The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047697	Pseudomonas aeruginosa strain RD1-3 chromosome, complete genome	6397159	629886	710559	6397159	tRNA,plate,holin,tail	Pseudomonas_phage(33.33%)	86	NA	NA
WP_003129196.1|629886_630912_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|630990_631560_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|631643_631997_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003142783.1|631987_632530_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003117955.1|632502_633735_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.3	2.0e-77
WP_014602427.1|633778_634285_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|634378_635932_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|635928_637200_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|637300_639223_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003085081.1|639501_639834_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|639877_640729_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|640728_641109_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|641145_641952_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003109023.1|642067_643054_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|643050_644343_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_016252922.1|644323_647116_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003137370.1|647242_648259_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003117959.1|648255_648930_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_023091417.1|648931_649690_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016263871.1|649690_650752_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_003109040.1|650903_653297_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|653342_653975_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|654103_655138_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|655371_656481_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003109043.1|656536_657583_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003109044.1|657697_658945_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|659050_659881_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|660004_660679_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|660678_661497_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|661569_663048_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003109046.1|663365_663680_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003109047.1|663779_664550_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.0	7.9e-72
WP_003085132.1|665007_665208_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_023091415.1|665255_665615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073625183.1|665977_666427_+|holin	holin	holin	B5TK61	Pseudomonas_phage	54.2	1.0e-26
WP_003113200.1|666448_666964_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003121844.1|666960_667518_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_023091414.1|667670_667997_+	bacteriophage protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	4.1e-30
WP_003161928.1|667993_668881_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	4.1e-88
WP_003118911.1|668873_669407_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_023091413.1|669408_671514_+|tail	phage tail fiber protein	tail	Q9ZXK6	Pseudomonas_virus	52.6	1.9e-221
WP_016852415.1|671521_671962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019681189.1|672004_673165_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.2	2.0e-188
WP_003085175.1|673177_673681_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|673695_674040_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023091412.1|674209_676447_+|tail	phage tail length determinator protein	tail	NA	NA	NA	NA
WP_034054805.1|676456_677329_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	52.1	7.9e-76
WP_003101635.1|677303_677510_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003137392.1|677567_678557_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.8e-106
WP_003118917.1|678589_679219_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
WP_003142810.1|679215_679578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118919.1|679574_679832_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003113190.1|680148_680643_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_004352265.1|680654_681002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003113188.1|681031_681286_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003113187.1|681332_683168_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	36.2	1.2e-28
WP_003113186.1|683160_683502_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_023091410.1|683509_684205_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	49.8	5.7e-69
WP_003113184.1|684207_684978_+	hypothetical protein	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_003118924.1|685032_685635_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
WP_023091409.1|685693_689353_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	57.2	0.0e+00
WP_124120567.1|689368_689686_+	hypothetical protein	NA	Q3HQU6	Burkholderia_phage	34.3	8.2e-07
WP_023091408.1|689687_690398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023091407.1|690439_691540_+	hypothetical protein	NA	A0A1W6JTA8	Pseudomonas_phage	77.6	2.0e-116
WP_031772097.1|691539_691851_+	hypothetical protein	NA	A0A1W6JTB1	Pseudomonas_phage	85.4	1.7e-44
WP_003129222.1|691847_692075_+	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	89.0	5.4e-29
WP_023091406.1|692479_693085_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	3.5e-75
WP_003085203.1|693086_694136_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|694132_694969_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
WP_003085214.1|695030_695675_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003085219.1|695946_696369_+	OsmC family protein	NA	NA	NA	NA	NA
WP_003101641.1|696688_697483_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_023091405.1|697537_698185_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003085225.1|698284_698623_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_034054806.1|698701_700183_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	34.0	7.9e-68
WP_003142814.1|700222_701023_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_034054807.1|701083_702160_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_003117983.1|702281_703250_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_023091403.1|703266_703689_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003085247.1|703979_705014_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003085249.1|705013_705733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003120826.1|705733_706156_+	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_003085254.1|706233_706584_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_003142820.1|706637_707729_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_076939080.1|707731_709075_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_003101660.1|709359_710559_+|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP047697	Pseudomonas aeruginosa strain RD1-3 chromosome, complete genome	6397159	2043694	2051191	6397159	capsid,integrase	Pseudomonas_phage(100.0%)	11	2045182:2045196	2052525:2052539
WP_031772003.1|2043694_2043982_+	hypothetical protein	NA	Q56VP7	Pseudomonas_phage	93.6	1.3e-51
WP_079278965.1|2043985_2044363_+	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	96.8	1.3e-59
WP_003140508.1|2044497_2044932_+	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_003115130.1|2044948_2045041_+	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
WP_003115979.1|2045053_2045305_+	hypothetical protein	NA	NA	NA	NA	NA
2045182:2045196	attL	CATCCTGGTCAACGG	NA	NA	NA	NA
WP_023090795.1|2045317_2045566_+|capsid	phage capsid protein	capsid	Q56VP2	Pseudomonas_phage	91.5	1.7e-31
WP_031772001.1|2045717_2047034_+	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	57.0	1.5e-49
WP_003114150.1|2047038_2047395_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_023090793.1|2047398_2048673_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	87.3	8.2e-199
WP_003115206.1|2048903_2050196_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	2.8e-247
WP_023090792.1|2050195_2051191_+|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.9	2.8e-93
2052525:2052539	attR	CCGTTGACCAGGATG	NA	NA	NA	NA
>prophage 3
NZ_CP047697	Pseudomonas aeruginosa strain RD1-3 chromosome, complete genome	6397159	4193233	4224379	6397159	head,protease,portal,holin,capsid,terminase	Pseudomonas_phage(74.19%)	39	NA	NA
WP_014602838.1|4193233_4194229_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	69.9	5.7e-131
WP_015648940.1|4194295_4194655_-|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	52.3	2.6e-17
WP_014602836.1|4194654_4195851_-|protease	ATP-dependent Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	58.0	6.9e-115
WP_046688675.1|4195847_4197323_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	70.7	1.1e-199
WP_015648941.1|4197322_4197547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046688674.1|4197562_4199491_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	65.0	5.1e-253
WP_014602833.1|4199462_4199957_-	DNA packaging protein	NA	A0A1B0Z033	Pseudomonas_phage	64.2	1.7e-51
WP_046688673.1|4200222_4200960_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	46.7	2.5e-43
WP_046688672.1|4201056_4201536_-	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	85.4	2.2e-51
WP_023097520.1|4201505_4202123_-	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	89.8	4.8e-104
WP_003119044.1|4202119_4202455_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	100.0	2.2e-58
WP_014602828.1|4202760_4203456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046688909.1|4203557_4204427_-	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	95.2	5.1e-160
WP_033979790.1|4204455_4204899_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	94.6	4.1e-73
WP_033979792.1|4204891_4205500_-	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	43.9	2.6e-41
WP_016046669.1|4206649_4207222_-	hypothetical protein	NA	H2BD67	Pseudomonas_phage	100.0	9.3e-102
WP_016046666.1|4207258_4207471_-	transcriptional regulator	NA	H2BD64	Pseudomonas_phage	100.0	7.1e-31
WP_049973662.1|4207525_4208398_+	LexA family transcriptional regulator	NA	H2BD63	Pseudomonas_phage	97.9	2.0e-156
WP_012075316.1|4208531_4209182_+	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	97.7	1.2e-121
WP_046688911.1|4209773_4210793_+	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	53.5	2.3e-95
WP_031634925.1|4211232_4211565_-	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	94.3	1.0e-47
WP_046688912.1|4212031_4212508_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014602819.1|4213384_4213756_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	99.2	1.9e-63
WP_046688611.1|4214267_4214780_+	hypothetical protein	NA	J7I0S8	Pseudomonas_phage	77.6	1.2e-76
WP_153603914.1|4214776_4214926_+	hypothetical protein	NA	J7HXJ0	Pseudomonas_phage	96.9	2.6e-11
WP_046688612.1|4214909_4215131_+	hypothetical protein	NA	A0A127KNM7	Pseudomonas_phage	94.5	1.3e-30
WP_014602817.1|4215127_4215310_+	hypothetical protein	NA	Q9MC67	Pseudomonas_phage	100.0	1.7e-25
WP_029528657.1|4215302_4215542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023113718.1|4215665_4215950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046688613.1|4216016_4216925_+	endonuclease	NA	Q858E0	Salmonella_phage	71.3	1.1e-123
WP_014602814.1|4216937_4217837_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.6	3.2e-104
WP_003116739.1|4217843_4218044_+	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_016561992.1|4218056_4218815_+	hypothetical protein	NA	J7I0T4	Pseudomonas_phage	66.1	1.1e-102
WP_046688614.1|4219697_4221611_+	DNA methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	91.8	1.2e-281
WP_124117576.1|4221967_4222822_-	DUF3825 domain-containing protein	NA	NA	NA	NA	NA
WP_124117578.1|4222950_4223316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046688615.1|4223312_4223780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153603913.1|4223831_4223996_+	hypothetical protein	NA	A0A2K8HK84	Pseudomonas_phage	95.0	1.9e-12
WP_025991793.1|4223992_4224379_+	hypothetical protein	NA	A0A2K8HZQ6	Pseudomonas_phage	100.0	2.1e-65
>prophage 4
NZ_CP047697	Pseudomonas aeruginosa strain RD1-3 chromosome, complete genome	6397159	4238690	4292296	6397159	integrase,holin,terminase,head	Pseudomonas_phage(82.54%)	67	4238374:4238433	4288287:4288378
4238374:4238433	attL	AAGAAAAAAGCCCCGTAACTCACTGAGCTACGGGGCTTTCCTGTTGGAGGCTGAGGTCGG	NA	NA	NA	NA
WP_033863663.1|4238690_4239203_+	hypothetical protein	NA	A0A2K8HVM8	Pseudomonas_phage	92.3	2.7e-92
WP_023082390.1|4239206_4239473_-	hypothetical protein	NA	L7TP56	Pseudomonas_virus	100.0	6.3e-45
WP_150035491.1|4239508_4239838_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	91.7	1.5e-48
WP_150035493.1|4239834_4240203_-	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	82.0	2.2e-43
WP_160289282.1|4240199_4240829_-	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	94.7	2.3e-109
WP_121370615.1|4240873_4242949_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	35.9	1.5e-61
WP_160289283.1|4242961_4244647_-	hypothetical protein	NA	A0A291I973	Pseudomonas_phage	72.4	6.8e-185
WP_033994432.1|4244713_4247461_-	hypothetical protein	NA	A0A0H5ART3	Pseudomonas_phage	48.0	6.0e-239
WP_023125838.1|4247426_4247840_-	hypothetical protein	NA	B5WZT7	Pseudomonas_phage	60.7	1.1e-40
WP_160289284.1|4247843_4248329_-	DUF1833 domain-containing protein	NA	A0A2H4J983	uncultured_Caudovirales_phage	45.0	1.1e-34
WP_058016774.1|4248330_4248795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160289285.1|4248791_4251275_-	tape measure protein	NA	J7HXG0	Pseudomonas_phage	82.6	8.2e-304
WP_043090782.1|4251274_4251892_-	hypothetical protein	NA	A0A125RNN1	Pseudomonas_phage	98.5	1.5e-113
WP_126869288.1|4251888_4252884_-	Ig domain-containing protein	NA	H2BD89	Pseudomonas_phage	84.0	1.1e-142
WP_160289286.1|4252898_4253273_-	hypothetical protein	NA	J7I407	Pseudomonas_phage	99.2	1.3e-67
WP_031675291.1|4253269_4253674_-	hypothetical protein	NA	H2BD87	Pseudomonas_phage	91.0	4.6e-63
WP_023082507.1|4253675_4253996_-	hypothetical protein	NA	J7I4I8	Pseudomonas_phage	97.2	1.5e-56
WP_014603768.1|4253992_4254394_-	hypothetical protein	NA	J7HX89	Pseudomonas_phage	98.5	7.8e-71
WP_128724039.1|4254478_4254937_-	hypothetical protein	NA	A0A125RNM4	Pseudomonas_phage	75.0	1.1e-49
WP_033984053.1|4254947_4256039_-	hypothetical protein	NA	H2BD82	Pseudomonas_phage	91.8	3.5e-190
WP_160289287.1|4256054_4256504_-	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	97.3	1.4e-76
WP_160289288.1|4256507_4257785_-	hypothetical protein	NA	H2BD80	Pseudomonas_phage	98.1	4.5e-213
WP_160289289.1|4257788_4258718_-|head	phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	99.0	3.4e-170
WP_160289290.1|4258674_4260045_-	DUF1073 domain-containing protein	NA	H2BD78	Pseudomonas_phage	98.0	1.9e-262
WP_023082514.1|4260047_4260245_-	hypothetical protein	NA	H2BD77	Pseudomonas_phage	98.5	8.9e-28
WP_034017705.1|4260244_4261708_-	phage DNA Packaging protein	NA	G0ZND4	Cronobacter_phage	83.5	7.6e-241
WP_121401783.1|4261697_4262258_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	81.6	2.0e-72
WP_003116758.1|4262266_4262551_-|holin	phage holin family protein	holin	H2BD74	Pseudomonas_phage	100.0	1.2e-41
WP_160289291.1|4262543_4262933_-	hypothetical protein	NA	H2BD73	Pseudomonas_phage	98.4	2.9e-62
WP_033997397.1|4263047_4263734_-	hypothetical protein	NA	H2BD72	Pseudomonas_phage	99.6	2.2e-129
WP_033951833.1|4263762_4264206_-	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	100.0	4.3e-78
WP_016046672.1|4264198_4265614_-	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	100.0	1.8e-263
WP_160289292.1|4265606_4266413_-	hypothetical protein	NA	J7I419	Pseudomonas_phage	94.8	5.5e-140
WP_160289293.1|4266405_4266588_-	hypothetical protein	NA	A0A127KNC5	Pseudomonas_phage	85.0	3.0e-22
WP_042930144.1|4266625_4266868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096627.1|4266858_4267431_-	hypothetical protein	NA	H2BD67	Pseudomonas_phage	99.5	1.2e-101
WP_003451709.1|4267462_4267681_-	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	2.9e-19
WP_052435791.1|4268058_4268631_+	LexA family transcriptional regulator	NA	H2BD63	Pseudomonas_phage	91.7	3.2e-86
WP_016046664.1|4268773_4269826_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	100.0	3.3e-201
WP_160289294.1|4270182_4270518_-	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	96.4	1.2e-51
WP_121394060.1|4271055_4271319_+	hypothetical protein	NA	J7I4K6	Pseudomonas_phage	97.7	5.3e-44
WP_034004100.1|4271351_4271720_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	97.5	3.6e-62
WP_039027474.1|4272138_4272369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160289295.1|4272528_4272750_+	hypothetical protein	NA	A0A2K8I9C2	Pseudomonas_phage	97.2	1.0e-32
WP_057384024.1|4272746_4272938_+	hypothetical protein	NA	J7HXB2	Pseudomonas_phage	98.4	9.5e-27
WP_160289296.1|4273066_4273867_+	PD-(D/E)XK nuclease family protein	NA	H2BD50	Pseudomonas_phage	95.5	1.7e-146
WP_033945330.1|4273875_4274091_+	hypothetical protein	NA	J7I4L3	Pseudomonas_phage	100.0	1.4e-34
WP_034004105.1|4274087_4275023_+	hypothetical protein	NA	J7HXB6	Pseudomonas_phage	99.6	4.2e-152
WP_009314053.1|4275029_4275230_+	hypothetical protein	NA	J7I437	Pseudomonas_phage	100.0	1.9e-30
WP_160289297.1|4275240_4276173_+	cell division protein FtsK	NA	J7I0T4	Pseudomonas_phage	99.4	1.4e-166
WP_160289298.1|4276176_4277922_+	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	93.8	1.1e-291
WP_160289299.1|4278082_4279513_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	72.3	8.4e-176
WP_160289300.1|4279525_4281436_+	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	91.2	7.1e-263
WP_023103948.1|4281432_4281879_+	hypothetical protein	NA	Q6JIG5	Burkholderia_virus	71.0	4.3e-54
WP_160289301.1|4281875_4282346_+	hypothetical protein	NA	J7I440	Pseudomonas_phage	89.1	1.2e-73
WP_160289302.1|4282342_4282963_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	69.1	3.6e-75
WP_023109472.1|4282959_4283448_+	DUF1643 domain-containing protein	NA	A0A0U1W068	Pseudomonas_phage	96.9	5.2e-93
WP_160289303.1|4283444_4284230_+	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	88.0	2.6e-126
WP_034027053.1|4284226_4284592_+	hypothetical protein	NA	H2BD40	Pseudomonas_phage	93.7	2.4e-58
WP_160289304.1|4284588_4285095_+	hypothetical protein	NA	L7TI83	Pseudomonas_virus	94.0	1.8e-85
WP_160289316.1|4285891_4286374_+	hypothetical protein	NA	Q5QF38	Pseudomonas_virus	98.8	5.3e-90
WP_160289305.1|4286370_4286493_+	YdgA family protein	NA	A0A2K8HK84	Pseudomonas_phage	90.0	7.9e-11
WP_160289306.1|4286489_4286876_+	hypothetical protein	NA	A0A2K8HZQ6	Pseudomonas_phage	99.2	8.0e-65
WP_071534308.1|4286932_4287166_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	49.3	9.5e-13
WP_079761175.1|4287194_4288232_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	58.3	6.2e-112
WP_004350037.1|4288693_4289227_-	hypothetical protein	NA	NA	NA	NA	NA
4288287:4288378	attR	AAGAAAAAAGCCCCGTAACTCACTGAGCTACGGGGCTTTCCTGTTGGAGGCTGAGGTCGGAATCGAACCGGCGTTCACGGATTTGCAATCCG	NA	NA	NA	NA
WP_029610822.1|4289317_4292296_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.4	1.5e-33
>prophage 5
NZ_CP047697	Pseudomonas aeruginosa strain RD1-3 chromosome, complete genome	6397159	4317528	4324422	6397159	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003090386.1|4317528_4318197_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_003090387.1|4318307_4318703_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090389.1|4318699_4319059_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090391.1|4319058_4319364_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003119979.1|4319360_4319696_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003097625.1|4319692_4320676_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003097628.1|4320763_4321738_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003160439.1|4321742_4323140_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097631.1|4323141_4324422_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
>prophage 6
NZ_CP047697	Pseudomonas aeruginosa strain RD1-3 chromosome, complete genome	6397159	5413159	5422188	6397159		Bacillus_phage(33.33%)	8	NA	NA
WP_003092260.1|5413159_5414200_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
WP_003129950.1|5414333_5414840_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	1.8e-56
WP_034054421.1|5414987_5415995_+	TolB family protein	NA	NA	NA	NA	NA
WP_003113873.1|5416120_5418688_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003092272.1|5418754_5419078_+	Ferredoxin 1	NA	NA	NA	NA	NA
WP_003113871.1|5419504_5420509_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003115226.1|5420613_5421507_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003098558.1|5421552_5422188_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
