The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	449452	482710	5439711	tRNA,protease,head,terminase,capsid,portal,tail,integrase	uncultured_Caudovirales_phage(73.33%)	33	467060:467077	483055:483072
WP_002919147.1|449452_450400_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|450414_450924_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|451052_452177_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|452148_452622_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|452647_453190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|453194_453767_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|453770_454589_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|454585_454843_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|454818_455373_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|461168_461390_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|461683_464794_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|464806_465946_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|466324_466975_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
467060:467077	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|467250_468477_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|468569_469511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|469692_469977_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|469987_470767_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|471218_471488_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|471480_471669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|471661_471976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|471972_472341_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|472337_472703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|472702_474838_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|475180_475516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|475564_476077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|476340_477507_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|477558_478119_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|478120_479362_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|479358_479694_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|479690_479990_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|479989_480433_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_000113647.1|480708_481065_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|481048_482710_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
483055:483072	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	1171818	1257917	5439711	tRNA,coat,lysis,head,terminase,transposase,portal,capsid,tail,plate,integrase	Salmonella_phage(68.63%)	97	1185572:1185591	1235018:1235037
WP_002914765.1|1171818_1174446_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	4.9e-81
WP_000906486.1|1174809_1174995_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_002914359.1|1176516_1176831_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_002914357.1|1176956_1177523_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_002914355.1|1177519_1177948_+	DedA family protein	NA	NA	NA	NA	NA
WP_002914353.1|1178014_1179571_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_002914351.1|1179727_1180243_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_002914345.1|1180295_1181063_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914344.1|1181041_1182718_-	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_002914342.1|1182854_1184393_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_002914339.1|1184408_1185581_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
1185572:1185591	attL	TTGCACTCATGTTATTCTCC	NA	NA	NA	NA
WP_002914337.1|1185706_1186237_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_002914335.1|1186327_1186663_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_002914333.1|1186652_1187399_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_002914330.1|1187576_1188575_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_004151038.1|1188653_1189721_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_002914328.1|1189713_1190916_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.8	1.2e-26
WP_002914327.1|1191272_1192235_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	72.2	1.5e-131
WP_002914325.1|1192245_1194387_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	46.4	2.5e-184
WP_002914321.1|1194359_1194770_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_002914320.1|1194766_1195012_-	glutaredoxin-like protein NrdH	NA	A0A0M7REK7	Lactobacillus_phage	41.1	5.5e-11
WP_004151037.1|1195195_1195627_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004149442.1|1195715_1197068_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002914293.1|1197211_1197559_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_002914291.1|1197708_1198071_+	YgaC family protein	NA	NA	NA	NA	NA
WP_002914289.1|1198156_1198606_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_002914287.1|1199334_1199736_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_002914284.1|1199808_1199988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914281.1|1200193_1201096_+	lipid A hydroxylase LpxO	NA	H8ZJK8	Ostreococcus_tauri_virus	40.2	2.6e-37
WP_002914279.1|1201076_1201622_-	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_002914277.1|1201629_1201929_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914274.1|1202004_1202610_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_004145715.1|1202713_1203622_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151036.1|1203704_1205492_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151035.1|1205755_1207276_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002914266.1|1207977_1208559_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000019473.1|1208773_1209754_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_062955148.1|1209799_1210798_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
WP_004151019.1|1210800_1211430_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1211552_1211795_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1211827_1212337_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1212344_1212545_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1212508_1212847_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1212914_1213148_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1213147_1213375_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1213371_1214223_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1214219_1216604_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004152765.1|1217084_1218569_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151011.1|1218676_1218865_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1218876_1219110_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1219205_1219889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1219875_1220955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1220954_1221956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1222477_1222747_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1222803_1223847_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1223846_1225610_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1225750_1226584_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1226600_1227653_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1227656_1228310_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1228405_1228870_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1228869_1229073_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1229076_1229292_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1229272_1229782_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1229786_1230170_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1230166_1230595_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150997.1|1230690_1231113_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1231105_1231552_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1231574_1232441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1232535_1233108_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1233104_1233467_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1233453_1234362_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1234354_1235026_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1235027_1236977_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
1235018:1235037	attR	GGAGAATAACATGAGTGCAA	NA	NA	NA	NA
WP_004200602.1|1236986_1238105_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1238156_1239230_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1239378_1240551_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1240560_1241076_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1241128_1241428_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1241442_1241562_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150984.1|1241554_1244185_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
WP_004150983.1|1244181_1244667_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1244663_1245758_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1245824_1246043_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1246070_1246448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1247051_1247534_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
WP_004188817.1|1247644_1248121_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1248110_1248401_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1248467_1248809_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1248956_1250618_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1250704_1251583_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1251707_1252298_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1252417_1253704_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1253723_1254515_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1254678_1256043_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1256302_1256551_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1256569_1257118_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1257149_1257917_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	1354924	1415172	5439711	tRNA,protease,transposase,holin,integrase	Salmonella_phage(27.03%)	60	1363628:1363645	1417920:1417937
WP_004149335.1|1354924_1356199_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913890.1|1356233_1356854_+	YfgM family protein	NA	NA	NA	NA	NA
WP_002913889.1|1356864_1358043_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_002913888.1|1358156_1359635_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004151982.1|1359752_1360832_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004144303.1|1360881_1361100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151981.1|1361083_1362475_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|1362633_1364100_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
1363628:1363645	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
WP_004151979.1|1364167_1365745_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_062955102.1|1365936_1367187_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.4	5.8e-205
WP_004197356.1|1367368_1367962_-	MT-A70 family protein	NA	T1SA14	Salmonella_phage	91.9	6.3e-109
WP_062955103.1|1367958_1368621_-	hypothetical protein	NA	A0A059VF56	Pseudomonas_phage	46.6	1.2e-47
WP_048264082.1|1368617_1368776_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.1e-17
WP_009485475.1|1368768_1369062_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_062955104.1|1369171_1369420_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	76.8	4.9e-31
WP_062955105.1|1369468_1370350_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	84.3	8.9e-136
WP_062955106.1|1370346_1371168_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	80.2	1.8e-130
WP_004164029.1|1371164_1371464_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004144290.1|1371830_1372412_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1372566_1372800_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1372946_1373156_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1373155_1373923_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1373919_1374705_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_048328152.1|1374824_1375172_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	6.5e-50
WP_062955107.1|1375364_1375775_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	45.1	4.3e-16
WP_032441402.1|1375758_1375950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441401.1|1375946_1376591_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
WP_072200041.1|1376884_1377352_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	51.7	1.3e-37
WP_029602865.1|1377351_1377645_+	hypothetical protein	NA	Q6UAT9	Klebsiella_phage	86.6	2.7e-44
WP_050491799.1|1377641_1378262_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	40.7	1.0e-29
WP_032441458.1|1378261_1378465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023339258.1|1378457_1378796_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_004152765.1|1378892_1380377_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_062955131.1|1383588_1383852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153233543.1|1383892_1385158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073547080.1|1385139_1386120_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_000608644.1|1386988_1388251_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_077265603.1|1389359_1390676_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K2FI18	Enterobacter_phage	32.3	2.3e-34
WP_062955010.1|1390762_1391167_+	hypothetical protein	NA	T1SA79	Salmonella_phage	81.1	8.7e-54
WP_023339240.1|1391153_1391459_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_062955009.1|1391448_1392078_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
WP_062955008.1|1392074_1392575_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
WP_004152009.1|1392761_1394630_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004162150.1|1394613_1395792_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_002913847.1|1396085_1397318_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913846.1|1397415_1398303_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913843.1|1398399_1398591_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
WP_002913841.1|1398943_1401172_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913839.1|1401225_1402758_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|1402761_1404822_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004152007.1|1405002_1405644_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913836.1|1405640_1406678_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_002913833.1|1406941_1407835_+	beta-glucoside kinase	NA	NA	NA	NA	NA
WP_002913829.1|1407844_1409278_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|1409495_1410122_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|1410217_1411504_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|1411602_1412304_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|1412300_1413212_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_002913810.1|1413339_1413699_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913807.1|1413708_1415172_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
1417920:1417937	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 4
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	1724827	1731733	5439711	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1724827_1725691_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_004899467.1|1725701_1726475_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_002912636.1|1726716_1727610_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1727855_1729217_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1729535_1730258_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_062955084.1|1730254_1731733_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	1772468	1788214	5439711		Enterobacteria_phage(33.33%)	15	NA	NA
WP_062955058.1|1772468_1773875_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
WP_062955056.1|1774098_1775163_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.4e-105
WP_062956182.1|1775176_1776046_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_048996045.1|1776077_1776968_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_004175260.1|1776982_1777537_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_000704907.1|1777716_1778883_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_016947628.1|1779311_1779431_-	small membrane protein	NA	NA	NA	NA	NA
WP_062955151.1|1779831_1780836_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	4.0e-31
WP_073547076.1|1781675_1782740_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_062956182.1|1782753_1783623_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	3.4e-111
WP_048996045.1|1783654_1784545_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	3.7e-28
WP_015958693.1|1784559_1785114_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_015958692.1|1785200_1786031_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_062955124.1|1786059_1786893_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_062955125.1|1786882_1788214_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.1	6.9e-15
>prophage 6
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	1930507	1956930	5439711	head,integrase,tail	Pectobacterium_phage(33.33%)	38	1920933:1920948	1938372:1938387
1920933:1920948	attL	CATCAGATAGTCAAAG	NA	NA	NA	NA
WP_015365913.1|1930507_1931524_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.2	3.7e-125
WP_015365914.1|1931507_1931753_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	41.4	2.8e-07
WP_015365915.1|1931962_1932148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064145722.1|1932149_1932716_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	63.0	3.6e-53
WP_146962167.1|1932712_1934893_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	32.6	1.9e-94
WP_050597398.1|1934937_1935171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094819180.1|1935894_1936350_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	54.3	1.2e-35
WP_000364674.1|1936458_1936692_+	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	44.4	2.9e-09
WP_082236706.1|1936754_1937201_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.0e-26
WP_015365921.1|1937284_1937443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064167418.1|1937460_1938429_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.3	1.6e-37
1938372:1938387	attR	CTTTGACTATCTGATG	NA	NA	NA	NA
WP_094819211.1|1938437_1939832_+	replicative DNA helicase	NA	I6R0N4	Salmonella_phage	47.4	4.9e-104
WP_114499494.1|1939870_1940539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064164989.1|1940542_1940776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157668072.1|1940772_1940943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146962169.1|1940939_1941530_+	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	83.9	1.1e-94
WP_015365928.1|1941532_1941763_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	3.8e-06
WP_094819183.1|1941759_1942377_+	hypothetical protein	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	24.9	2.3e-05
WP_094819212.1|1942404_1942665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094819184.1|1942661_1944623_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	55.9	8.2e-206
WP_094819185.1|1944622_1944961_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	1.5e-46
WP_064408055.1|1945143_1945335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094819186.1|1945403_1945997_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.1	3.2e-81
WP_094819187.1|1945986_1946310_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	52.0	4.0e-25
WP_042945555.1|1946297_1946654_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042945553.1|1946650_1946944_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	7.5e-31
WP_094819188.1|1946976_1947261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094819189.1|1947321_1947552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094819190.1|1947535_1947796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020947865.1|1947802_1948255_+	hypothetical protein	NA	A3EYX3	Salmonella_phage	66.4	1.5e-49
WP_160192557.1|1948339_1949734_+	hypothetical protein	NA	A0A1B1IPE1	uncultured_Mediterranean_phage	41.4	5.3e-66
WP_094819193.1|1949733_1951398_+|head,tail	phage head-tail adapter protein	head,tail	A0A221SAN2	Ralstonia_phage	39.1	1.3e-103
WP_029503969.1|1951400_1951724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094819194.1|1951710_1952469_+	hypothetical protein	NA	M1I7K2	Pelagibacter_phage	24.0	4.8e-05
WP_042945539.1|1952479_1953475_+	phage protein	NA	W6MW28	Pseudomonas_phage	59.9	1.0e-103
WP_042945537.1|1953513_1953987_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	39.2	2.3e-13
WP_042945535.1|1954048_1954654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094819196.1|1954653_1956930_+	hypothetical protein	NA	A0A221SAL7	Ralstonia_phage	27.5	3.8e-69
>prophage 7
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	1966585	1973633	5439711		Klebsiella_phage(50.0%)	9	NA	NA
WP_094819201.1|1966585_1966801_+	hypothetical protein	NA	A5LH82	Enterobacteria_phage	61.0	5.2e-13
WP_094819202.1|1966802_1967342_+	lysozyme	NA	H6WRZ4	Salmonella_phage	79.8	7.0e-83
WP_094819203.1|1967338_1967869_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	47.3	5.0e-33
WP_094819204.1|1967865_1968024_+	DUF1378 family protein	NA	NA	NA	NA	NA
WP_141223324.1|1968106_1970521_+	hypothetical protein	NA	A0A0U3DL17	Klebsiella_phage	45.6	3.6e-110
WP_094819206.1|1970517_1970772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094819207.1|1970808_1971069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146965280.1|1971080_1972910_-	hypothetical protein	NA	A0A0U3C9T3	Klebsiella_phage	47.8	1.6e-158
WP_094819209.1|1973084_1973633_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	90.0	1.6e-87
>prophage 8
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	2819123	2830010	5439711		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2819123_2822231_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2822285_2823551_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2823581_2824670_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2824756_2825017_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2825314_2826175_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2826195_2826957_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2827217_2828120_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2828131_2829397_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2829389_2830010_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 9
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	3058706	3097172	5439711	terminase,integrase	uncultured_Caudovirales_phage(34.04%)	56	3088285:3088299	3094294:3094308
WP_004152576.1|3058706_3059573_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|3059572_3060346_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3060342_3061539_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3061538_3061892_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3061893_3062547_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|3062600_3063167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|3063209_3063392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3063441_3063783_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3063782_3064805_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152568.1|3064807_3065110_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
WP_004152567.1|3065110_3065710_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|3065709_3067713_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3067702_3067855_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3067890_3068316_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3068319_3068760_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3068770_3069916_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3069919_3070360_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3070454_3070841_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3070840_3071347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3071343_3071763_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3071731_3072013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3072052_3072994_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3073005_3073500_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3073503_3074706_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3074757_3075306_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3075361_3076813_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3077050_3078451_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152171.1|3078401_3079154_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
WP_004152170.1|3079255_3079576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3079810_3080200_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3080196_3080727_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3080729_3080978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3081383_3082166_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3082162_3082639_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3082635_3083598_-	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3083599_3085258_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3085834_3086056_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3086153_3086822_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3086992_3087307_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3087299_3087488_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3087657_3088023_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3088015_3088270_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3088241_3088460_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3088285:3088299	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3088456_3088882_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3088878_3089073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3089069_3089897_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3090001_3090520_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3090525_3091236_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3091225_3091450_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3091446_3091659_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_004152149.1|3091655_3092135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152148.1|3092313_3092556_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3092536_3093718_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3093914_3094463_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3094294:3094308	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3094661_3096194_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3096410_3097172_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 10
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	3130105	3158646	5439711	integrase,transposase,holin	Enterobacteria_phage(35.48%)	39	3129887:3129902	3155952:3155967
3129887:3129902	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901815.1|3130105_3130777_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3130963_3131791_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3131866_3133132_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3133133_3133553_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004152765.1|3133632_3135117_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3136014_3136437_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3137029_3137734_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_062955100.1|3137770_3138058_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
WP_004218565.1|3138054_3138594_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_024940884.1|3138590_3138890_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_022644626.1|3139368_3140415_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.3e-05
WP_004232548.1|3140640_3141330_-	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_004218534.1|3141329_3141470_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004218533.1|3141466_3142105_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218532.1|3142097_3142766_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004243010.1|3142762_3142930_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218531.1|3142910_3143378_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004218530.1|3143898_3144927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196831.1|3145134_3145380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218528.1|3145435_3145738_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201118.1|3145734_3146583_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004201117.1|3146579_3147440_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3147525_3147747_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3147787_3148015_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3148126_3148825_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_019405077.1|3148847_3148967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201109.1|3149112_3150189_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3150270_3150474_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004135674.1|3150902_3151097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3151185_3151470_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3151485_3152331_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3152327_3152615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3152616_3153297_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3153293_3153722_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3153718_3154381_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004153574.1|3154588_3155776_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
WP_004151901.1|3155952_3156843_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3155952:3155967	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3156842_3157835_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3157836_3158646_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 11
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	3286318	3375025	5439711	tRNA,lysis,head,terminase,transposase,capsid,portal,tail,integrase	Klebsiella_phage(44.19%)	93	3313121:3313135	3372836:3372850
WP_002901088.1|3286318_3286819_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_002901080.1|3286935_3287382_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901073.1|3287365_3288157_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150777.1|3288258_3289443_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140471.1|3289474_3290167_-	CTP synthase	NA	NA	NA	NA	NA
WP_004150778.1|3290312_3290822_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004150779.1|3290808_3291165_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_004150780.1|3291154_3291394_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004150781.1|3291694_3292708_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
WP_004150782.1|3292765_3292867_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_099119317.1|3292866_3292941_+	protein YoaJ	NA	NA	NA	NA	NA
WP_004140488.1|3293058_3293184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140489.1|3293243_3293507_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004150783.1|3293637_3294276_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004148038.1|3294365_3295280_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150784.1|3295941_3296985_-	type II asparaginase	NA	NA	NA	NA	NA
WP_004150785.1|3297287_3298496_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004150787.1|3298569_3300354_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004150788.1|3300360_3301251_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004140497.1|3301371_3302880_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150790.1|3303190_3303877_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_153233540.1|3304326_3304515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|3304493_3305126_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140506.1|3305692_3305890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004140509.1|3306005_3307016_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004150793.1|3307012_3308419_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140512.1|3308474_3309362_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140514.1|3309378_3309885_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150794.1|3309911_3310406_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004150795.1|3310496_3310682_-	general stress protein	NA	NA	NA	NA	NA
WP_004140529.1|3311303_3312497_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004140530.1|3312609_3312837_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3313121:3313135	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
WP_004150797.1|3313273_3313597_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004150798.1|3313589_3313982_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_004150799.1|3313978_3314692_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004892953.1|3314964_3315117_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_023328083.1|3315271_3316768_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
WP_062955111.1|3316836_3329541_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_023328085.1|3329603_3330197_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
WP_047666390.1|3330223_3330646_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
WP_047666389.1|3330687_3331398_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
WP_023328087.1|3331399_3332155_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
WP_023328088.1|3332151_3332490_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
WP_023328089.1|3332489_3335825_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
WP_014228914.1|3336057_3336423_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_023328090.1|3336480_3336942_-	hypothetical protein	NA	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_023328091.1|3336973_3337375_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
WP_017880258.1|3337371_3337761_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_023328092.1|3337741_3338080_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
WP_020317538.1|3338076_3338394_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_049010370.1|3338374_3338635_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
WP_023328094.1|3338693_3339980_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
WP_014907815.1|3340057_3340978_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_023279520.1|3341014_3342274_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
WP_017898992.1|3342273_3342453_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3342446_3344168_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3344167_3344602_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014907818.1|3344850_3345282_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_023297386.1|3345278_3345602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3345553_3345916_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_032749552.1|3346242_3346467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049115059.1|3346505_3346943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016160650.1|3347892_3348243_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_032432826.1|3348239_3348737_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
WP_016160648.1|3348736_3348952_-|lysis	phage S lysis protein	lysis	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_004147999.1|3349869_3350019_+	small membrane protein	NA	NA	NA	NA	NA
WP_004147997.1|3350756_3350960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025861432.1|3351203_3351806_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
WP_062955112.1|3351822_3352854_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
WP_025861428.1|3353053_3353446_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
WP_077255782.1|3353486_3353777_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
WP_025368263.1|3353788_3354022_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
WP_004152765.1|3354100_3355585_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_062954975.1|3356425_3357787_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_062954976.1|3357960_3358674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062954989.1|3359025_3359895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062954977.1|3359983_3361375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032443841.1|3361723_3362164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047667474.1|3362177_3362642_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
WP_077265602.1|3362634_3363639_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
WP_046622349.1|3363698_3364253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071561166.1|3364255_3364480_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
WP_077257742.1|3364568_3365006_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
WP_040234937.1|3365327_3365642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023279538.1|3366032_3366227_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_014228879.1|3366269_3366614_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|3367632_3368337_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012542206.1|3369774_3370020_+	excisionase	NA	NA	NA	NA	NA
WP_032418030.1|3370000_3371128_+|integrase	tyrosine-type recombinase/integrase	integrase	O21925	Phage_21	58.4	4.4e-119
WP_004150800.1|3371245_3372496_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004150801.1|3372736_3373387_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3372836:3372850	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
WP_004150802.1|3373403_3373862_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150803.1|3373918_3375025_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 12
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	3591368	3686103	5439711	tRNA,protease,lysis,head,terminase,transposase,plate,tail,capsid,portal,integrase	Salmonella_phage(55.93%)	93	3647478:3647496	3686178:3686196
WP_002898139.1|3591368_3592661_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3592751_3594095_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3594103_3594715_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3594837_3599091_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3599226_3599721_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004141839.1|3600226_3601222_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
WP_002898017.1|3601336_3603103_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3603103_3604825_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3604869_3605571_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3605924_3606143_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3606263_3608543_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3608573_3608891_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3609216_3609438_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896440.1|3611438_3612554_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3612700_3614359_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3614778_3615474_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3615589_3616489_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3616632_3618285_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3618295_3619264_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3619475_3619910_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3620061_3621780_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3621818_3622820_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3622830_3624273_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3624360_3625374_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3625370_3626201_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3626232_3627372_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|3628718_3629423_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032419144.1|3629588_3630317_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3630337_3631069_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3631075_3631792_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3631791_3632460_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3632643_3633375_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3633417_3634890_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3634886_3635603_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3635681_3636809_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3636850_3637339_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3637396_3638242_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3638238_3639192_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3639202_3640336_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3640499_3641612_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3641960_3642440_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3642528_3643431_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3644252_3644540_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3644742_3645006_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3645012_3645396_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3645662_3647348_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3647478:3647496	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3647567_3647786_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3647877_3648978_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3648974_3649460_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3649456_3652084_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3652076_3652196_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3652210_3652510_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3652562_3653078_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3653087_3654260_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3654398_3655475_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3655504_3655708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3655704_3656436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3656439_3659391_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3659392_3659992_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3659984_3660893_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_032441567.1|3660879_3661242_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
WP_002896177.1|3661238_3661811_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_000019473.1|3662035_3663016_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_048255583.1|3663129_3663798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3663794_3664241_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3664233_3664665_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896168.1|3664760_3665189_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3665185_3665569_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3665573_3666083_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3666063_3666279_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3666282_3666486_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3666485_3666950_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3667045_3667696_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3667699_3668758_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3668774_3669608_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3669750_3671517_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3671516_3672542_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3672603_3674346_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3674621_3675299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3675413_3675647_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3675657_3675846_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3675999_3678414_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3678410_3679268_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3679264_3679492_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3679491_3679725_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3679792_3680134_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3680097_3680298_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3680305_3680815_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3680847_3681069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087530321.1|3681214_3682093_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.4	6.6e-30
WP_004150866.1|3682104_3683049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152765.1|3683147_3684632_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151720.1|3685050_3686103_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3686178:3686196	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 13
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	4329897	4341550	5439711	integrase	Enterobacteria_phage(70.0%)	13	4330347:4330361	4353403:4353417
WP_004144574.1|4329897_4331001_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4330347:4330361	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4331011_4332265_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4332617_4333808_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4333795_4334746_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4334745_4335171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152202.1|4335738_4336305_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|4336322_4336568_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_062956184.1|4336564_4337302_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
WP_002889915.1|4337843_4338110_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4338106_4338664_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4338660_4338888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4338884_4339205_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4339216_4341550_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4353403:4353417	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 14
NZ_CP047649	Klebsiella pneumoniae strain 158590 chromosome, complete genome	5439711	4810997	4819810	5439711	transposase	Enterobacteria_phage(83.33%)	9	NA	NA
WP_004152207.1|4810997_4813331_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4813345_4813666_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4813662_4813890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4813886_4814435_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152204.1|4815258_4815996_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4815992_4816238_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4816255_4816822_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152201.1|4817562_4818642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019445.1|4818829_4819810_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
