The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047669	Klebsiella aerogenes strain HNHF1 chromosome, complete genome	5253477	65017	72640	5253477		Erwinia_phage(33.33%)	8	NA	NA
WP_052766688.1|65017_65350_-	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	40.0	2.4e-09
WP_047058586.1|65621_66248_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_015704508.1|66559_66886_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_015704509.1|66879_67344_-	membrane protein	NA	A0A218M4J4	Erwinia_phage	33.3	4.9e-08
WP_015368076.1|68300_69554_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.6	2.5e-91
WP_015368077.1|69564_70668_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.7	9.7e-63
WP_015368078.1|70957_72010_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.0	5.1e-114
WP_026612390.1|72073_72640_-	hypothetical protein	NA	S5MM68	Bacillus_phage	38.9	2.2e-10
>prophage 2
NZ_CP047669	Klebsiella aerogenes strain HNHF1 chromosome, complete genome	5253477	2139074	2183133	5253477	lysis,integrase,terminase,tail	Enterobacteria_phage(22.22%)	62	2128136:2128160	2183164:2183188
2128136:2128160	attL	TGCGCCCAGTCTGGTTTGTTTAAAA	NA	NA	NA	NA
WP_160184385.1|2139074_2141621_-	kinase	NA	A0A286S259	Klebsiella_phage	70.7	0.0e+00
WP_160184106.1|2142106_2142487_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.4e-58
WP_045419358.1|2142496_2142979_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	73.8	7.9e-62
WP_032712199.1|2142965_2143439_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.1	3.1e-58
WP_160184386.1|2143438_2146330_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.1	2.7e-96
WP_032712205.1|2146953_2147286_-	lipoprotein	NA	M1PRT9	Cellulophaga_phage	66.7	2.9e-31
WP_123273243.1|2147352_2147550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100279723.1|2147687_2148170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160184107.1|2148224_2149397_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.9	6.5e-25
WP_160184108.1|2149420_2149813_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_160184109.1|2149809_2150361_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.8	3.9e-28
WP_160184110.1|2150362_2150746_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	9.2e-21
WP_160184111.1|2150747_2151143_-	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	5.6e-13
WP_151391665.1|2151183_2151456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042896375.1|2151464_2152418_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	73.7	9.4e-131
WP_160184112.1|2152428_2153217_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	64.8	7.6e-70
WP_142689032.1|2153301_2154414_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.4	8.1e-110
WP_160184113.1|2154397_2155798_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.0	1.6e-126
WP_032712234.1|2155797_2157105_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	6.1e-149
WP_058674190.1|2157082_2158075_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	34.5	1.4e-28
WP_126003066.1|2158539_2158722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047041390.1|2159206_2159491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160184114.1|2159866_2160394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160184115.1|2160884_2161262_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	38.6	1.7e-14
WP_160184116.1|2161249_2161753_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	91.5	1.8e-85
WP_045412035.1|2161730_2161955_-|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	90.5	6.8e-32
WP_160184387.1|2162314_2163004_-	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	3.7e-60
WP_004884232.1|2163003_2163144_-	YlcG family protein	NA	NA	NA	NA	NA
WP_160184117.1|2163140_2163785_-	hypothetical protein	NA	S4TSR3	Salmonella_phage	66.4	3.9e-72
WP_160184118.1|2163777_2163948_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	79.6	2.0e-15
WP_160184119.1|2163947_2164403_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.7	7.8e-59
WP_160184120.1|2164579_2164813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160184121.1|2164821_2165076_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.3	6.7e-28
WP_160184122.1|2165089_2165371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160184388.1|2165496_2166312_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	41.2	5.3e-42
WP_154059060.1|2166494_2166875_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.4	6.7e-64
WP_160184123.1|2166874_2167237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160184389.1|2168565_2169123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045412061.1|2169239_2169542_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_047075678.1|2169541_2170132_-	hypothetical protein	NA	I3PUZ9	Vibrio_phage	40.0	5.4e-36
WP_160184124.1|2170131_2171061_-	replication protein	NA	K7PGT1	Enterobacteria_phage	77.3	5.5e-51
WP_160184125.1|2171146_2171689_-	regulator	NA	M9NZI6	Enterobacteria_phage	86.1	1.7e-81
WP_015705720.1|2171783_2172014_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.9	4.5e-23
WP_160184126.1|2172118_2172814_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	66.5	2.6e-82
WP_160184127.1|2172862_2172982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160184128.1|2173239_2173587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160184129.1|2174349_2174544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063407113.1|2174542_2174749_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	75.0	1.6e-24
WP_160184130.1|2174819_2175791_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.4	1.1e-38
WP_160184131.1|2175798_2176083_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	86.2	2.2e-43
WP_160184132.1|2176101_2176947_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	60.3	1.4e-69
WP_160184133.1|2176943_2177624_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	92.5	2.7e-124
WP_160184134.1|2177620_2178049_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	1.9e-62
WP_160184135.1|2178045_2178702_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	85.6	3.0e-112
WP_160184136.1|2178698_2179877_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	68.9	2.0e-151
WP_160184137.1|2179873_2180092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160184138.1|2180088_2180625_+	hypothetical protein	NA	J9Q748	Salmonella_phage	74.3	7.2e-72
WP_160184139.1|2180621_2180813_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	62.7	2.7e-13
WP_160184140.1|2180904_2181123_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	9.2e-18
WP_160184141.1|2181125_2181467_+	hypothetical protein	NA	I3PV00	Vibrio_phage	52.9	3.3e-22
WP_015705920.1|2181572_2181821_+	excisionase family protein	NA	S4TND0	Salmonella_phage	53.1	1.8e-17
WP_160184142.1|2181852_2183133_+|integrase	site-specific integrase	integrase	A0A0P0ZGT7	Escherichia_phage	58.8	3.8e-143
2183164:2183188	attR	TGCGCCCAGTCTGGTTTGTTTAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP047669	Klebsiella aerogenes strain HNHF1 chromosome, complete genome	5253477	2368274	2377595	5253477		Enterobacteria_phage(50.0%)	10	NA	NA
WP_015706036.1|2368274_2369144_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	7.5e-111
WP_015706037.1|2369158_2370223_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.9	1.2e-102
WP_015706038.1|2371012_2371120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015706039.1|2371116_2372121_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	3.4e-30
WP_141108162.1|2372458_2372578_+	small membrane protein	NA	NA	NA	NA	NA
WP_015706040.1|2372817_2373984_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.7	2.4e-112
WP_015706041.1|2374158_2374713_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	2.3e-52
WP_015706042.1|2374724_2375615_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.1	4.0e-27
WP_015706043.1|2375646_2376516_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	1.3e-110
WP_015706044.1|2376530_2377595_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.9	5.4e-103
>prophage 4
NZ_CP047669	Klebsiella aerogenes strain HNHF1 chromosome, complete genome	5253477	4549331	4598471	5253477	transposase,integrase	Bacillus_phage(28.57%)	45	4543796:4543811	4583385:4583400
4543796:4543811	attL	TGGTGGAGCAGTACGG	NA	NA	NA	NA
WP_006786007.1|4549331_4550231_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_020899211.1|4550299_4550917_-	recombinase family protein	NA	NA	NA	NA	NA
WP_087464944.1|4551321_4552468_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	91.9	4.3e-146
WP_006785878.1|4552532_4553165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006785879.1|4553331_4553682_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	52.4	1.0e-18
WP_006785880.1|4553830_4554262_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555738.1|4554511_4555987_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	29.3	1.9e-26
WP_000697968.1|4555979_4556660_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475503.1|4556849_4558235_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|4558263_4558617_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_001485328.1|4558730_4560023_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574021.1|4560033_4563180_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_002436620.1|4563266_4563707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129244003.1|4563804_4566276_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.1	2.2e-83
WP_000843497.1|4566316_4566514_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|4566547_4567285_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A8ATH6	Listeria_phage	41.0	3.6e-13
WP_001023257.1|4567573_4568023_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|4568256_4570074_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_020899208.1|4570073_4570970_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|4571009_4571390_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_160184311.1|4571394_4572324_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|4572378_4573059_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_006785898.1|4573055_4574456_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_004388336.1|4574671_4575106_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_001351729.1|4578081_4578474_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|4578611_4579496_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|4579527_4580727_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|4580832_4581483_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001143775.1|4581547_4584553_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
4583385:4583400	attR	CCGTACTGCTCCACCA	NA	NA	NA	NA
WP_001217881.1|4584714_4585272_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000027057.1|4585454_4586315_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001043260.1|4586476_4587292_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4587352_4588156_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4588155_4588992_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|4589297_4589540_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|4589571_4590222_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|4590327_4591527_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|4591793_4592099_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|4592126_4593341_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001447541.1|4593557_4594442_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|4594472_4595966_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|4596176_4596401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|4596397_4597135_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|4597620_4597761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4597766_4598471_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP047668	Klebsiella aerogenes strain HNHF1 plasmid pHNHF1_NDM-9, complete sequence	234522	154288	206627	234522	integrase,transposase	Salmonella_phage(17.65%)	56	165779:165794	209355:209370
WP_087522250.1|154288_155657_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
WP_000783758.1|155756_155915_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001015182.1|156333_156537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743060.1|156582_156933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031421.1|156992_157592_-	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	42.6	1.7e-08
WP_000778030.1|157691_158636_-	DUF5417 domain-containing protein	NA	NA	NA	NA	NA
WP_001272970.1|159737_160922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000710431.1|160987_161269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000893963.1|161525_161732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744346.1|161852_162149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000286107.1|162193_162631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000800252.1|162698_163235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000537761.1|163399_163768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000442694.1|164200_164503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032029.1|164859_165144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210769.1|165209_165563_+	hypothetical protein	NA	NA	NA	NA	NA
165779:165794	attL	AAGAAAAAGCCCCAAC	NA	NA	NA	NA
WP_000422741.1|165998_166424_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_072647959.1|166420_166771_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	2.8e-40
WP_000080195.1|166801_168415_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_072647958.1|168401_169121_-	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000952983.1|169122_170304_-	S49 family peptidase	NA	B8QTU8	Erwinia_phage	29.2	3.4e-13
WP_000718549.1|170314_170977_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_046788496.1|170963_172073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046788497.1|172072_174157_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001011151.1|174156_177303_-	helicase	NA	NA	NA	NA	NA
WP_000128631.1|177312_178050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071885.1|178046_178532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004209.1|179290_180091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140953.1|180092_180605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196728.1|181198_182245_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001257292.1|182234_183650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072647581.1|183658_187612_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_001284752.1|187792_189082_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
WP_024136329.1|189189_189756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000494967.1|189838_190378_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000720274.1|190525_191275_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_000843244.1|191299_191692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025803.1|191725_192148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000620990.1|192207_192819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031377.1|192925_193735_+	DsbA family protein	NA	NA	NA	NA	NA
WP_042634445.1|193780_195040_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
WP_000111290.1|195023_195458_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
WP_001130842.1|195651_196269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770127.1|196418_196775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152919720.1|197025_197196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|197232_197937_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000434930.1|198431_199058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|199562_200438_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_001067855.1|200675_201380_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_049824851.1|201389_201860_+	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_014839978.1|201879_202668_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_014839979.1|202667_203186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839980.1|203190_203607_-	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_001067855.1|203992_204697_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845054.1|204971_205985_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_001083725.1|206129_206627_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
209355:209370	attR	AAGAAAAAGCCCCAAC	NA	NA	NA	NA
