The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047665	Escherichia coli strain LD26-1 chromosome, complete genome	4774827	85174	155370	4774827	portal,tail,lysis,integrase,protease,head,plate,terminase,capsid	Salmonella_phage(68.0%)	81	83448:83462	137104:137118
83448:83462	attL	AATGCCTTTTTCGCC	NA	NA	NA	NA
WP_064485156.1|85174_86206_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	3.3e-105
WP_000584504.1|86286_86808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105906349.1|86809_88012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160183900.1|88092_88974_-	chromosome partitioning protein ParB	NA	A0A1S6KZZ7	Salmonella_phage	45.3	1.1e-40
WP_000035244.1|89099_89321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064485159.1|89353_89863_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000956192.1|89870_90167_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_094314085.1|90284_90626_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_001415207.1|90693_90927_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	5.4e-32
WP_021578435.1|90926_91154_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.0e-35
WP_105906347.1|91150_92008_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	2.8e-158
WP_160183901.1|92004_94419_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.9	0.0e+00
WP_001154431.1|94572_94761_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217575.1|94771_95005_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_100207729.1|95605_96508_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_126719504.1|96767_97910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520389.1|97979_99008_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.4	3.4e-171
WP_001098422.1|99007_100774_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216237.1|100916_101750_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_063104903.1|101766_102825_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.7	9.9e-182
WP_000059191.1|102828_103479_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000673530.1|103574_104039_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000868175.1|104038_104242_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|104245_104461_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|104480_104954_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000727850.1|104955_105333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080916.1|105329_105758_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	3.8e-47
WP_001039949.1|105853_106285_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.7e-71
WP_000829157.1|106277_106724_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_000993752.1|106792_107371_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	8.8e-92
WP_000177597.1|107367_107727_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000268280.1|107713_108622_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_001086824.1|108614_109220_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_160183902.1|109216_110626_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.7	6.8e-154
WP_000376436.1|110629_111049_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.8	1.7e-36
WP_033813583.1|111020_111623_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	85.4	3.2e-92
WP_160183903.1|111622_112174_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.1	6.7e-57
WP_032162477.1|112201_112768_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	1.1e-86
WP_032162475.1|112910_114083_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	3.5e-204
WP_001207660.1|114092_114608_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|114662_114965_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|114979_115099_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282787.1|115091_118169_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980416.1|118165_118651_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	8.3e-67
WP_032162474.1|118647_119748_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	3.2e-175
WP_000972391.1|119838_120057_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024867.1|120292_121978_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|122247_122625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|122654_122912_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201554.1|123071_123359_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189178.1|123342_124065_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684311.1|124125_125028_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|125115_125592_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|125943_127056_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996025.1|127150_128284_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000105430.1|128293_129247_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|129243_130089_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|130148_130637_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149733.1|130677_131805_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|131979_132711_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|133002_133671_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|133670_134387_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|134393_135125_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|135142_135871_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|136088_136604_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|136729_137053_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_089078699.1|137049_137880_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
137104:137118	attR	GGCGAAAAAGGCATT	NA	NA	NA	NA
WP_001338420.1|137876_138890_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|138988_140419_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|140429_141431_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815350.1|141467_143186_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000178677.1|143318_144287_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|144298_145951_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|146094_146994_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001297311.1|147488_148184_-	aquaporin Z	NA	NA	NA	NA	NA
WP_089618368.1|148609_150268_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|150264_151221_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|151371_152487_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188176.1|152483_154430_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|154502_154727_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|155049_155370_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 2
NZ_CP047665	Escherichia coli strain LD26-1 chromosome, complete genome	4774827	607991	728233	4774827	tail,lysis,transposase,integrase,tRNA,terminase	Escherichia_phage(42.59%)	112	602375:602391	645853:645869
602375:602391	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_032219717.1|607991_609224_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
WP_000387388.1|609478_610462_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|610939_612313_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001153728.1|612441_613377_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000040852.1|613428_614664_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|614665_614881_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|614959_615169_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|615161_615356_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|615412_616222_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001532611.1|616214_618815_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000632297.1|618916_619192_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|619266_619437_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|619436_619658_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|620099_620588_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|620584_620740_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233320.1|621171_621591_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|621670_621925_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693853.1|621921_622347_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262393.1|622418_623489_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151151.1|623529_623952_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|624292_626290_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_000625667.1|626353_627631_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019009.1|627761_628643_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957774.1|628639_629332_-	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_001117227.1|629343_630543_-	MFS transporter	NA	NA	NA	NA	NA
WP_000149055.1|631266_631605_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940319.1|632418_633018_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247763.1|633017_633308_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640162.1|633304_633847_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	4.9e-76
WP_000506936.1|634889_635318_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|635489_635864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|636115_636331_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|636330_636828_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228688.1|637044_637230_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|637426_638884_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291092.1|639021_639816_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	7.5e-49
WP_001204033.1|639808_640741_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_000126788.1|640718_640928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089446.1|640931_642026_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
WP_000625347.1|642006_643308_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
WP_000763708.1|643310_644717_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
WP_001317036.1|644700_645813_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_000770036.1|645917_646682_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	6.6e-87
645853:645869	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_000918490.1|646780_647920_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	74.7	1.7e-158
WP_000634214.1|648142_648538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|648537_648921_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|648921_649302_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|649298_649691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|649717_650680_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|650830_651190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000840620.1|651663_654897_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.7	1.3e-112
WP_000024051.1|654889_655228_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|655227_655926_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_001349612.1|655931_656675_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	8.9e-145
WP_000090943.1|656611_657214_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_032202219.1|657274_660754_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_001233133.1|660821_661421_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.0	1.6e-107
WP_089078768.1|661485_664713_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_001351719.1|664712_665288_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_000078178.1|665385_665976_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|666292_666526_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|666594_666708_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157925.1|667047_667221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082294.1|667485_667920_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|668060_669194_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_000628159.1|669559_673084_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|673357_673624_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001299385.1|673620_674043_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|674153_675143_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_000900909.1|675350_677990_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698141.1|677986_678172_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001296730.1|678179_678506_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067519.1|678677_679583_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138608.1|679818_681318_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000535440.1|681375_683649_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186504.1|683896_685942_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191073.1|686226_687156_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|687167_687455_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|687463_688210_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189197.1|688224_688722_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206364.1|688729_689800_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292341.1|689796_690564_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969780.1|690563_691352_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973371.1|691353_692781_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|692770_693193_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206190.1|693192_694398_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632286.1|694424_695738_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039886.1|695838_696789_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123454.1|696770_697361_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000097801.1|697591_698452_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_000177536.1|700991_701597_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000890935.1|701596_702493_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000627376.1|704254_705571_+	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000048948.1|705621_706227_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000139614.1|706427_710330_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_001027931.1|710601_711402_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115957.1|711598_713038_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000048667.1|713079_714081_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001307188.1|714269_714800_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|715044_715218_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001320773.1|715289_715439_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_001098551.1|715837_717478_+	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_000414564.1|717515_718439_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000013786.1|718655_719999_+	VOC family protein	NA	NA	NA	NA	NA
WP_000375956.1|720223_721879_+	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_001296778.1|722018_722243_+	YdcH family protein	NA	NA	NA	NA	NA
WP_000140877.1|722305_722842_+	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001234054.1|722836_723817_-	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001296725.1|723940_724933_+	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_000586733.1|724929_725523_+	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001261013.1|725825_726494_+	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_001373192.1|727024_728233_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	2.9e-209
>prophage 3
NZ_CP047665	Escherichia coli strain LD26-1 chromosome, complete genome	4774827	1342151	1349689	4774827		Escherichia_phage(28.57%)	7	NA	NA
WP_001471776.1|1342151_1342712_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	4.6e-53
WP_001471777.1|1342716_1343595_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
WP_001374048.1|1343652_1344552_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	2.0e-29
WP_001374049.1|1344551_1345637_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_001374047.1|1346005_1346899_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	5.1e-46
WP_001471778.1|1347141_1348137_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	8.6e-10
WP_001374058.1|1348294_1349689_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.6	6.3e-19
>prophage 4
NZ_CP047665	Escherichia coli strain LD26-1 chromosome, complete genome	4774827	1441283	1450725	4774827		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|1441283_1442420_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|1442416_1444417_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|1444541_1445003_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1445043_1445514_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1445560_1446280_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1446276_1447962_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1448183_1448915_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1448974_1449082_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1449062_1449794_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|1449798_1450725_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
>prophage 5
NZ_CP047665	Escherichia coli strain LD26-1 chromosome, complete genome	4774827	2042486	2049626	4774827		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2042486_2045048_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|2045153_2045810_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|2045860_2046628_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2046823_2047732_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2047728_2048991_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2048987_2049626_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
NZ_CP047665	Escherichia coli strain LD26-1 chromosome, complete genome	4774827	4089464	4151656	4774827	tRNA,transposase,plate,protease	Emiliania_huxleyi_virus(12.5%)	51	NA	NA
WP_001295561.1|4089464_4090817_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|4090846_4093279_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|4093400_4093886_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|4093889_4094915_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4095019_4095475_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|4095478_4096267_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|4096266_4097415_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|4097411_4098008_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|4098044_4101527_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|4101539_4102499_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|4102597_4104739_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|4104795_4105185_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|4105249_4106548_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|4106596_4106857_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|4106843_4107044_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|4107209_4107755_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|4107751_4108174_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|4108187_4108898_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_160183917.1|4109147_4110128_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001260712.1|4111208_4112927_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|4113038_4113746_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202335.1|4113742_4114147_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|4114264_4115080_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|4115119_4115773_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|4115765_4116797_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140174.1|4116984_4117557_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|4123318_4124122_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648606.1|4124118_4125033_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4125273_4126074_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211690.1|4126151_4126922_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4126969_4128328_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|4128399_4129155_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|4129188_4129911_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4129907_4130375_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|4130439_4131171_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|4131710_4132496_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|4132632_4133112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908058.1|4133121_4134036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089078728.1|4134079_4134562_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087751.1|4134585_4135938_-	membrane protein	NA	NA	NA	NA	NA
WP_122985420.1|4135948_4139383_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240532.1|4139491_4140904_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088859.1|4140908_4141652_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614334.1|4141648_4144408_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_000343293.1|4144416_4145178_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246416.1|4145182_4146514_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|4146516_4147041_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_089078729.1|4147037_4148318_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|4148342_4149425_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|4149388_4151239_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|4151242_4151656_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 7
NZ_CP047665	Escherichia coli strain LD26-1 chromosome, complete genome	4774827	4182489	4266340	4774827	portal,lysis,tail,integrase,transposase,protease,head,plate,terminase,holin,capsid	Shigella_phage(49.18%)	93	4186084:4186098	4266202:4266216
WP_000749882.1|4182489_4183545_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
WP_001285288.1|4183832_4184936_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|4184947_4186201_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
4186084:4186098	attL	TCTGGGTGCGGAAGT	NA	NA	NA	NA
WP_000051887.1|4186405_4187569_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000433939.1|4187445_4187796_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000206732.1|4187795_4188101_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|4188100_4188463_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008236.1|4188453_4188990_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_000016389.1|4189534_4189969_+	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000549623.1|4189940_4190147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160183918.1|4190381_4191056_-	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	4.6e-132
WP_000649477.1|4191146_4191347_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515830.1|4191390_4191942_+	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_023148278.1|4192117_4192297_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	3.9e-14
WP_000104967.1|4192286_4193228_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_160183919.1|4193224_4193719_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	5.6e-87
WP_021543207.1|4193718_4194372_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_001721080.1|4194368_4194695_+	lexA DNA-binding domain protein	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	4.5e-53
WP_000767124.1|4194691_4195081_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	100.0	7.1e-69
WP_001061381.1|4195100_4195910_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	1.6e-152
WP_001360050.1|4195917_4196907_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_085949407.1|4196921_4197290_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_001208502.1|4197325_4197775_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_001446998.1|4197796_4198738_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_001120496.1|4199034_4199361_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001407088.1|4199364_4199847_+	glycoside hydrolase family protein	NA	U5P0A9	Shigella_phage	92.4	2.1e-83
WP_023566046.1|4199839_4200304_+|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	66.4	8.5e-45
WP_001407090.1|4200385_4201144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001407091.1|4201214_4201565_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.8	2.0e-62
WP_000929181.1|4201690_4202185_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_160183923.1|4202418_4203915_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	1.3e-299
WP_032257813.1|4203926_4204109_+	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	98.3	2.9e-25
WP_000466255.1|4204108_4205350_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193632.1|4205327_4205978_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_000257507.1|4205992_4207198_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_000601360.1|4207247_4207448_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927719.1|4207450_4207774_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702388.1|4207770_4208181_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000213502.1|4208155_4208662_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_112919927.1|4208658_4209219_+	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_032225398.1|4209227_4209398_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	3.5e-25
WP_096962341.1|4209381_4210878_+|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_000090998.1|4210877_4211234_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661047.1|4211233_4211503_+|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000807197.1|4211644_4213480_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000219910.1|4213540_4214869_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000999511.1|4214865_4215945_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_112919928.1|4215944_4216493_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.3	1.1e-94
WP_000424732.1|4216492_4216918_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001583215.1|4216904_4217963_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	5.6e-201
WP_001583217.1|4217953_4218538_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_089647603.1|4218541_4219342_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.0	5.7e-57
WP_112919930.1|4219341_4219950_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.6	1.1e-92
WP_010376608.1|4219915_4220263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904983.1|4220794_4221349_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	2.8e-87
WP_000355484.1|4221406_4222180_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_160183920.1|4222583_4224017_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.3	3.2e-106
WP_012602456.1|4224051_4225266_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_001111353.1|4226083_4226494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121354.1|4226472_4227429_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|4227438_4229637_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|4229633_4230590_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000070694.1|4230586_4231276_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|4231693_4232308_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|4232555_4232885_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001305432.1|4233197_4233908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001315269.1|4233876_4235520_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131079.1|4235509_4238035_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|4238060_4238729_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730974.1|4238786_4239374_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001296902.1|4239448_4239991_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147277.1|4240813_4241041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|4241075_4241216_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803999.1|4241215_4241479_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|4241841_4241943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092603.1|4243058_4247312_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001315271.1|4247433_4248291_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001709928.1|4248539_4249409_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	2.1e-52
WP_001299021.1|4249568_4250162_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|4250173_4250410_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046293.1|4250518_4251844_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000339593.1|4252069_4252924_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001102101.1|4253452_4254172_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023914.1|4254182_4255610_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001315273.1|4255602_4256298_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209088.1|4256543_4257209_-	membrane protein	NA	NA	NA	NA	NA
WP_071593451.1|4257392_4258586_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001406334.1|4259731_4260493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160183921.1|4260646_4261057_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085947772.1|4261105_4262318_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_160183922.1|4262288_4262702_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001295805.1|4263031_4263595_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001159102.1|4264669_4266340_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
4266202:4266216	attR	TCTGGGTGCGGAAGT	NA	NA	NA	NA
>prophage 8
NZ_CP047665	Escherichia coli strain LD26-1 chromosome, complete genome	4774827	4731149	4774311	4774827	tail,lysis,portal,integrase,protease,head,terminase,capsid	Enterobacteria_phage(54.24%)	61	4729519:4729534	4753548:4753563
4729519:4729534	attL	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000533642.1|4731149_4732220_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
WP_001303849.1|4732197_4732416_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|4732455_4732623_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001348592.1|4732865_4733468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|4733678_4733900_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001386642.1|4733998_4734280_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000548531.1|4734290_4734482_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_072126246.1|4734454_4734637_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_000186835.1|4734633_4735314_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	99.1	4.6e-132
WP_089078684.1|4735310_4736096_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	98.9	1.5e-147
WP_000995439.1|4736101_4736398_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000358700.1|4736472_4736616_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_001198858.1|4736608_4736749_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000065373.1|4736821_4737190_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_000213975.1|4737372_4737573_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|4737839_4738322_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_089078685.1|4738322_4738778_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	96.1	4.0e-63
WP_021526961.1|4738995_4739400_-	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	99.3	1.9e-69
WP_000028393.1|4739396_4740029_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	100.0	5.4e-119
WP_001194218.1|4740132_4740348_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|4740467_4740761_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_052976200.1|4740793_4741693_+	replication protein	NA	K7P7F0	Enterobacteria_phage	98.3	1.1e-170
WP_000788910.1|4741689_4742391_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145931.1|4742387_4742678_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736903.1|4742751_4743192_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|4743188_4743716_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254223.1|4743712_4743889_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|4743891_4744233_+	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_000950954.1|4744225_4744420_+	protein ninF	NA	NA	NA	NA	NA
WP_001099712.1|4744439_4744802_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_001309323.1|4746163_4746253_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	80.8	8.0e-05
WP_001204791.1|4746338_4746722_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737280.1|4746911_4748009_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_000839596.1|4748592_4748808_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_089078763.1|4748807_4749305_+	lysozyme	NA	A0A291AWW2	Escherichia_phage	97.6	3.5e-89
WP_001228702.1|4749521_4749728_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|4749756_4749909_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|4750260_4750671_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001309326.1|4750728_4750962_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_063625344.1|4751350_4751896_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	8.1e-95
WP_001597877.1|4751870_4753796_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
4753548:4753563	attR	CTGACTGCTGAAGAGC	NA	NA	NA	NA
WP_000198149.1|4753792_4753999_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_047629415.1|4753995_4755597_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.1e-309
WP_047629419.1|4755577_4756897_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	2.4e-233
WP_001358225.1|4756906_4757239_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063254.1|4757294_4758320_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_023566743.1|4758361_4758757_+	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	95.5	7.4e-58
WP_000752996.1|4758768_4759122_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_000975086.1|4759133_4759712_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000683143.1|4759708_4760104_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001439072.1|4760111_4760852_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000479139.1|4760867_4761290_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_000459480.1|4761271_4761706_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_032292244.1|4761698_4764278_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.1	0.0e+00
WP_000847345.1|4764274_4764604_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001512626.1|4764603_4765302_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.1e-133
WP_000194783.1|4765307_4766051_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090895.1|4765987_4766620_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_089078764.1|4766680_4770178_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.5	0.0e+00
WP_001233090.1|4770248_4770848_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_024203579.1|4770912_4774311_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
>prophage 1
NZ_CP047667	Escherichia coli strain LD26-1 plasmid pLD26-1-135kb, complete sequence	135123	28335	71864	135123	integrase,transposase,protease	Macacine_betaherpesvirus(23.08%)	49	48792:48807	82375:82390
WP_085948178.1|28335_29549_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_160183924.1|29574_29730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000277845.1|29759_30221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830839.1|30246_31239_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_001203745.1|31235_31868_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000214084.1|31864_32251_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001064268.1|32247_34875_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_001278689.1|35034_35256_-	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	3.3e-07
WP_000809906.1|35390_35906_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001038341.1|35902_36154_-	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_001057292.1|36150_36468_-	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_000002780.1|36464_37037_-	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_072095570.1|38453_39158_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000399792.1|39168_39735_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|39756_40068_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000340272.1|40082_40442_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001254386.1|40475_40703_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000332484.1|40796_41483_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000124981.1|41673_42057_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000614936.1|42333_42981_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234469.1|43277_44099_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000107535.1|44220_44508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042808424.1|44740_44929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|45429_45588_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299721.1|45667_45856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276228.1|45867_46587_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845895.1|46583_47018_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001145469.1|47072_49031_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	4.7e-20
48792:48807	attL	GGCATGAACAACCAGA	NA	NA	NA	NA
WP_000006004.1|49089_49323_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_000290793.1|49378_49906_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	54.3	6.7e-46
WP_032175643.1|50133_50328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072133095.1|50378_50651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311069.1|50802_51366_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	38.0	2.7e-21
WP_000170681.1|51411_52773_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|52824_53055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027505.1|54048_54231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042007484.1|54230_54692_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_072256028.1|54691_54994_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000082154.1|55518_56490_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
WP_000817028.1|58844_59816_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|59815_60982_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_085947772.1|62522_63735_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000361611.1|64280_65258_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066954.1|65542_66283_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_065203495.1|66403_66592_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_000175738.1|66965_67874_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|67936_69046_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|69478_70432_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|71705_71864_-|transposase	transposase	transposase	NA	NA	NA	NA
82375:82390	attR	TCTGGTTGTTCATGCC	NA	NA	NA	NA
>prophage 1
NZ_CP047666	Escherichia coli strain LD26-1 plasmid pLD26-1-MCR1, complete sequence	251000	57775	99927	251000	transposase,protease,integrase	Escherichia_phage(30.77%)	45	52724:52737	65235:65248
52724:52737	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_012478345.1|57775_58750_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_049589868.1|58945_60571_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_160183281.1|60642_61449_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_001805195.1|61384_61729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|61750_62926_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|63096_63309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|63669_64752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|64918_66418_-	kinase	NA	NA	NA	NA	NA
65235:65248	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|66443_68081_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|68080_69121_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|69206_69845_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|69844_70486_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
WP_001388628.1|70508_71147_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|71609_72077_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|72094_73303_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|73313_74270_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|74269_75349_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|75350_76124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|76116_77259_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|77268_78327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|78650_79232_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|79231_80389_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|80411_80867_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
WP_062914744.1|80889_81930_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|81978_82557_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|82624_83200_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|83628_84870_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|85432_85714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|85763_85955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|86046_86418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|86760_87153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|87756_88050_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|88054_89380_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|89440_89647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|89748_90159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146881499.1|90171_90987_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_001043843.1|91240_91666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|92214_92523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|92538_93396_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_152921942.1|94244_94712_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	4.9e-08
WP_063120614.1|95369_96503_-	permease	NA	NA	NA	NA	NA
WP_001175593.1|96608_96932_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|97474_98179_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|98290_98995_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389365.1|99162_99927_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
NZ_CP047666	Escherichia coli strain LD26-1 plasmid pLD26-1-MCR1, complete sequence	251000	103265	160778	251000	transposase,integrase	Escherichia_phage(33.33%)	56	103213:103272	156766:157586
103213:103272	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|103265_103970_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000105383.1|104236_105673_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000427623.1|106090_107095_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032193599.1|107667_108372_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067858.1|108401_109106_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_152921935.1|109117_109273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|109915_110734_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|110730_111936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|112215_113535_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|113785_115213_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|115427_115943_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|115945_116842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|117063_117297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|117958_118189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|118525_118987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|119016_119424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|119474_119792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|120168_120519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|122208_122913_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001617865.1|123215_124091_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_014839980.1|124702_125119_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|125123_125642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071448054.1|125641_126388_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|126393_127098_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|127211_127988_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000602738.1|129538_130291_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|132101_132587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|132783_133874_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|133963_134779_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|134865_135168_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|135061_135313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|135343_136837_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|136948_137254_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|137281_138496_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001447541.1|138712_139597_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|140521_141226_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_065800308.1|141310_141700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|141964_142969_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_015344976.1|143047_145999_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|146001_146562_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_081316080.1|146687_147272_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|147240_148254_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|148398_148896_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|149007_149298_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|149303_150095_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|150356_151616_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|151708_152500_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|152669_153002_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000034420.1|154181_154973_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|155441_155687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|155724_156588_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001067855.1|156818_157523_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|157673_158489_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
156766:157586	attR	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_001067855.1|158678_159383_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|159607_159811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|159938_160778_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
