGCCAGTTCGCCCGGATGTTGGGACTTGAACCGAAGAACACGGCGGTGCGGAGTCCGGAGAGTAACGGAATAGCAGAGAGCTTCGTGAAAACGATAAAGCGTGACTACATCAGTATCATGCCCAAACCAGACGGGTTAACGGCAGCAAAGAACCTTGCAGAGGCGTTCGAGCATTATAACGAATGGCATCCGCATAGTGCGCTGGGTTATCGCTCGCCACGGGAATATCTGCGGCAGCGGGCTTGTAATGGGTTAAGTGATAACAGATGTCTGGAAATATAGGGGCAAATCCAG	NA	NA	NA	NA
WP_001236847.1|342803_346127_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_000934920.1|346148_347117_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_000041964.1|347213_348266_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_001295188.1|348360_348906_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_010723271.1|349648_349702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294219.1|349684_350824_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001295189.1|350822_352370_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_000981977.1|352341_352803_+|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_000990333.1|352821_354159_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|354168_356016_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|356008_356959_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|357044_357353_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460362.1|357428_358709_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|358794_360054_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|360056_361061_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|361142_361340_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|361443_362742_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|362946_363372_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|363410_365852_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
>prophage 23
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	369784	370948	4694065		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|369784_370948_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 24
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	412487	418975	4694065		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|412487_413018_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|413327_414284_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210557.1|414423_415926_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_072656886.1|415939_416962_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|416948_417944_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|417976_418975_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 25
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	423290	426051	4694065		Vibrio_phage(100.0%)	2	NA	NA
WP_001106226.1|423290_423755_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|423912_426051_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 26
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	429689	435786	4694065		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|429689_430637_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|430821_430875_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|431015_433712_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|433917_434304_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|434376_434838_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|434850_435786_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 27
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	444133	517268	4694065	integrase,tRNA,transposase	Escherichia_phage(15.79%)	67	454773:454790	513490:513507
WP_000416407.1|444133_446989_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|446988_447432_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|447785_449297_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|449563_450664_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|450663_451746_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001315985.1|451864_453367_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	6.1e-84
WP_001315986.1|453496_454516_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	3.2e-44
454773:454790	attL	GTTCGAGTCCGGCCTTCG	NA	NA	NA	NA
WP_001218930.1|454982_456248_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
WP_021554229.1|456571_458071_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001477155.1|458244_458985_-	porin family protein	NA	NA	NA	NA	NA
WP_001274542.1|459597_461247_+	DNA phosphorothioation-dependent restriction protein DptF	NA	NA	NA	NA	NA
WP_000283233.1|461251_462577_+	DNA phosphorothioation-dependent restriction protein DptG	NA	NA	NA	NA	NA
WP_000114120.1|462557_467612_+	DNA phosphorothioation-dependent restriction protein DptH	NA	NA	NA	NA	NA
WP_001327223.1|467649_468168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000071509.1|468168_468474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071533805.1|468522_469329_+	DGQHR domain-containing protein	NA	NA	NA	NA	NA
WP_000937304.1|469387_469744_-	DNA sulfur modification protein DndE	NA	NA	NA	NA	NA
WP_000905895.1|469743_471744_-	DNA sulfur modification protein DndD	NA	NA	NA	NA	NA
WP_000041168.1|471733_473368_-	DNA phosphorothioation system sulfurtransferase DndC	NA	R9TRT5	Rhizobium_phage	27.9	6.1e-21
WP_000179014.1|473364_474450_-	DNA sulfur modification protein DndB	NA	NA	NA	NA	NA
WP_000258195.1|474912_475086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000166952.1|475082_475427_+	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	38.4	3.1e-07
WP_001167422.1|475445_475994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000958149.1|476236_476473_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991584.1|476541_477117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|477946_479155_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000599533.1|479520_480726_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|481169_481490_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|481482_481869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|481876_482563_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001322387.1|482540_483167_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|483245_484451_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|484563_485157_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001352368.1|485670_486879_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001325745.1|488577_489318_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_085947771.1|489842_491004_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000902464.1|491141_491933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000900255.1|492003_492825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609859.1|492862_493312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387046.1|493560_494112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001609855.1|494297_495101_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	51.3	4.1e-79
WP_001617303.1|495751_496099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218942.1|496377_497154_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001072164.1|497156_497660_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_000538703.1|497863_498346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123906543.1|498290_498785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295213.1|498798_499821_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	98.8	2.5e-198
WP_072133117.1|499817_500600_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	1.7e-138
WP_001075491.1|500815_501547_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000778605.1|502216_502747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001499035.1|504351_505221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126799.1|505217_506180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000010383.1|506285_507170_+	GTPase	NA	NA	NA	NA	NA
WP_001282919.1|507372_508053_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001097301.1|508200_508878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278287.1|508883_509117_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001175163.1|509206_510025_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	1.9e-47
WP_000206664.1|510116_510602_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.2e-12
WP_001186165.1|510616_511093_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692350.1|511179_511401_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001285607.1|511480_511849_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094443.1|511938_512316_+	toxin	NA	NA	NA	NA	NA
WP_000761685.1|512312_512801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327226.1|512820_513018_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|513628_514902_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
513490:513507	attR	GTTCGAGTCCGGCCTTCG	NA	NA	NA	NA
WP_001037966.1|515629_516280_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_001534123.1|516287_517268_-	sialate O-acetylesterase	NA	Q08JA2	Stx2-converting_phage	55.9	9.4e-102
>prophage 28
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	520628	522304	4694065		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|520628_521231_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|521707_522304_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 29
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	526614	527823	4694065	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|526614_527823_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 30
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	533845	535306	4694065		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|533845_535306_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 31
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	541874	542429	4694065		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151855.1|541874_542429_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 32
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	555014	560381	4694065		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919543.1|555014_556679_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|556727_558089_-	MFS transporter	NA	NA	NA	NA	NA
WP_001543395.1|558305_559220_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106033.1|559358_560381_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 33
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	563610	564890	4694065		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|563610_564348_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|564350_564890_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 34
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	572828	575704	4694065		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|572828_574418_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|574810_575416_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|575542_575704_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 35
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	581440	582763	4694065		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|581440_582763_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 36
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	589506	594861	4694065		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|589506_590739_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|591045_592713_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409456.1|592923_594861_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 37
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	598144	600258	4694065		Bacillus_phage(50.0%)	2	NA	NA
WP_001188654.1|598144_598834_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.8	3.3e-29
WP_001219577.1|598833_600258_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.9	1.2e-09
>prophage 38
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	612026	623890	4694065	transposase	Cyanophage(16.67%)	11	NA	NA
WP_000130185.1|612026_612980_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001295414.1|613094_613682_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|613716_614283_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|614431_615145_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843565.1|615170_615575_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|615951_617868_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118476.1|617956_619087_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	37.1	1.4e-27
WP_001300563.1|619349_620462_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000935262.1|620539_620749_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_085947770.1|620791_622161_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000681354.1|622723_623890_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.5	3.4e-90
>prophage 39
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	627625	630442	4694065	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|627625_630442_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 40
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	634885	636034	4694065		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|634885_636034_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 41
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	641505	647166	4694065		Hepacivirus(50.0%)	4	NA	NA
WP_001350478.1|641505_643059_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.6	2.1e-31
WP_000349936.1|643132_644350_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|644478_645621_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|645651_647166_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 42
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	655057	656457	4694065		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|655057_655537_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|655614_656457_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 43
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	665577	671000	4694065		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|665577_668484_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035670.1|668648_671000_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 44
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	677448	678147	4694065		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916281.1|677448_678147_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 45
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	690849	692574	4694065		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|690849_692574_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 46
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	718663	719707	4694065		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|718663_719707_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 47
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	723952	724504	4694065		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|723952_724504_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 48
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	733131	734556	4694065		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|733131_734556_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 49
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	742299	748922	4694065		Mamastrovirus(33.33%)	5	NA	NA
WP_001189647.1|742299_743850_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_072656903.1|744051_746442_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|746647_747184_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|747224_747887_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|747995_748922_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 50
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	752184	753087	4694065	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|752184_753087_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 51
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	762945	769751	4694065	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|762945_764364_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937424.1|764402_765329_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|765365_765821_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000396036.1|765998_766703_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|766717_767248_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001350480.1|767321_769751_+	ATP-dependent RNA helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
>prophage 52
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	774994	775792	4694065		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|774994_775792_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 53
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	781826	782171	4694065		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|781826_782171_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 54
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	786100	787525	4694065	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|786100_787525_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 55
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	800122	800881	4694065		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|800122_800881_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 56
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	809709	813825	4694065		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|809709_810306_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|810342_813825_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 57
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	826830	827862	4694065		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594006.1|826830_827862_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 58
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	834385	842017	4694065		Indivirus(25.0%)	9	NA	NA
WP_000997010.1|834385_835189_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|835185_836100_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|836340_837141_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|837144_837768_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|837815_839174_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|839245_840001_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|840034_840757_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|840753_841221_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|841285_842017_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
>prophage 59
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	848761	938284	4694065	plate,tail,transposase,integrase,terminase,capsid,head,protease,portal,holin	Shigella_phage(46.67%)	104	867344:867399	903984:904039
WP_000284050.1|848761_849340_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|849545_850313_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|850283_851024_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615983.1|851179_851458_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|851460_851721_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056849.1|851930_852680_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000006255.1|852855_853353_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|853576_855316_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_001333407.1|855275_856046_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|856116_857172_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|857223_857517_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|857519_857918_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|857927_858380_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|858685_858952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|858884_859421_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|859477_860935_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|861195_861654_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|861745_862990_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|863047_863449_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|863487_864543_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|864830_865934_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|865945_867199_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
867344:867399	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAA	NA	NA	NA	NA
WP_032207578.1|867403_868567_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	9.1e-229
WP_000433939.1|868443_868794_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000206732.1|868793_869099_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242754.1|869098_869461_-	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_000008235.1|869451_869988_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000016389.1|870532_870967_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549626.1|870938_871145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450735.1|871392_872019_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|872116_872317_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|872354_872906_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|873081_873261_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_072656987.1|873250_874162_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	82.1	2.1e-143
WP_001305611.1|874158_874653_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_001305610.1|874652_875306_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_000210154.1|875302_875629_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_040074681.1|875625_876015_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	98.4	4.6e-68
WP_072656986.1|876034_876832_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.9	1.9e-148
WP_001433852.1|876839_877829_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_053287272.1|877842_878595_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	3.4e-136
WP_032217105.1|878845_879040_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	96.9	1.5e-27
WP_061811782.1|879189_880242_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.0	1.4e-204
WP_001120501.1|880319_880655_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_072656985.1|880658_881135_+	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	96.2	7.8e-86
WP_032217108.1|881118_881511_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	85.4	6.1e-52
WP_001379492.1|881973_882306_+	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_072656984.1|882356_882707_+	HNH endonuclease	NA	Q8SBD7	Shigella_phage	94.0	9.8e-62
WP_000929172.1|882832_883327_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_096954127.1|883560_885057_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	100.0	8.8e-301
WP_000605606.1|885068_885251_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001524100.1|885250_886492_+|portal	phage portal protein	portal	U5P411	Shigella_phage	100.0	6.9e-243
WP_072656983.1|886469_887120_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	2.1e-118
WP_072656982.1|887134_888340_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	99.0	7.7e-223
WP_000601365.1|888389_888590_+	hypothetical protein	NA	S5FNU1	Shigella_phage	100.0	3.4e-27
WP_000927714.1|888592_888916_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	4.4e-56
WP_001579916.1|888912_889323_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	6.7e-70
WP_000224835.1|889297_889804_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000779292.1|889800_890361_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497758.1|890369_890540_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_072656981.1|890523_892020_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	98.8	2.9e-272
WP_000090998.1|892019_892376_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661054.1|892375_892645_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_072656980.1|892786_894622_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	1.3e-306
WP_141010499.1|894682_896011_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.4	1.5e-243
WP_032277694.1|896007_897087_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	1.7e-205
WP_001259084.1|897086_897635_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_000424732.1|897634_898060_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_032141738.1|898046_899105_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.3	2.3e-199
WP_000383545.1|899095_899680_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_001579925.1|899683_900334_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	100.0	2.4e-117
WP_005060420.1|900290_900746_+|tail	tail fiber assembly protein	tail	M1FJ98	Enterobacteria_phage	100.0	3.2e-81
WP_000217914.1|900979_901285_-	hypothetical protein	NA	M1FPE6	Enterobacteria_phage	100.0	2.8e-52
WP_025755781.1|902502_903423_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	100.0	1.6e-172
WP_000915848.1|903419_903782_-	GtrA family protein	NA	U5P0S6	Shigella_phage	100.0	3.6e-59
WP_001111348.1|904155_904566_-	hypothetical protein	NA	NA	NA	NA	NA
903984:904039	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAA	NA	NA	NA	NA
WP_000121359.1|904544_905501_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|905510_907709_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|907705_908662_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070700.1|908658_909348_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|909765_910380_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|910627_910957_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|911269_911980_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_072656978.1|911948_913592_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|913581_916107_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|916132_916801_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|916858_917446_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|917520_918063_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|918886_919114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|919148_919289_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|919288_919552_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|919915_920017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001299021.1|924513_925107_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474084.1|925118_925355_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|925463_926789_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339594.1|927014_927869_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_072657041.1|928395_929115_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|929125_930553_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|930545_931241_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|931483_932152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|932364_934035_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|934048_935521_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|935534_936122_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|936250_938284_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 60
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	950448	951498	4694065		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|950448_951498_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 61
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	960270	962157	4694065		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010285.1|960270_962157_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	7.0e-53
>prophage 62
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	965355	966255	4694065		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|965355_966255_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 63
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	970795	975075	4694065		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_072657001.1|970795_973870_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.9	0.0e+00
WP_000805902.1|973992_975075_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 64
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	980485	982446	4694065		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|980485_981436_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|981432_982446_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 65
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	986026	990143	4694065	transposase	Prochlorococcus_phage(50.0%)	5	NA	NA
WP_000842100.1|986026_987136_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
WP_001141271.1|987170_987446_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_000596084.1|987633_988407_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000012218.1|988408_988852_-	transferase	NA	NA	NA	NA	NA
WP_085947917.1|988870_990143_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 66
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	993771	994539	4694065		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939375.1|993771_994539_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 67
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	999303	1003701	4694065	transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_085947771.1|999303_1000466_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001295335.1|1001919_1002543_+	hydrogen peroxide resistance inhibitor IprA	NA	NA	NA	NA	NA
WP_000830741.1|1002543_1003701_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 68
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1011116	1012232	4694065		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|1011116_1012232_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 69
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1016521	1026598	4694065		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|1016521_1017433_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219309.1|1017557_1018466_+	fructokinase	NA	NA	NA	NA	NA
WP_001326926.1|1018710_1019895_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698951.1|1020020_1023167_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|1023163_1024366_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|1024555_1025245_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893623.1|1025302_1026598_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 70
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1033550	1042531	4694065	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|1033550_1034678_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|1034700_1035033_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|1035060_1036908_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|1036918_1037890_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|1038018_1038366_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|1038542_1039427_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001326929.1|1039725_1040265_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|1040415_1040865_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150457.1|1040868_1041972_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_001021161.1|1042060_1042531_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 71
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1064090	1069137	4694065	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|1064090_1064714_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1064839_1066114_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|1066301_1068656_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1068864_1069137_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 72
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1072265	1072961	4694065		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|1072265_1072961_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 73
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1076284	1079831	4694065		Bacillus_phage(100.0%)	2	NA	NA
WP_001235649.1|1076284_1078057_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256201.1|1078049_1079831_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 74
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1088667	1091817	4694065		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1088667_1091817_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 75
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1098825	1104408	4694065		Klosneuvirus(33.33%)	5	NA	NA
WP_000127356.1|1098825_1099377_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|1099505_1101437_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1101489_1101819_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1101818_1102424_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|1102533_1104408_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
>prophage 76
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1115631	1118793	4694065		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|1115631_1115973_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|1116288_1118793_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 77
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1123332	1124010	4694065		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|1123332_1124010_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 78
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1127146	1134955	4694065		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|1127146_1127833_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1127829_1130244_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|1130674_1134955_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
>prophage 79
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1141329	1143111	4694065		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|1141329_1143111_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 80
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1149301	1150447	4694065		Streptococcus_phage(100.0%)	1	NA	NA
WP_001333621.1|1149301_1150447_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
>prophage 81
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1162024	1211924	4694065	integrase,tRNA,lysis,transposase	Enterobacteria_phage(51.85%)	53	1165653:1165667	1212720:1212734
WP_000912385.1|1162024_1163410_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|1163445_1163967_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1164074_1164287_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1164288_1165155_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1165625_1166168_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
1165653:1165667	attL	CTGGCTGCCGCACTA	NA	NA	NA	NA
WP_000988364.1|1166387_1167080_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_072657033.1|1167110_1169714_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|1169692_1170733_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|1170743_1171259_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1171261_1171894_-	fimbriae biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001350488.1|1172228_1173392_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_072657034.1|1173511_1174186_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.6	9.9e-127
WP_063073066.1|1174115_1174769_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	100.0	1.5e-111
WP_000145916.1|1174765_1175068_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	98.9	2.7e-44
WP_085947917.1|1175377_1176651_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_089551189.1|1176669_1176804_+	multidrug transporter emrE	NA	NA	NA	NA	NA
WP_001372443.1|1176851_1177001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1177058_1178585_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|1179049_1179601_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1179610_1180408_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1180524_1180626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|1180622_1181078_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|1181077_1181248_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|1181240_1181531_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|1181527_1181890_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1181886_1182027_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|1182112_1182496_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737280.1|1182685_1183783_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_000839596.1|1184355_1184571_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|1184570_1185068_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|1185284_1185467_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|1185557_1185851_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|1186141_1186552_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|1186837_1187044_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|1187208_1187403_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_072657025.1|1187791_1187950_+	hypothetical protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	1.4e-15
WP_001224604.1|1188391_1189282_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662357.1|1189282_1192255_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000253839.1|1194628_1196071_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000770953.1|1196060_1196744_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_000074234.1|1196900_1198274_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709870.1|1198431_1198764_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717157.1|1198779_1200003_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_072657024.1|1200014_1203158_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
WP_000786319.1|1203259_1204636_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153148.1|1204716_1205964_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_000351487.1|1206071_1206725_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360951.1|1206818_1207187_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682509.1|1207251_1207500_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_029393376.1|1207565_1208684_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_085947770.1|1209115_1210484_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000956455.1|1210582_1210735_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001300563.1|1210811_1211924_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
1212720:1212734	attR	TAGTGCGGCAGCCAG	NA	NA	NA	NA
>prophage 82
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1216903	1222946	4694065		Tupanvirus(50.0%)	3	NA	NA
WP_000077805.1|1216903_1220785_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000096692.1|1221000_1222134_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|1222130_1222946_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 83
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1237493	1239316	4694065		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502945.1|1237493_1238123_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_072657015.1|1238095_1239316_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.7e-58
>prophage 84
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1242499	1244614	4694065		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|1242499_1244065_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|1244185_1244614_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 85
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1260038	1260685	4694065		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|1260038_1260248_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939747.1|1260301_1260685_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 86
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1265498	1267937	4694065		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|1265498_1266710_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231430.1|1266848_1267937_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 87
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1274947	1277530	4694065	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|1274947_1277530_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 88
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1284469	1288778	4694065		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367875.1|1284469_1286140_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_001207520.1|1286999_1287935_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|1288052_1288778_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 89
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1294661	1295741	4694065		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1294661_1295741_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 90
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1300613	1302278	4694065		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1300613_1302278_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 91
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1307043	1310857	4694065	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023094.1|1307043_1308990_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|1309192_1310857_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 92
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1324155	1336876	4694065		Bacillus_phage(25.0%)	8	NA	NA
WP_000186076.1|1324155_1324833_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001310640.1|1324829_1327514_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|1327506_1328079_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087939.1|1328087_1330136_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_000741129.1|1330158_1331832_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|1331831_1331921_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|1332233_1332440_+	YbfA family protein	NA	NA	NA	NA	NA
WP_000015200.1|1332682_1336876_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	5.5e-26
>prophage 93
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1342606	1345656	4694065		Hokovirus(50.0%)	2	NA	NA
WP_000207142.1|1342606_1344025_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
WP_001032689.1|1344174_1345656_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 94
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1349034	1349826	4694065		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113989.1|1349034_1349826_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.5	7.5e-09
>prophage 95
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1386356	1389876	4694065		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|1386356_1387076_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|1387072_1388014_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|1388127_1388508_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|1388823_1389876_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 96
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1394229	1400803	4694065		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|1394229_1395246_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_072656988.1|1395506_1396979_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	4.7e-12
WP_001147439.1|1397046_1397835_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1397963_1398113_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_000101984.1|1398279_1399053_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|1399052_1399742_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|1399744_1400803_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 97
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1411158	1412448	4694065		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|1411158_1412448_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 98
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1418929	1419838	4694065		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1418929_1419838_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 99
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1430435	1445247	4694065		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996107.1|1430435_1432172_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|1432164_1433160_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|1433162_1433834_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|1434062_1435427_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|1435658_1436141_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|1436260_1438411_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|1438438_1439401_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|1439541_1440627_+	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000849301.1|1440855_1441116_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|1441380_1441647_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|1441720_1442398_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430057.1|1442439_1444722_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|1444986_1445247_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 100
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1448931	1454156	4694065		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|1448931_1449654_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|1449650_1450310_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|1450448_1451195_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1451598_1452102_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|1452400_1453288_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|1453522_1453588_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|1453640_1454156_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 101
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1459153	1467495	4694065		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|1459153_1460746_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|1460986_1462252_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|1462403_1463219_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209342.1|1463364_1465797_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|1465802_1466702_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_029392856.1|1466832_1467495_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	3.7e-25
>prophage 102
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1470710	1472582	4694065		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|1470710_1472582_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 103
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1484694	1485897	4694065		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|1484694_1485897_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 104
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1494463	1503613	4694065		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|1494463_1494721_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|1494880_1495168_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1495151_1495874_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1495934_1496837_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1496924_1497401_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|1497751_1498864_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1498958_1500092_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105430.1|1500101_1501055_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1501051_1501897_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1501956_1502445_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149682.1|1502485_1503613_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
>prophage 105
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1506973	1509711	4694065		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|1506973_1507702_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|1507919_1508435_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1508560_1508884_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|1508880_1509711_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 106
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1513298	1515017	4694065		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815337.1|1513298_1515017_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
>prophage 107
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1524314	1547999	4694065	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188144.1|1524314_1526261_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1526333_1526558_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1526880_1527201_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1527231_1529508_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1530192_1530411_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_029392813.1|1530695_1531400_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202175.1|1531441_1533163_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043598.1|1533163_1534930_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|1535052_1536018_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|1536562_1537057_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077038.1|1537191_1541181_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1541339_1541951_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1541961_1543305_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1543395_1544688_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|1544926_1547371_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|1547381_1547999_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 108
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1554307	1557522	4694065		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|1554307_1555048_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|1555239_1557522_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 109
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1561620	1562709	4694065		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|1561620_1562709_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 110
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1567795	1572337	4694065		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|1567795_1568080_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|1568287_1570552_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1570588_1572337_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 111
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1587042	1598012	4694065	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|1587042_1587591_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|1587617_1588265_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|1588486_1589677_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|1589861_1590950_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|1591552_1592953_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001307697.1|1593121_1594324_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_072656896.1|1594589_1597202_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|1597244_1598012_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 112
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1613931	1615839	4694065		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|1613931_1615839_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 113
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1628438	1630493	4694065		Bacillus_phage(100.0%)	1	NA	NA
WP_001295354.1|1628438_1630493_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 114
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1634726	1635386	4694065	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1634726_1635386_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 115
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1653971	1666286	4694065		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1653971_1654184_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1654194_1654383_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001309400.1|1654357_1654588_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1654577_1654751_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829662.1|1654799_1655873_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001300633.1|1655944_1658689_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.2	2.7e-37
WP_001264933.1|1658771_1659800_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120125.1|1659772_1660465_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|1660594_1661767_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062091.1|1661766_1664313_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.2e-71
WP_000209894.1|1664309_1664909_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1665060_1665366_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420621.1|1665365_1666286_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 116
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1670591	1672865	4694065		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|1670591_1670765_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_053266019.1|1671021_1672350_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.1e-233
WP_001028083.1|1672370_1672865_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 117
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1687502	1688567	4694065		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|1687502_1688567_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 118
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1695386	1697948	4694065	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409873.1|1695386_1696745_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.2	1.9e-20
WP_085947771.1|1696785_1697948_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 119
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1704138	1704972	4694065		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1704138_1704972_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 120
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1709107	1709641	4694065		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1709107_1709641_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 121
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1718949	1719870	4694065		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1718949_1719870_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 122
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1724530	1724776	4694065		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1724530_1724776_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 123
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1740659	1741601	4694065		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|1740659_1741601_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 124
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1753958	1755140	4694065		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1753958_1754693_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1754903_1755140_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 125
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1758412	1760055	4694065		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|1758412_1759054_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|1759050_1760055_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 126
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1772361	1772619	4694065		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1772361_1772619_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 127
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1779907	1787522	4694065	transposase	Planktothrix_phage(33.33%)	7	NA	NA
WP_001033694.1|1779907_1780609_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|1780608_1781853_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|1781881_1782793_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952737.1|1782808_1783648_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
WP_039003037.1|1783932_1784655_-	PAP2 family protein	NA	NA	NA	NA	NA
WP_049589868.1|1784726_1786352_-	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_012478345.1|1786547_1787522_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
>prophage 128
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1790584	1792562	4694065		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|1790584_1791442_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1791425_1792562_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 129
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1797583	1798954	4694065		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|1797583_1798954_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 130
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1802090	1805822	4694065		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000444488.1|1802090_1803341_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001295666.1|1803443_1803767_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1804302_1804413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1804465_1804870_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1805090_1805822_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 131
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1812896	1813985	4694065		Escherichia_phage(100.0%)	1	NA	NA
WP_071524883.1|1812896_1813985_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.9	8.3e-75
>prophage 132
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1819237	1820511	4694065	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947917.1|1819237_1820511_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 133
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1823865	1825553	4694065		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|1823865_1824285_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|1824284_1825553_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 134
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1852222	1854974	4694065		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|1852222_1853902_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1854026_1854974_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 135
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1858110	1862118	4694065		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|1858110_1859193_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|1859192_1860026_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200374.1|1860022_1860415_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1860418_1861228_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1861263_1862118_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 136
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1865217	1865448	4694065		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|1865217_1865448_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 137
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1876702	1887065	4694065		Escherichia_phage(25.0%)	10	NA	NA
WP_000702650.1|1876702_1878241_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571681.1|1878237_1878948_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1878947_1879625_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555857.1|1880702_1881545_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|1881594_1882053_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|1882165_1883071_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|1883162_1884176_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1884377_1885286_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1885429_1885843_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068077.1|1886447_1887065_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 138
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1896475	1898490	4694065		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|1896475_1897489_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|1897485_1898490_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 139
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1910148	1913106	4694065		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001340286.1|1910148_1911507_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	3.3e-36
WP_000763511.1|1911510_1913106_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 140
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1920075	1925367	4694065	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559286.1|1920075_1920834_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|1921053_1922103_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1922138_1922390_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1922769_1925367_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 141
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1930291	1930882	4694065		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1930291_1930882_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 142
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1938699	1944356	4694065		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|1938699_1940634_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001335988.1|1940701_1941829_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1941972_1942761_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000565727.1|1943128_1943482_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|1943549_1944356_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 143
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1957271	1958537	4694065		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|1957271_1958537_+	4-aminobutyrate aminotransferase PuuE	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 144
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1972541	1973624	4694065		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057985.1|1972541_1973624_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 145
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1990242	1990758	4694065		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|1990242_1990758_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 146
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	1997084	2010013	4694065	integrase,tRNA	Escherichia_phage(66.67%)	13	1989248:1989261	2008848:2008861
1989248:1989261	attL	AGAAAAATTTAATG	NA	NA	NA	NA
WP_000628058.1|1997084_1998317_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_072656967.1|1998571_1999555_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2000032_2001406_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|2001498_2002434_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|2002485_2003721_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2003722_2003938_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2004016_2004226_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2004218_2004413_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2004469_2005279_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_071788686.1|2007258_2008083_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	81.2	2.6e-60
WP_000788970.1|2008089_2008836_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450662.1|2008858_2009620_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.2e-117
2008848:2008861	attR	AGAAAAATTTAATG	NA	NA	NA	NA
WP_001141106.1|2009635_2010013_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.8	1.6e-54
>prophage 147
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2015274	2022567	4694065	holin,lysis,transposase	Escherichia_phage(37.5%)	11	NA	NA
WP_001702268.1|2015274_2015874_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	2.9e-106
WP_001741607.1|2015873_2016164_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_000640144.1|2016160_2016703_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.6	4.9e-76
WP_001208722.1|2016924_2017494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052921396.1|2017462_2017765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947770.1|2017859_2019229_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000781775.1|2019288_2019630_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_001194112.1|2019633_2020110_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	2.3e-85
WP_001228696.1|2020326_2020512_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2020708_2022166_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|2022303_2022567_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
>prophage 148
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2025609	2033454	4694065	tail	Enterobacteria_phage(57.14%)	7	NA	NA
WP_160194479.1|2025609_2028972_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_000885611.1|2028971_2029547_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000078178.1|2029644_2030235_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2030551_2030785_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2030853_2030967_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|2031745_2032180_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|2032320_2033454_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 149
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2038414	2039404	4694065		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|2038414_2039404_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 150
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2077061	2080964	4694065		Klosneuvirus(100.0%)	1	NA	NA
WP_000139543.1|2077061_2080964_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 151
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2084902	2087541	4694065	transposase	Escherichia_phage(33.33%)	4	NA	NA
WP_000428998.1|2084902_2085433_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|2085677_2085851_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|2085922_2086072_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_085947770.1|2086171_2087541_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 152
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2102227	2109277	4694065		Phage_TP(25.0%)	7	NA	NA
WP_001303492.1|2102227_2104189_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|2104280_2104511_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|2104732_2104909_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|2104954_2105371_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760626.1|2105449_2106856_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|2107100_2108246_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|2108263_2109277_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 153
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2116409	2118512	4694065		Salmonella_phage(100.0%)	1	NA	NA
WP_000689363.1|2116409_2118512_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 154
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2123418	2125527	4694065		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103220.1|2123418_2125527_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.6e-27
>prophage 155
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2136805	2138350	4694065		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|2136805_2138350_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 156
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2145234	2145525	4694065		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|2145234_2145525_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 157
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2151894	2153335	4694065		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|2151894_2152179_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642433.1|2152324_2153335_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 158
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2156608	2158514	4694065		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285536.1|2156608_2157535_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_000193547.1|2157527_2158514_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 159
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2162882	2166689	4694065		Klosneuvirus(50.0%)	2	NA	NA
WP_001360132.1|2162882_2165282_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426292.1|2165306_2166689_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 160
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2172330	2173539	4694065	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|2172330_2173539_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 161
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2179593	2180802	4694065	transposase	uncultured_marine_virus(100.0%)	1	NA	NA
WP_001352368.1|2179593_2180802_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
>prophage 162
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2192876	2194150	4694065	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947917.1|2192876_2194150_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 163
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2199950	2201223	4694065	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947917.1|2199950_2201223_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 164
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2206387	2207923	4694065		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194860.1|2206387_2207923_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	4.4e-21
>prophage 165
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2215804	2216752	4694065		Bacillus_virus(100.0%)	1	NA	NA
WP_000878968.1|2215804_2216752_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	29.6	7.3e-19
>prophage 166
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2224471	2224855	4694065		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|2224471_2224855_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 167
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2227857	2228748	4694065		Bacillus_phage(100.0%)	1	NA	NA
WP_072656997.1|2227857_2228748_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 168
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2234112	2268056	4694065	transposase,tail,lysis	Enterobacteria_phage(25.81%)	48	NA	NA
WP_000214712.1|2234112_2234316_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|2234350_2235811_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|2235899_2237183_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2237788_2237902_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2237970_2238204_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|2238520_2239111_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|2239208_2239784_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000453611.1|2241460_2242006_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|2242394_2242628_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|2242685_2243096_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|2243247_2243421_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2243592_2243748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|2243826_2243892_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|2243894_2244083_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2244093_2244306_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2244668_2245166_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2245162_2245696_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|2245692_2246004_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2246008_2246224_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2246977_2247193_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2247493_2247706_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2247760_2247850_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|2248127_2248880_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_072134002.1|2248893_2249547_-	DUF968 domain-containing protein	NA	Q8SBE5	Shigella_phage	61.3	5.2e-72
WP_000813254.1|2249737_2249893_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2249964_2250252_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2250251_2250491_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2250515_2250821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2251023_2251356_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|2251792_2253106_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|2253283_2253466_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_029393055.1|2254083_2254380_-	hypothetical protein	NA	U5P0A0	Shigella_phage	62.9	1.2e-07
WP_000920568.1|2254363_2254594_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2254677_2255085_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2255251_2255407_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_032306542.1|2255566_2255776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|2255831_2256851_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2256862_2258077_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|2258282_2258609_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2258743_2259085_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2259119_2259680_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2259682_2260393_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|2260500_2260806_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|2261004_2263431_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_160194488.1|2263491_2265915_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
WP_000213028.1|2265925_2266543_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|2266544_2267399_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2267441_2268056_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 169
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2285817	2287119	4694065		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|2285817_2287119_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 170
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2297195	2299007	4694065		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|2297195_2299007_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 171
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2318883	2320158	4694065	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2318883_2320158_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 172
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2327069	2328568	4694065		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|2327069_2327591_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|2327671_2328568_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 173
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2337370	2346251	4694065		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|2337370_2338186_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|2338313_2338895_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|2339129_2340299_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2340464_2340554_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|2340852_2341878_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|2341874_2342807_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|2342919_2344131_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|2344421_2345570_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|2345609_2346251_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 174
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2351755	2354022	4694065		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587525.1|2351755_2352568_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069979.1|2352571_2353357_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|2353353_2354022_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 175
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2362311	2367395	4694065		environmental_halophage(33.33%)	5	NA	NA
WP_000577988.1|2362311_2363532_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907979.1|2363528_2364800_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948863.1|2364774_2365521_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	31.4	8.4e-10
WP_000089364.1|2365530_2367018_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|2367026_2367395_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 176
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2385985	2409587	4694065	tRNA,transposase	Tupanvirus(20.0%)	21	NA	NA
WP_072656891.1|2385985_2387686_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	1.8e-31
WP_000069375.1|2387742_2390121_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|2390453_2391287_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|2391443_2392490_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|2392621_2392813_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175703.1|2392816_2394253_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001300634.1|2394315_2395029_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|2395275_2395740_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|2395817_2396567_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154168.1|2396566_2397118_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|2397180_2398161_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2398261_2398561_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|2398565_2400953_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2400967_2401951_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2402234_2402279_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|2402401_2402758_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2402810_2403008_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2403104_2403647_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2403650_2405579_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_072656890.1|2408173_2408284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947917.1|2408314_2409587_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 177
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2418194	2420456	4694065		Tupanvirus(100.0%)	1	NA	NA
WP_000077872.1|2418194_2420456_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 178
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2426800	2427628	4694065		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|2426800_2427628_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 179
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2435104	2436325	4694065		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|2435104_2436325_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 180
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2443089	2443743	4694065		Planktothrix_phage(100.0%)	1	NA	NA
WP_001300558.1|2443089_2443743_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	1.2e-12
>prophage 181
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2449341	2451303	4694065		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|2449341_2451303_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 182
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2456229	2460314	4694065		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|2456229_2456871_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_000438807.1|2456963_2458322_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719096.1|2458438_2459197_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723710.1|2459333_2460314_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 183
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2469124	2469979	4694065		Indivirus(100.0%)	1	NA	NA
WP_001186371.1|2469124_2469979_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	2.5e-10
>prophage 184
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2473297	2477874	4694065		Bacillus_phage(100.0%)	3	NA	NA
WP_000219687.1|2473297_2474581_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|2474727_2476203_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|2476383_2477874_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 185
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2492403	2500509	4694065	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2492403_2494089_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2494293_2494875_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220966.1|2494914_2495610_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2495667_2497578_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2497709_2498054_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2498415_2498775_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2498894_2499074_-	YoaH family protein	NA	NA	NA	NA	NA
WP_029392722.1|2499147_2500509_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	1.5e-41
>prophage 186
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2504371	2505928	4694065		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2504371_2505928_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 187
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2511568	2511778	4694065		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2511568_2511778_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 188
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2517110	2519159	4694065		Moraxella_phage(100.0%)	1	NA	NA
WP_001055791.1|2517110_2519159_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 189
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2526655	2531125	4694065		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|2526655_2527312_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976476.1|2527707_2528049_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879289.1|2528061_2528934_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|2528937_2529312_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2529450_2529681_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2529782_2530439_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2530462_2531125_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 190
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2539181	2540657	4694065		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2539181_2540657_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 191
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2544655	2551719	4694065		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|2544655_2545978_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|2545993_2546926_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2547004_2547760_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571480.1|2547756_2548542_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2548688_2549699_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2549707_2550319_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|2550457_2550523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024932.1|2550593_2551196_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2551197_2551719_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 192
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2555737	2557788	4694065		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|2555737_2556556_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2556608_2557004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019590.1|2557044_2557788_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 193
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2564404	2566138	4694065	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|2564404_2566138_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 194
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2571736	2573251	4694065		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|2571736_2573251_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 195
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2585243	2585996	4694065		Bacillus_virus(100.0%)	1	NA	NA
WP_001272991.1|2585243_2585996_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 196
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2598002	2598671	4694065		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334583.1|2598002_2598671_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	7.3e-82
>prophage 197
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2614505	2621262	4694065		Burkholderia_phage(50.0%)	7	NA	NA
WP_001350521.1|2614505_2616200_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2616370_2616553_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922686.1|2616631_2617549_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2617721_2618642_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786005.1|2618630_2619101_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001157239.1|2619081_2620500_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365562.1|2620566_2621262_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
>prophage 198
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2626333	2627005	4694065		Bacillus_phage(100.0%)	1	NA	NA
WP_001395354.1|2626333_2627005_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	2.4e-32
>prophage 199
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2630549	2631080	4694065		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|2630549_2631080_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 200
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2655201	2656475	4694065	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947917.1|2655201_2656475_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 201
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2660644	2666325	4694065	transposase	Enterobacteria_phage(25.0%)	5	NA	NA
WP_053266140.1|2660644_2661571_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	88.1	3.4e-154
WP_053266144.1|2661567_2661930_-	GtrA family protein	NA	U5P0S6	Shigella_phage	85.0	1.4e-50
WP_123060056.1|2662554_2664063_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	4.7e-44
WP_052953619.1|2664371_2664782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|2665173_2666325_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 202
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2671744	2672911	4694065		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|2671744_2672911_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 203
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2679108	2680008	4694065		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2679108_2680008_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 204
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2687361	2693462	4694065		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_047399991.1|2687361_2688528_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.4	1.0e-110
WP_000043428.1|2688773_2690180_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	6.2e-38
WP_001313975.1|2690299_2690659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912441.1|2693087_2693462_-	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	46.0	1.6e-17
>prophage 205
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2697724	2704031	4694065		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001100804.1|2697724_2698270_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
WP_000857516.1|2698274_2699153_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.1e-106
WP_001023625.1|2699211_2700111_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	2.6e-29
WP_000699403.1|2700110_2701196_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
WP_000183060.1|2701568_2702462_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_047399983.1|2702636_2704031_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	8.3e-19
>prophage 206
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2709646	2716440	4694065		Bacillus_phage(25.0%)	6	NA	NA
WP_047399976.1|2709646_2711017_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_053266106.1|2711209_2712646_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.4	1.1e-47
WP_000699714.1|2712648_2713872_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479838.1|2713868_2714348_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043607.1|2714347_2715316_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_047399972.1|2715318_2716440_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 207
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2720683	2731146	4694065		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|2720683_2721523_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_047399969.1|2721700_2723863_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|2723865_2724309_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2724314_2725454_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_053266109.1|2726112_2727696_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	3.2e-35
WP_053266110.1|2727969_2729811_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2729831_2730413_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2730504_2731146_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 208
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2735809	2737162	4694065		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_053266112.1|2735809_2737162_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	2.7e-06
>prophage 209
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2750602	2790946	4694065	plate,tail,transposase,integrase,terminase,capsid,tRNA,head,portal,lysis,holin	Escherichia_phage(45.24%)	50	2757105:2757131	2789138:2789164
WP_000675150.1|2750602_2752006_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|2752002_2752725_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_085947770.1|2753032_2754401_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_072657031.1|2754414_2754693_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2754901_2755198_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2755199_2755496_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2755598_2756960_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2757105:2757131	attL	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000468308.1|2757232_2757451_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882991.1|2757532_2758696_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	5.4e-205
WP_000978897.1|2758695_2759175_-|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_001564784.1|2759189_2761637_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	92.9	0.0e+00
WP_000785970.1|2761629_2761749_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2761781_2762057_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2762113_2762632_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001564785.1|2762644_2763835_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	2.4e-224
WP_001403134.1|2764231_2765164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001403135.1|2765317_2765845_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	94.9	4.0e-91
WP_001403136.1|2765848_2767858_-|tail	tail fiber protein (GpH)	tail	Q7Y4D4	Escherichia_virus	97.8	0.0e+00
WP_001285325.1|2767868_2768399_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001564786.1|2768391_2769300_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	6.3e-161
WP_000127164.1|2769304_2769652_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001093716.1|2769648_2770284_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	2.0e-113
WP_072657061.1|2770367_2771153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001403140.1|2771224_2771677_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	3.8e-74
WP_001403141.1|2771669_2772137_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	4.3e-81
WP_001440152.1|2772099_2772273_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001564788.1|2772244_2772670_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	4.7e-66
WP_001564789.1|2772657_2773083_-	hypothetical protein	NA	Q858W1	Yersinia_virus	91.5	2.5e-59
WP_001144101.1|2773097_2773595_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|2773594_2773876_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846409.1|2773879_2774083_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2774082_2774592_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001564790.1|2774691_2775435_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.2	2.3e-124
WP_001564791.1|2775438_2776512_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.2	9.7e-201
WP_001085953.1|2776570_2777425_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_000156872.1|2777598_2779371_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_160194482.1|2779370_2780405_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.1	1.0e-199
WP_001389235.1|2780795_2781779_+	DNA-processing protein DprA	NA	NA	NA	NA	NA
WP_001062015.1|2781771_2783055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001564793.1|2783230_2785486_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.7	0.0e+00
WP_000027664.1|2785475_2785751_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113270.1|2785747_2785972_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277962.1|2785971_2786274_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	98.0	8.5e-46
WP_000557703.1|2786273_2786498_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|2786561_2787062_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000043869.1|2787239_2787515_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|2787629_2787929_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_001543021.1|2788044_2789058_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	5.4e-193
WP_001565686.1|2789323_2789641_-	hypothetical protein	NA	NA	NA	NA	NA
2789138:2789164	attR	AATCTCCCTTACACGGGCTTATTTTTT	NA	NA	NA	NA
WP_000807362.1|2790046_2790946_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 210
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2800166	2803723	4694065		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|2800166_2801171_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000012001.1|2801167_2802133_+	kinase	NA	NA	NA	NA	NA
WP_072656881.1|2802106_2802853_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351783.1|2802904_2803723_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
>prophage 211
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2814371	2816405	4694065	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001350533.1|2814371_2816405_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 212
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2828036	2837477	4694065		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|2828036_2829173_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_001375261.1|2829169_2831170_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2831294_2831756_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2831795_2832266_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2832312_2833032_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2833028_2834714_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2834935_2835667_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2835726_2835834_+	protein YohO	NA	NA	NA	NA	NA
WP_000783123.1|2835814_2836546_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569315.1|2836550_2837477_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 213
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2857839	2859360	4694065		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|2857839_2859360_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 214
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2863054	2866840	4694065		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2863054_2863723_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|2863980_2864817_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489247.1|2864848_2866840_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 215
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2870910	2871768	4694065		Catovirus(100.0%)	1	NA	NA
WP_000873894.1|2870910_2871768_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	4.0e-24
>prophage 216
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2886315	2890616	4694065		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091940.1|2886315_2887782_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
WP_000198828.1|2887899_2888886_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000594599.1|2888924_2889638_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|2890049_2890616_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 217
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2896370	2904018	4694065		Vibrio_phage(50.0%)	7	NA	NA
WP_000194927.1|2896370_2897960_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|2897963_2898308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|2898640_2899831_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|2899858_2900554_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578061.1|2900702_2902463_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_000494183.1|2902587_2902872_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050793.1|2903010_2904018_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 218
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2915892	2916510	4694065		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2915892_2916510_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 219
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2925843	2931621	4694065		Bacillus_phage(25.0%)	5	NA	NA
WP_000422182.1|2925843_2927487_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
WP_000884971.1|2927562_2928213_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
WP_000710375.1|2928212_2929277_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406064.1|2929350_2930406_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865568.1|2930517_2931621_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.2e-117
>prophage 220
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2935898	2940741	4694065		Hokovirus(50.0%)	2	NA	NA
WP_000876011.1|2935898_2938748_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_000559125.1|2938914_2940741_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 221
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2955664	2958292	4694065		Bacillus_virus(100.0%)	1	NA	NA
WP_001281218.1|2955664_2958292_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	1.1e-91
>prophage 222
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2963736	2969883	4694065		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075164.1|2963736_2966022_+	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_029395970.1|2966255_2967386_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.1e-175
WP_000135040.1|2967385_2967640_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|2967693_2968344_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779105.1|2968806_2969883_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 223
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2975775	2980286	4694065	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140569.1|2975775_2976675_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000150333.1|2976687_2976873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992954.1|2976913_2977717_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_072656965.1|2977734_2979024_-	MFS transporter	NA	NA	NA	NA	NA
WP_001319848.1|2979080_2980286_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 224
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	2983889	2988893	4694065		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|2983889_2984492_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001295286.1|2984799_2985939_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|2985942_2986911_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|2986910_2988893_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 225
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3027733	3030961	4694065		Salmonella_phage(50.0%)	3	NA	NA
WP_000813859.1|3027733_3028333_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|3028391_3030224_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|3030310_3030961_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 226
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3041520	3043381	4694065	transposase	Sodalis_phage(50.0%)	2	NA	NA
WP_000156149.1|3041520_3042411_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	43.9	8.9e-67
WP_001293613.1|3042607_3043381_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 227
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3047592	3049110	4694065		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|3047592_3049110_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 228
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3055586	3056723	4694065		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699145.1|3055586_3056723_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 229
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3065259	3066345	4694065		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|3065259_3066345_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 230
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3084173	3085106	4694065		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368140.1|3084173_3085106_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
>prophage 231
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3093031	3100608	4694065		Bacillus_phage(50.0%)	4	NA	NA
WP_001326970.1|3093031_3096625_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
WP_001296867.1|3096680_3097826_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|3097899_3098844_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283490.1|3098913_3100608_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 232
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3104302	3105223	4694065		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|3104302_3105223_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 233
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3109040	3109775	4694065		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3109040_3109775_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 234
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3135470	3148124	4694065		Streptococcus_phage(40.0%)	12	NA	NA
WP_000443661.1|3135470_3137486_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_001300494.1|3137556_3138543_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|3138772_3139534_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|3139718_3140690_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|3141073_3141331_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|3141375_3143103_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|3143143_3143653_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_053266131.1|3143695_3144547_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719962.1|3144651_3145026_+	YfeK family protein	NA	NA	NA	NA	NA
WP_029392762.1|3145058_3145793_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001336044.1|3145981_3146893_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
WP_000021036.1|3147026_3148124_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 235
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3151141	3151933	4694065		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|3151141_3151933_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 236
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3155411	3160531	4694065		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001327042.1|3155411_3156716_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|3156955_3157855_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838944.1|3157950_3158526_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001350539.1|3158586_3159036_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000405996.1|3159022_3159448_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000102886.1|3159661_3160531_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 237
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3179185	3180136	4694065		Cyanophage(100.0%)	1	NA	NA
WP_053266134.1|3179185_3180136_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	7.4e-11
>prophage 238
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3197424	3198138	4694065		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3197424_3198138_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 239
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3219390	3223392	4694065		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|3219390_3220680_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|3220765_3221392_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001336050.1|3221716_3222754_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001028612.1|3222753_3223392_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
>prophage 240
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3229827	3236122	4694065		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|3229827_3230001_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|3230314_3230830_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755173.1|3230845_3231385_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138270.1|3231477_3233055_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|3233123_3234590_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937912.1|3234751_3236122_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 241
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3244952	3245384	4694065		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3244952_3245384_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 242
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3255594	3262051	4694065		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133592.1|3255594_3256878_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|3257055_3257256_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|3257267_3257603_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|3257604_3259455_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|3259471_3259987_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3260082_3260406_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3260422_3260809_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3260836_3262051_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 243
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3277369	3278881	4694065		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493470.1|3277369_3278881_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 244
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3284773	3296063	4694065		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|3284773_3286027_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_029392861.1|3286354_3287545_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3287589_3287928_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001295369.1|3287988_3289323_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|3289312_3290026_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001311037.1|3290190_3291618_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970102.1|3292175_3296063_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
>prophage 245
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3300182	3300443	4694065		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|3300182_3300443_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 246
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3303902	3307644	4694065		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3303902_3304583_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002541.1|3304854_3305829_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3305844_3307644_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 247
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3313415	3319674	4694065	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219203.1|3313415_3314750_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001300638.1|3314958_3315840_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3315942_3316530_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3316585_3316969_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3317273_3317963_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3318010_3319048_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3319254_3319674_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 248
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3324967	3326266	4694065		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|3324967_3326266_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 249
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3332122	3334696	4694065		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3332122_3334696_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 250
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3340602	3341673	4694065		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|3340602_3341673_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 251
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3355418	3366866	4694065	integrase	Enterobacteria_phage(70.0%)	12	3351175:3351188	3358523:3358536
3351175:3351188	attL	CATGATAATTTCTT	NA	NA	NA	NA
WP_000162574.1|3355418_3355901_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000124726.1|3356662_3357871_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	6.6e-105
WP_001183325.1|3357874_3359833_+	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	36.3	3.9e-67
3358523:3358536	attR	CATGATAATTTCTT	NA	NA	NA	NA
WP_000446146.1|3360050_3360623_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638636.1|3360696_3361197_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283018.1|3361193_3361928_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	99.2	3.6e-130
WP_001149160.1|3362480_3362747_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_072656943.1|3362743_3363334_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	99.3	2.0e-70
WP_001244665.1|3363326_3363614_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_072656944.1|3363606_3364062_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	2.3e-63
WP_072656945.1|3364197_3364518_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_072656946.1|3364532_3366866_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
>prophage 252
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3372457	3372676	4694065		Salmonella_phage(100.0%)	1	NA	NA
WP_071524906.1|3372457_3372676_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
>prophage 253
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3382127	3386179	4694065		Klosneuvirus(50.0%)	4	NA	NA
WP_001087611.1|3382127_3383408_+	4-aminobutyrate aminotransferase GabT	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_072656948.1|3383645_3385046_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|3385066_3385729_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|3385729_3386179_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 254
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3390115	3395410	4694065		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|3390115_3390361_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|3390357_3390768_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246534.1|3390740_3392885_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_072656949.1|3392894_3393854_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.9e-132
WP_000985494.1|3394207_3395410_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 255
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3408360	3413746	4694065	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3408360_3408546_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047184.1|3408780_3411411_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|3411538_3412039_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3412107_3413169_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|3413248_3413746_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 256
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3419212	3420178	4694065		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|3419212_3420178_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 257
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3427653	3428667	4694065		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300815.1|3427653_3428667_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.4	9.3e-28
>prophage 258
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3446492	3459674	4694065		Escherichia_phage(50.0%)	12	NA	NA
WP_053266151.1|3446492_3449054_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141322.1|3449159_3449816_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3449866_3450634_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3450829_3451738_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001393459.1|3451734_3452901_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|3452992_3453631_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3453635_3454412_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3454500_3455865_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3455958_3456951_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3457013_3458153_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3458292_3458919_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3458912_3459674_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 259
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3462786	3464819	4694065		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|3462786_3463392_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|3463391_3464819_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 260
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3488825	3489611	4694065		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021334.1|3488825_3489611_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.2e-20
>prophage 261
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3494084	3499004	4694065		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|3494084_3494756_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288228.1|3494894_3495035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268460.1|3495048_3495921_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|3495980_3497279_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3497366_3499004_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 262
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3503036	3507151	4694065		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046812.1|3503036_3504338_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_000186450.1|3504394_3507151_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 263
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3514685	3515534	4694065		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|3514685_3515534_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 264
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3520392	3521148	4694065		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3520392_3521148_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 265
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3532674	3548112	4694065	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_029392756.1|3532674_3533880_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	1.7e-73
WP_000184261.1|3533879_3534323_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|3534373_3535180_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|3535418_3536516_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|3536984_3538238_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|3538469_3539801_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|3539862_3541689_-	RecBCD enzyme subunit RecD	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_001285993.1|3541688_3545231_-	RecBCD enzyme subunit RecB	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_001138201.1|3545223_3548112_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 266
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3553588	3560361	4694065		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|3553588_3554383_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|3554389_3555265_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957910.1|3555415_3557662_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3557674_3558205_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|3558889_3559579_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3559647_3560361_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 267
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3569991	3572486	4694065		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|3569991_3571410_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603502.1|3571724_3572486_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 268
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3581812	3582975	4694065	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947771.1|3581812_3582975_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 269
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3587638	3588912	4694065	transposase	Shigella_phage(100.0%)	1	NA	NA
WP_085947917.1|3587638_3588912_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 270
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3594836	3595592	4694065		Clostridium_phage(100.0%)	1	NA	NA
WP_001301085.1|3594836_3595592_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 271
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3620051	3635444	4694065	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|3620051_3621452_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001336279.1|3621469_3622786_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|3622821_3624189_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|3624224_3624713_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001350545.1|3624712_3626632_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|3627067_3628516_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|3628517_3628643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3628639_3628711_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192820.1|3628765_3629314_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|3629357_3630875_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3630884_3631983_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813200.1|3632073_3633807_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_000715214.1|3633812_3634523_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3634547_3635444_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 272
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3639368	3644742	4694065		Pandoravirus(50.0%)	3	NA	NA
WP_001336277.1|3639368_3640802_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
WP_000951964.1|3640858_3641602_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195062.1|3641868_3644742_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.2e-263
>prophage 273
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3652878	3654111	4694065		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3652878_3654111_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 274
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3677613	3715386	4694065	integrase,tRNA,protease,transposase	Staphylococcus_phage(33.33%)	36	3706120:3706136	3726839:3726855
WP_001326497.1|3677613_3678372_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105566.1|3678577_3679498_-	agmatinase	NA	NA	NA	NA	NA
WP_072656915.1|3679635_3681612_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3681620_3681752_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|3681887_3682103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3682406_3683561_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3683984_3685379_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001300769.1|3685455_3685953_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3686047_3686755_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3686834_3687566_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3687578_3688529_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3688637_3689201_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3689200_3689617_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001326494.1|3689800_3690781_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3690798_3691503_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3691520_3692087_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000994920.1|3692083_3692374_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174777.1|3692381_3692975_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_000239943.1|3692967_3694104_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745210.1|3694258_3695266_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394131.1|3695382_3696429_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3696604_3697324_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3697507_3697834_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3697833_3698553_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001321419.1|3698713_3699766_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3699793_3700069_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3700133_3701213_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|3701414_3702671_+	nucleoside permease	NA	NA	NA	NA	NA
WP_001326492.1|3702720_3704856_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|3705253_3705961_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
3706120:3706136	attL	TTCGATTCCGAGTCCGG	NA	NA	NA	NA
WP_072656916.1|3706339_3707404_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	3.7e-67
WP_001118619.1|3707470_3708394_+|transposase	IS5-like element IS903B family transposase	transposase	Q9MCT5	Escherichia_phage	100.0	2.2e-177
WP_089551125.1|3710200_3711474_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	7.2e-171
WP_063073050.1|3711803_3713669_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_077250692.1|3713964_3714315_+|transposase	transposase	transposase	Q716C1	Shigella_phage	96.6	4.4e-38
WP_001254932.1|3714234_3715386_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3726839:3726855	attR	TTCGATTCCGAGTCCGG	NA	NA	NA	NA
>prophage 275
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3718636	3722899	4694065		Escherichia_phage(100.0%)	1	NA	NA
WP_072656976.1|3718636_3722899_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.7	1.9e-127
>prophage 276
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3746662	3747547	4694065		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3746662_3747547_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 277
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3753623	3762974	4694065		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|3753623_3754451_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691619.1|3754650_3755577_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|3755627_3755885_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|3755927_3758147_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|3758257_3759670_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|3759744_3760482_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3760715_3762974_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 278
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3766284	3766677	4694065		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|3766284_3766677_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 279
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3770504	3784415	4694065	transposase	Bacillus_virus(16.67%)	15	NA	NA
WP_000195296.1|3770504_3772397_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3772425_3773007_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3773006_3773834_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3773858_3774281_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3774281_3774911_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|3775115_3776597_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|3776744_3777416_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|3777421_3778582_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188362.1|3778619_3779435_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3779550_3780324_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3780381_3780552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3780813_3781467_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_001295626.1|3781840_3782131_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_001272145.1|3782414_3782966_+	fimbrial-like protein	NA	NA	NA	NA	NA
WP_085947917.1|3783142_3784415_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 280
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3792320	3793754	4694065		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3792320_3793754_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 281
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3798891	3800130	4694065	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|3798891_3800130_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 282
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3806530	3822725	4694065	tRNA	Moraxella_phage(16.67%)	11	NA	NA
WP_001264352.1|3806530_3807544_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|3807781_3807997_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3808107_3809853_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|3810047_3811889_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_001066494.1|3812726_3813491_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|3813778_3814402_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094721.1|3814555_3816076_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_000627220.1|3816382_3817873_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.2e-33
WP_000450594.1|3817914_3818247_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|3818465_3819449_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082856.1|3819632_3822725_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
>prophage 283
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3835579	3836545	4694065		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|3835579_3836545_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 284
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3857123	3859418	4694065		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3857123_3859418_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 285
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3867624	3868770	4694065		Streptococcus_phage(100.0%)	1	NA	NA
WP_072656910.1|3867624_3868770_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	4.8e-49
>prophage 286
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3889474	3897268	4694065		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|3889474_3890335_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249104.1|3890399_3892436_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246830.1|3892393_3892789_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|3892808_3893399_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|3893408_3893984_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147574.1|3894097_3895138_-	permease	NA	NA	NA	NA	NA
WP_001300423.1|3895210_3895846_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|3895973_3896492_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|3896471_3896915_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189333.1|3896965_3897268_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 287
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3902970	3904860	4694065		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|3902970_3904860_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 288
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3910341	3916980	4694065		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|3910341_3913014_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|3913038_3914526_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|3914553_3915006_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|3915636_3916980_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 289
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3921062	3923935	4694065	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|3921062_3921911_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|3922000_3923935_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 290
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3930709	3932187	4694065		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|3930709_3931681_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|3931908_3932187_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 291
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3936255	3951050	4694065		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|3936255_3937065_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_029392759.1|3937274_3938252_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|3938265_3939252_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|3939272_3939839_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|3939835_3940411_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|3940379_3940937_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3940943_3941669_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|3941716_3943150_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|3943172_3943460_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|3943577_3944069_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3944114_3944969_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3944965_3945238_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|3945451_3946084_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|3946080_3946809_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|3946805_3947459_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|3947688_3950025_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|3950120_3951050_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 292
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3963626	3968374	4694065		Salmonella_phage(50.0%)	5	NA	NA
WP_000445111.1|3963626_3964754_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|3964813_3965278_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209011.1|3965274_3966150_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|3966146_3966836_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108454.1|3966883_3968374_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	6.4e-09
>prophage 293
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3972078	3972576	4694065	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3972078_3972576_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 294
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3976542	3979067	4694065	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|3976542_3977910_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|3977999_3979067_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 295
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	3995843	3996887	4694065		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3995843_3996887_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 296
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4009196	4013350	4694065		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738568.1|4009196_4010222_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019655.1|4010289_4011471_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001300681.1|4011480_4012584_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|4012591_4013350_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 297
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4023847	4025319	4694065	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|4023847_4024357_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004473.1|4024371_4025319_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 298
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4047311	4049264	4694065		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|4047311_4049264_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 299
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4058094	4066653	4694065		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773156.1|4058094_4060788_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|4061079_4062264_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|4062334_4064449_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|4064545_4065016_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4065112_4065487_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|4065612_4065900_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|4065907_4066267_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|4066266_4066653_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 300
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4072223	4081764	4694065		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|4072223_4074137_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|4074136_4075159_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|4075152_4075371_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|4075424_4076294_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|4076348_4076753_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|4077054_4077687_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|4077737_4079828_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|4079894_4081115_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|4081200_4081764_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 301
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4106011	4106848	4694065		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|4106011_4106848_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 302
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4123752	4127519	4694065		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|4123752_4125375_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|4125450_4126803_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|4126799_4127519_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 303
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4134101	4134980	4694065		Sodalis_phage(100.0%)	1	NA	NA
WP_000039062.1|4134101_4134980_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 304
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4141014	4143408	4694065		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_072656900.1|4141014_4143408_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 305
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4147787	4149014	4694065		Ralstonia_phage(100.0%)	1	NA	NA
WP_072656901.1|4147787_4149014_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.8	2.0e-133
>prophage 306
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4155069	4157517	4694065		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|4155069_4157517_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 307
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4177528	4179339	4694065		Enterococcus_phage(50.0%)	2	NA	NA
WP_072656902.1|4177528_4178272_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	5.8e-11
WP_000907792.1|4178268_4179339_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 308
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4182882	4184365	4694065		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416891.1|4182882_4183596_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	7.0e-14
WP_000082101.1|4183597_4184365_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 309
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4190087	4192906	4694065		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4190087_4190942_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4191186_4192245_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|4192237_4192906_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 310
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4195909	4200041	4694065		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|4195909_4196536_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106551.1|4196609_4198808_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	8.5e-119
WP_000130621.1|4198909_4199155_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|4199375_4200041_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 311
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4207934	4213586	4694065		Bacillus_virus(50.0%)	3	NA	NA
WP_000173631.1|4207934_4208741_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|4208746_4209148_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_160194485.1|4209350_4213586_+	DUF4329 domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.3e-26
>prophage 312
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4216961	4219697	4694065		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|4216961_4219697_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 313
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4233298	4235341	4694065		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|4233298_4235341_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 314
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4238686	4240821	4694065		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|4238686_4239040_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|4239093_4240383_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|4240395_4240821_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 315
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4244214	4244862	4694065		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|4244214_4244862_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 316
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4290823	4292808	4694065		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|4290823_4291828_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|4291824_4292808_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 317
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4303020	4305354	4694065		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|4303020_4305354_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 318
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4309008	4311008	4694065	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|4309008_4309221_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135732.1|4309407_4309560_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085947770.1|4309639_4311008_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 319
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4314846	4315842	4694065		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|4314846_4315842_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 320
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4321160	4322702	4694065		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146473.1|4321160_4322702_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	3.3e-16
>prophage 321
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4346976	4355276	4694065	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_000582468.1|4346976_4348821_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
WP_000206275.1|4348817_4350209_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|4350306_4350915_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_112030701.1|4351142_4355276_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.7e-25
>prophage 322
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4373150	4383879	4694065		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|4373150_4373402_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4373543_4373975_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001350558.1|4374219_4375764_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|4375773_4377057_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483847.1|4377060_4378020_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982115.1|4378006_4379041_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646007.1|4379279_4380305_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|4380314_4381511_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_014639028.1|4381785_4382658_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|4382946_4383879_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 323
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4398784	4403347	4694065		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|4398784_4399264_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114543.1|4399302_4400112_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|4400209_4400377_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4400397_4400634_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001350561.1|4400850_4401519_-	RadC family protein	NA	NA	NA	NA	NA
WP_000050139.1|4401690_4402911_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001393518.1|4402891_4403347_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	1.2e-48
>prophage 324
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4408044	4414794	4694065		Morganella_phage(25.0%)	6	NA	NA
WP_001350563.1|4408044_4408869_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.9	1.0e-96
WP_000924289.1|4409159_4409777_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870036.1|4409773_4411456_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
WP_001295237.1|4411713_4412337_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4412391_4412667_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|4412685_4414794_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 325
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4419230	4420622	4694065		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4419230_4420622_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 326
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4432740	4434075	4694065		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|4432740_4434075_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 327
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4441381	4450402	4694065		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168475.1|4441381_4443070_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001300753.1|4443175_4443274_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001054909.1|4443838_4443928_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|4444207_4445392_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|4445399_4445897_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4445893_4446256_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4446245_4446593_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|4446700_4447150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828527.1|4447196_4448690_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_001087145.1|4448686_4450402_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 328
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4456754	4457708	4694065		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|4456754_4457183_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4457294_4457708_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 329
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4462135	4463284	4694065		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|4462135_4463284_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 330
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4467990	4475359	4694065		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|4467990_4470405_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4470433_4471507_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4471506_4472607_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4472611_4474015_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_141010492.1|4474311_4474392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|4474621_4474762_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4474778_4475138_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4475101_4475359_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 331
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4485557	4486895	4694065		Moraxella_phage(100.0%)	1	NA	NA
WP_000019348.1|4485557_4486895_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 332
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4498654	4506262	4694065		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|4498654_4499428_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251998.1|4499610_4500501_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4500500_4501460_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4501546_4502587_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334099.1|4502900_4504730_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|4504891_4506262_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 333
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4518216	4519209	4694065		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|4518216_4519209_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 334
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4522377	4528230	4694065		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|4522377_4524246_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001301979.1|4524412_4524832_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|4524839_4526345_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|4526349_4527315_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056271.1|4527339_4528230_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	2.5e-05
>prophage 335
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4541624	4543271	4694065		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012607.1|4541624_4543271_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 336
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4551743	4557157	4694065		Bacillus_phage(33.33%)	4	NA	NA
WP_001238899.1|4551743_4553765_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.2e-113
WP_001295254.1|4553811_4555296_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|4555431_4556697_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|4556827_4557157_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 337
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4561199	4567343	4694065		Enterobacteria_phage(40.0%)	6	NA	NA
WP_001340422.1|4561199_4562330_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
WP_000006621.1|4562326_4563589_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226601.1|4563588_4564656_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_000676056.1|4564674_4565556_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145183.1|4565533_4566208_+	dTDP-fucosamine acetyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|4566212_4567343_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 338
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4575418	4577074	4694065		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395863.1|4575418_4577074_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	2.3e-44
>prophage 339
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4587353	4591212	4694065		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|4587353_4588250_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|4588249_4588966_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|4589049_4591212_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 340
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4596930	4598760	4694065		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|4596930_4598760_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 341
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4611292	4614579	4694065		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|4611292_4612933_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|4613011_4613281_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4613284_4613800_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4613802_4614579_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 342
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4623460	4624075	4694065		Streptococcus_phage(100.0%)	1	NA	NA
WP_001308167.1|4623460_4624075_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 343
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4637934	4640721	4694065		uncultured_virus(100.0%)	1	NA	NA
WP_021570273.1|4637934_4640721_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.2	5.8e-72
>prophage 344
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4644837	4647308	4694065		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|4644837_4646247_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|4646258_4647308_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 345
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4656721	4659501	4694065		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718893.1|4656721_4657618_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621656.1|4657785_4658682_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|4658715_4659501_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 346
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4666818	4669869	4694065		Escherichia_phage(100.0%)	1	NA	NA
WP_010723259.1|4666818_4669869_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 347
NZ_CP047594	Escherichia coli strain LD27-1 chromosome, complete genome	4694065	4684856	4693804	4694065	integrase	Enterobacteria_phage(30.0%)	13	4680253:4680265	4692530:4692542
4680253:4680265	attL	CGGCGCATAGCTG	NA	NA	NA	NA
WP_000122641.1|4684856_4685477_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001166063.1|4685735_4686719_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4686867_4687542_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4687647_4689021_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4689017_4689716_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4689865_4690366_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_032219397.1|4690551_4691532_-|integrase	tyrosine-type recombinase/integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	8.0e-186
WP_001192857.1|4691601_4691895_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4692047_4692320_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_000217670.1|4692489_4692990_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
4692530:4692542	attR	CAGCTATGCGCCG	NA	NA	NA	NA
WP_000557703.1|4693053_4693278_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277891.1|4693277_4693577_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	100.0	8.4e-46
WP_032217814.1|4693579_4693804_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	98.6	1.5e-34
