The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	0	35755	2858867	tail,capsid,head,portal,terminase,transposase,holin,protease	Staphylococcus_phage(93.33%)	37	NA	NA
WP_000625094.1|0_1662_+|terminase	terminase large subunit	terminase	Q8LTH3	Staphylococcus_phage	99.8	0.0e+00
WP_000025266.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	99.7	3.0e-219
WP_000861914.1|2848_3586_+|protease	Clp protease ClpP	protease	C8CH20	Staphylococcus_phage	100.0	2.3e-129
WP_000154558.1|3609_4755_+|capsid	phage major capsid protein	capsid	C8CH21	Staphylococcus_phage	99.7	2.8e-214
WP_000238240.1|4774_5059_+	hypothetical protein	NA	A0A1W6JPL8	Staphylococcus_phage	100.0	2.3e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114341.1|5675_6080_+	hypothetical protein	NA	A0A1W6JPJ1	Staphylococcus_phage	100.0	2.5e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268740.1|6484_7129_+|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096353.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	99.1	3.0e-58
WP_160187001.1|8039_12569_+|tail	phage tail tape measure protein	tail	W5R8I2	Staphylococcus_phage	91.5	0.0e+00
WP_031889406.1|12565_14050_+|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	98.8	1.2e-294
WP_073392894.1|14065_17851_+	hypothetical protein	NA	A0A1X9H0H3	Staphylococcus_phage	98.8	0.0e+00
WP_001153681.1|17840_17993_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040261.1|18039_18327_+	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
WP_000539688.1|18384_18681_+	DUF2951 domain-containing protein	NA	D2JLG2	Staphylococcus_phage	100.0	2.9e-46
WP_011447039.1|18830_19007_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|19059_19167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|19218_19473_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|19484_20240_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000919350.1|20430_20922_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_100218362.1|21403_21865_+	amidase	NA	R9QTN8	Staphylococcus_phage	95.4	1.9e-81
WP_000702262.1|22375_22726_+	complement inhibitor SCIN-A	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
WP_000277709.1|22749_24396_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
WP_001791826.1|24702_24963_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|25273_25453_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_000669728.1|26410_28480_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000277709.1|28777_30424_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
WP_001068528.1|30671_31958_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|32157_32256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681966.1|32497_32674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|32931_33312_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991315.1|33308_34205_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645732.1|34205_34886_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|34882_35755_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
>prophage 2
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	41000	41402	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|41000_41402_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 3
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	45599	47630	2858867		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|45599_46160_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275719.1|46532_47630_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
>prophage 4
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	51660	53944	2858867		Bacillus_virus(100.0%)	2	NA	NA
WP_000284434.1|51660_53130_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
WP_000040861.1|53122_53944_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 5
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	57633	64411	2858867		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|57633_58929_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|59037_59340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272063.1|59522_60215_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|60211_62404_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774552.1|62407_64411_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
>prophage 6
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	71640	76668	2858867		Catovirus(33.33%)	5	NA	NA
WP_001231458.1|71640_72588_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_160187002.1|72668_74030_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	42.8	4.5e-102
WP_000548777.1|74199_74730_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140179.1|74976_76047_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|76113_76668_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 7
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	80121	80535	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001643743.1|80121_80535_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.5	3.0e-17
>prophage 8
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	85516	86146	2858867		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|85516_86146_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 9
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	92175	166670	2858867	plate,tail,tRNA,capsid,head,portal,integrase,terminase,holin	Staphylococcus_phage(80.95%)	83	84017:84034	111813:111830
84017:84034	attL	ATCATCATCTTGTTCGTC	NA	NA	NA	NA
WP_001145732.1|92175_93222_-|integrase	site-specific integrase	integrase	A0A0H3U2V9	Staphylococcus_phage	100.0	4.2e-201
WP_000392109.1|93432_94113_-	hypothetical protein	NA	A0A2H4PQQ5	Staphylococcus_phage	100.0	5.1e-123
WP_000661378.1|94329_95055_-	hypothetical protein	NA	A0A0F6N4L7	Staphylococcus_phage	95.4	7.4e-120
WP_000775189.1|95083_95758_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	94.6	5.2e-120
WP_001055142.1|95774_96107_-	helix-turn-helix transcriptional regulator	NA	R4IH08	Staphylococcus_phage	98.2	2.0e-56
WP_000108121.1|96369_96564_+	helix-turn-helix transcriptional regulator	NA	A0A0F6N3M9	Staphylococcus_phage	96.9	6.9e-25
WP_123985805.1|96563_97331_+	phage antirepressor KilAC domain-containing protein	NA	A0A0F6N3N8	Staphylococcus_phage	98.0	5.2e-140
WP_000187184.1|97331_97556_+	hypothetical protein	NA	A0A0F6N4M2	Staphylococcus_phage	100.0	3.2e-34
WP_000395455.1|97746_97977_-	hypothetical protein	NA	C8CGY3	Staphylococcus_phage	100.0	2.3e-35
WP_000066020.1|98156_98318_+	DUF1270 domain-containing protein	NA	A0A2I6PDF7	Staphylococcus_phage	100.0	1.9e-20
WP_000291488.1|98410_98671_+	DUF1108 family protein	NA	A0A2I6PDH1	Staphylococcus_phage	100.0	2.6e-43
WP_001205732.1|98679_98943_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700577.1|98951_100895_+	AAA family ATPase	NA	A0EWX0	Staphylococcus_phage	100.0	0.0e+00
WP_160187004.1|100896_101817_+	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	99.7	3.0e-166
WP_072467283.1|101882_102515_+	MBL fold metallo-hydrolase	NA	A0A2I6PDI9	Staphylococcus_phage	100.0	9.4e-87
WP_000610650.1|102515_102986_+	single-stranded DNA-binding protein	NA	A0A2I6PDH4	Staphylococcus_phage	100.0	5.7e-81
WP_000148335.1|103015_103909_+	DnaD domain-containing protein	NA	A0A2I6PDG7	Staphylococcus_phage	100.0	8.4e-142
WP_001662399.1|103915_104134_+	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	98.6	2.3e-37
WP_001662398.1|104142_104547_+	RusA family crossover junction endodeoxyribonuclease	NA	O80087	Staphylococcus_phage	100.0	8.4e-73
WP_000101268.1|104559_104931_+	hypothetical protein	NA	A0A2I6PDG3	Staphylococcus_phage	100.0	2.7e-57
WP_001622146.1|104931_105180_+	hypothetical protein	NA	C8CH00	Staphylococcus_phage	96.3	2.0e-40
WP_001062709.1|105194_105587_+	hypothetical protein	NA	A0A2I6PE39	Staphylococcus_phage	100.0	1.6e-68
WP_000983947.1|105583_105775_+	hypothetical protein	NA	Q4ZBT5	Staphylococcus_virus	100.0	1.5e-27
WP_001622147.1|105774_106206_+	hypothetical protein	NA	Q4ZBT4	Staphylococcus_virus	99.3	4.7e-74
WP_000370293.1|106198_106447_+	DUF1024 family protein	NA	A0A0H4IP74	Staphylococcus_phage	100.0	4.1e-38
WP_160187005.1|106602_107130_+	dUTP pyrophosphatase	NA	A0A2I6PF13	Staphylococcus_phage	99.4	8.6e-94
WP_000195831.1|107166_107403_+	DUF1381 domain-containing protein	NA	C8CH06	Staphylococcus_phage	100.0	1.1e-35
WP_000483477.1|107427_107664_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_000595257.1|107656_107830_+	transcriptional activator RinB	NA	Q4ZBK0	Staphylococcus_phage	100.0	6.4e-22
WP_000989998.1|107830_107977_+	hypothetical protein	NA	A0A059T5A8	Staphylococcus_phage	100.0	2.2e-15
WP_000162696.1|108000_108423_+	RinA family phage transcriptional activator	NA	S4V7K2	Staphylococcus_phage	100.0	1.6e-74
WP_001003272.1|108609_109050_+|terminase	terminase small subunit	terminase	Q8SDV0	Staphylococcus_phage	100.0	2.8e-74
WP_160187006.1|109036_110314_+|terminase	PBSX family phage terminase large subunit	terminase	Q8SDU9	Staphylococcus_phage	99.8	8.7e-249
WP_000921897.1|110324_111860_+|portal	phage portal protein	portal	Q8SDU8	Staphylococcus_phage	99.2	9.3e-290
111813:111830	attR	GACGAACAAGATGATGAT	NA	NA	NA	NA
WP_001556698.1|111866_112862_+|head	phage head morphogenesis protein	head	E0Y3K7	Staphylococcus_virus	99.7	1.7e-183
WP_000072207.1|112934_113105_+	hypothetical protein	NA	Q4ZDF2	Staphylococcus_virus	100.0	3.3e-23
WP_160187007.1|113239_113854_+	DUF4355 domain-containing protein	NA	I1W646	Staphylococcus_phage	99.0	1.4e-39
WP_000438513.1|113867_114842_+|capsid	phage major capsid protein	capsid	S4V686	Staphylococcus_phage	100.0	1.7e-183
WP_001114085.1|114863_115151_+	hypothetical protein	NA	S4V6D9	Staphylococcus_phage	100.0	4.7e-46
WP_000208960.1|115159_115492_+|head,tail	phage head-tail connector protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
WP_001268313.1|115488_115791_+	hypothetical protein	NA	A4ZFB6	Staphylococcus_virus	99.0	7.4e-50
WP_031925055.1|115790_116138_+	HK97 gp10 family phage protein	NA	B2ZYY9	Staphylococcus_phage	98.3	5.9e-59
WP_098827722.1|116149_116533_+	hypothetical protein	NA	Q8SDU1	Staphylococcus_phage	98.4	5.9e-68
WP_000002583.1|116551_117133_+|tail	phage major tail protein, TP901-1 family	tail	Q8SDU0	Staphylococcus_phage	100.0	4.9e-106
WP_001100163.1|117194_117560_+	hypothetical protein	NA	Q8SDT9	Staphylococcus_phage	100.0	2.8e-59
WP_000105584.1|117589_117934_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
WP_098827721.1|117950_121418_+	hypothetical protein	NA	Q4ZDU6	Staphylococcus_virus	97.6	1.6e-273
WP_000350680.1|121430_122378_+|tail	phage tail family protein	tail	Q8SDT6	Staphylococcus_phage	100.0	2.1e-183
WP_000156407.1|122386_124288_+	peptidase	NA	Q8SDT5	Staphylococcus_phage	99.8	0.0e+00
WP_160187008.1|124302_126213_+	hypothetical protein	NA	A0EWM6	Staphylococcus_virus	99.1	0.0e+00
WP_053868349.1|126212_128036_+|plate	BppU family phage baseplate upper protein	plate	A0A0H4ISS3	Staphylococcus_phage	99.8	0.0e+00
WP_000705896.1|128035_128413_+	DUF2977 domain-containing protein	NA	A0A0F6N3G4	Staphylococcus_phage	100.0	1.5e-60
WP_000782200.1|128416_128590_+	XkdX family protein	NA	A0A0F6N3L7	Staphylococcus_phage	100.0	6.6e-27
WP_000466778.1|128629_128929_+	DUF2951 domain-containing protein	NA	A0A0H4ITZ0	Staphylococcus_phage	100.0	7.6e-47
WP_000524023.1|129065_130964_+	CHAP domain-containing protein	NA	B2ZZ02	Staphylococcus_phage	99.1	0.0e+00
WP_098827718.1|130976_132149_+|plate	BppU family phage baseplate upper protein	plate	A0EWN2	Staphylococcus_virus	99.2	2.7e-196
WP_029550581.1|132154_132550_+	hypothetical protein	NA	Q4ZBP5	Staphylococcus_phage	99.2	7.9e-68
WP_000354128.1|132604_133042_+|holin	phage holin	holin	S4SVG2	Staphylococcus_phage	99.3	4.1e-73
WP_061641004.1|133022_134468_+	CHAP domain-containing protein	NA	A0A0H3U310	Staphylococcus_phage	97.7	1.8e-290
WP_000238963.1|134976_135771_+	phosphatidylinositol kinase	NA	Q4ZAU0	Staphylococcus_virus	100.0	8.3e-149
WP_000278830.1|135777_136515_+	hypothetical protein	NA	A7YGY5	Staphylococcus_virus	99.6	7.5e-136
WP_102853795.1|136567_136684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005407.1|137010_137172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000163281.1|137301_137817_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000830380.1|138157_138967_+	monofunctional peptidoglycan glycosyltransferase SgtB	NA	NA	NA	NA	NA
WP_001124422.1|139227_140046_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000435806.1|140023_140338_+	YfhH family protein	NA	NA	NA	NA	NA
WP_000535849.1|140352_141870_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000886472.1|141878_142715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379091.1|142975_143953_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000284755.1|144104_145142_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000251252.1|145444_145987_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_000597238.1|146277_148014_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
WP_001236371.1|148204_149299_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_160187009.1|149591_150881_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000939530.1|150961_151417_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_000869463.1|151422_152373_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_000110011.1|152469_152916_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_000063551.1|161424_162486_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_000649898.1|162744_164202_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001144055.1|164188_164917_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
WP_001793998.1|165052_166195_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000181394.1|166199_166670_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	175571	175916	2858867		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|175571_175916_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 11
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	185504	186245	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|185504_186245_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 12
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	194108	198388	2858867		Staphylococcus_phage(80.0%)	5	NA	NA
WP_147612242.1|194108_194891_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	38.6	8.7e-34
WP_000821649.1|195172_195892_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
WP_000721567.1|195926_196655_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
WP_000764684.1|196808_197594_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
WP_001235656.1|197632_198388_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	40.8	2.3e-39
>prophage 13
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	201642	271925	2858867	protease,tRNA	Staphylococcus_phage(93.18%)	65	NA	NA
WP_000711498.1|201642_202980_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	50.5	1.5e-62
WP_000595635.1|203226_203742_-	membrane protein	NA	NA	NA	NA	NA
WP_001039022.1|204756_205476_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
WP_001038766.1|205599_206316_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
WP_001038734.1|207361_208078_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
WP_001038742.1|208247_208967_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
WP_001794363.1|209146_210886_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	3.2e-286
WP_000072622.1|210878_212033_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
WP_000413389.1|212069_213887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095390.1|214148_214448_-	secretion protein	NA	NA	NA	NA	NA
WP_061733915.1|214462_216073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000619920.1|216115_216565_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001819963.1|216792_217152_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000182553.1|217277_219698_-	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_000731421.1|220664_221108_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001037039.1|221107_221551_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001791232.1|221725_221827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001801861.1|221949_222045_-	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_000747804.1|222495_222942_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000125075.1|223134_223704_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
WP_001093574.1|223703_225071_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000414222.1|225219_225792_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_000627550.1|225889_226234_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
WP_000669038.1|226274_226901_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
WP_000070654.1|226976_227972_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
WP_001794016.1|228052_228703_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
WP_016186903.1|229004_229460_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
WP_000348372.1|229618_231097_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
WP_160187013.1|231101_232103_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.0	2.2e-183
WP_000718107.1|232099_232357_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672010.1|232422_232896_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
WP_001801476.1|232900_233647_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
WP_000109909.1|233939_235532_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
WP_000933819.1|235903_237097_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366165.1|237221_238130_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
WP_000453316.1|238341_239175_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
WP_000623481.1|239424_239778_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
WP_001200542.1|239774_240140_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091444.1|240394_240697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|240955_241669_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_000492901.1|242126_242747_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001168914.1|242913_243549_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001030476.1|243846_244290_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
WP_001152695.1|244276_244720_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671059.1|244832_245303_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
WP_000384171.1|245501_245726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|246001_246856_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989104.1|246942_248235_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
WP_000221181.1|248234_248549_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	97.1	1.7e-52
WP_001261683.1|249191_250694_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
WP_001819953.1|251186_252218_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
WP_000493891.1|252224_252857_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
WP_001159032.1|252867_254049_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_001008556.1|254061_254526_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	1.9e-68
WP_001196351.1|254647_255649_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
WP_014937042.1|255760_255880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266099.1|255882_256710_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|257282_257684_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764425.1|257802_258366_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
WP_000526541.1|258362_259316_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_001025064.1|259426_260608_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
WP_001108722.1|260899_263314_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
WP_000836472.1|263335_263647_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
WP_001050520.1|263970_270540_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	88.7	1.7e-295
WP_000284993.1|270656_271925_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
>prophage 14
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	280062	283998	2858867		Salmonella_phage(50.0%)	3	NA	NA
WP_000733283.1|280062_280908_-	BlaZ family penicillin-hydrolyzing class A beta-lactamase PC1	NA	A0A1B0VBP7	Salmonella_phage	34.0	1.5e-31
WP_001284656.1|282760_283141_+	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_000690628.1|283404_283998_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	1.1e-41
>prophage 15
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	289581	294909	2858867		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|289581_290439_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048371.1|290467_291064_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118301.1|291084_294909_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 16
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	303481	305188	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862084.1|303481_305188_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 17
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	311792	314423	2858867	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|311792_313055_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279341.1|313148_314423_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 18
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	318191	322327	2858867		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|318191_319796_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291426.1|319782_320943_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553919.1|321057_321504_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174275.1|321583_322327_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-18
>prophage 19
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	339909	343107	2858867		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226930.1|339909_343107_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	5.5e-135
>prophage 20
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	348039	349797	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232655.1|348039_349797_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	3.3e-41
>prophage 21
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	354680	362845	2858867		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080025.1|354680_355382_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_073392727.1|355384_357046_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.0	1.7e-34
WP_000849445.1|357546_359034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038301.1|359326_361957_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	1.8e-46
WP_001114454.1|361972_362845_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 22
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	366759	377913	2858867	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|366759_367680_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_016186894.1|367772_367868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|368092_370030_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049150.1|370456_371950_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791219.1|372178_372706_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	5.3e-11
WP_001125540.1|372734_372935_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|372981_373338_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032653.1|373479_374088_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	36.4	1.7e-21
WP_001280014.1|374106_375036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|375040_375151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127572.1|375198_376500_+	trigger factor	NA	NA	NA	NA	NA
WP_000472293.1|376650_377913_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
>prophage 23
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	387479	390110	2858867	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425358.1|387479_390110_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 24
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	400225	435823	2858867	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|400225_401230_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|401231_402257_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|402279_403419_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|403437_403698_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749802.1|403972_406252_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000595001.1|406454_408728_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
WP_160187015.1|408749_409268_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	9.5e-29
WP_001058583.1|409695_411885_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869979.1|411896_412349_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|412345_413221_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|413681_414944_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_070986910.1|414959_416726_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	26.9	6.4e-16
WP_001791215.1|417058_417187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682640.1|417186_417960_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102741.1|418120_419395_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.9	6.3e-106
WP_000704122.1|419479_419902_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|420001_420184_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000008061.1|420223_420370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985898.1|420606_421620_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|421929_423072_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|423072_424191_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567025.1|424872_425541_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283316.1|425542_428020_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000734077.1|428362_430993_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|431055_431316_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|431319_431748_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|431762_432071_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342267.1|432355_432994_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|432996_433920_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|433931_435200_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|435199_435823_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 25
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	452287	458451	2858867		Bacillus_phage(33.33%)	5	NA	NA
WP_000439692.1|452287_452749_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953291.1|452807_454955_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
WP_001282570.1|455011_455986_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_160187018.1|456030_456282_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|456627_458451_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 26
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	461886	464994	2858867		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|461886_463719_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119020.1|463854_464994_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	6.8e-27
>prophage 27
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	471463	472411	2858867		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117769.1|471463_472411_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	4.9e-47
>prophage 28
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	475465	489193	2858867	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|475465_476857_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001794939.1|477191_477815_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|477825_478644_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217253.1|478704_480504_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
WP_001283055.1|480727_481834_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624581.1|481964_482642_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683921.1|482644_483745_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
WP_001062173.1|483858_485205_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
WP_000924211.1|485214_486105_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001213908.1|486230_487016_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|487057_487921_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|487907_488318_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|488593_489193_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 29
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	495365	495989	2858867		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|495365_495989_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 30
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	501533	504345	2858867		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019697.1|501533_502880_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	2.1e-64
WP_000202178.1|502872_504345_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.1	1.4e-80
>prophage 31
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	511865	518435	2858867		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|511865_513203_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159866.1|513195_513426_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_160187019.1|513403_514285_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	3.4e-10
WP_001124985.1|514715_515168_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942216.1|515183_516863_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291540.1|517013_518435_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	6.6e-40
>prophage 32
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	525264	526671	2858867		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|525264_526671_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 33
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	534018	535503	2858867		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|534018_535503_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 34
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	541167	550665	2858867		Brevibacillus_phage(25.0%)	9	NA	NA
WP_000447733.1|541167_542055_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183424.1|542132_542639_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273367.1|542730_543462_+	segregation and condensation protein A	NA	NA	NA	NA	NA
WP_000368652.1|543454_543997_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|543989_544727_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|544859_545585_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987777.1|545565_547317_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_001574168.1|547568_548501_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000723488.1|548487_550665_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	40.5	1.7e-31
>prophage 35
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	553889	556568	2858867		Bacillus_phage(50.0%)	3	NA	NA
WP_001151997.1|553889_554138_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163814.1|554245_555199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902107.1|555188_556568_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
>prophage 36
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	565975	571116	2858867		Bacillus_phage(25.0%)	6	NA	NA
WP_001043863.1|565975_566248_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|566678_567251_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774679.1|567253_567979_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001819897.1|567995_568940_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|569031_569481_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001269937.1|569949_571116_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	1.5e-34
>prophage 37
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	574778	575354	2858867		Bacillus_virus(100.0%)	1	NA	NA
WP_000005208.1|574778_575354_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	4.6e-08
>prophage 38
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	578726	586233	2858867	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361536.1|578726_579929_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	1.4e-35
WP_000049917.1|579915_580887_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525060.1|580910_583604_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858795.1|583925_585218_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
WP_000362222.1|585546_586233_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 39
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	589924	590551	2858867		Bacillus_phage(100.0%)	1	NA	NA
WP_001108885.1|589924_590551_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 40
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	600015	600894	2858867		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|600015_600894_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 41
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	639458	649915	2858867	transposase	Staphylococcus_phage(50.0%)	14	NA	NA
WP_000282169.1|639458_640163_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.3	1.9e-11
WP_001814377.1|640407_640602_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001165814.1|640613_640865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404628.1|640902_642027_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995290.1|642042_642480_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|642903_643860_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|644059_644539_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166055.1|644553_645393_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	5.1e-48
WP_000159899.1|645478_646012_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|646004_646433_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473654.1|646444_646945_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|646944_647166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|647238_648186_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000342154.1|648424_649915_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	1.7e-22
>prophage 42
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	653323	655335	2858867		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|653323_653983_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166793.1|653979_655335_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 43
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	661703	662495	2858867		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|661703_662495_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 44
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	666029	671055	2858867	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|666029_667166_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001794103.1|667197_667827_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|667845_668115_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|668276_668585_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|668755_668956_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876206.1|669152_669554_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216956.1|669789_671055_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.0	4.0e-12
>prophage 45
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	678897	680499	2858867		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|678897_680499_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 46
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	684924	688378	2858867		Indivirus(50.0%)	3	NA	NA
WP_000079448.1|684924_685776_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
WP_000974850.1|685782_686424_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077549.1|686563_688378_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	2.3e-154
>prophage 47
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	691792	692494	2858867		Tupanvirus(100.0%)	1	NA	NA
WP_160187023.1|691792_692494_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	1.5e-13
>prophage 48
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	699975	702328	2858867		Acinetobacter_phage(100.0%)	2	NA	NA
WP_160187024.1|699975_700758_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	1.6e-27
WP_000604802.1|701761_702328_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.8	1.7e-23
>prophage 49
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	706646	710212	2858867	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_000283027.1|706646_707909_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	1.7e-95
WP_001123276.1|708056_708242_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_000277741.1|708565_710212_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 50
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	719481	723875	2858867		Bacillus_phage(50.0%)	2	NA	NA
WP_001289586.1|719481_721884_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
WP_001574370.1|721883_723875_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 51
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	729492	731139	2858867		Vibrio_phage(100.0%)	1	NA	NA
WP_001088983.1|729492_731139_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	1.9e-22
>prophage 52
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	734808	735930	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691309.1|734808_735930_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.1	2.1e-09
>prophage 53
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	740079	745735	2858867		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|740079_740703_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380738.1|741082_741946_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.2e-15
WP_001791425.1|742019_742124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688127.1|742120_743098_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085657.1|743254_743524_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|743977_744127_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000089857.1|744217_745735_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	2.7e-92
>prophage 54
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	755871	760147	2858867		Bacillus_phage(50.0%)	6	NA	NA
WP_000841344.1|755871_756405_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|756543_756732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624452.1|756844_757447_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670311.1|757443_758535_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_160187025.1|758538_759270_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001794121.1|759238_760147_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	9.8e-21
>prophage 55
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	764101	764437	2858867	head	Staphylococcus_phage(100.0%)	1	NA	NA
WP_077670291.1|764101_764437_-|head	phage head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	60.4	2.6e-27
>prophage 56
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	768374	774980	2858867	capsid,transposase	Staphylococcus_phage(80.0%)	8	NA	NA
WP_077670290.1|768374_769040_-|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	53.0	4.6e-60
WP_000585095.1|769100_769352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477487.1|770872_771289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121213.1|771715_772663_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	1.6e-183
WP_000006110.1|772874_773060_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_031788482.1|773452_773563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002343.1|774264_774471_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_001071312.1|774767_774980_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
>prophage 57
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	782363	789237	2858867	transposase	Staphylococcus_phage(50.0%)	8	NA	NA
WP_001251205.1|782363_783722_+	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	4.0e-42
WP_000681139.1|783726_785574_+	membrane protein	NA	NA	NA	NA	NA
WP_000247474.1|785563_786610_+	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000810443.1|786616_787207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001255381.1|787262_787619_+	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000746372.1|787727_788231_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078367270.1|788211_788748_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	1.3e-28
WP_001659797.1|789039_789237_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 58
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	794308	794785	2858867		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|794308_794785_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 59
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	800728	807210	2858867		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103747.1|800728_801547_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
WP_001077635.1|802021_802564_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516249.1|802569_804579_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	4.1e-59
WP_000073334.1|804591_807210_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	3.8e-41
>prophage 60
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	816624	817668	2858867		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|816624_817668_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 61
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	821867	827411	2858867		Bacillus_virus(33.33%)	4	NA	NA
WP_000664777.1|821867_823154_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089941.1|823153_824419_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293307.1|824449_825163_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042907377.1|825167_827411_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 62
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	832551	844366	2858867	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864182.1|832551_833523_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_160187026.1|833537_834455_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|834624_834975_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043642.1|835361_837479_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020856.1|837483_837801_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|837797_838082_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097463.1|838102_839278_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|839298_839766_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000139497.1|840055_844366_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 63
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	848639	849410	2858867		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|848639_849410_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 64
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	854184	867855	2858867	protease,tRNA	Erwinia_phage(16.67%)	11	NA	NA
WP_000379051.1|854184_855588_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	6.4e-27
WP_000072681.1|855653_856199_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015609.1|856195_857092_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	6.1e-31
WP_000195263.1|857509_858817_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|858972_861048_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000620184.1|861221_862094_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000672864.1|862265_863510_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041658.1|863537_864656_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110252.1|864882_865791_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.3e-17
WP_001020801.1|865812_866979_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176401.1|867087_867855_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 65
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	881239	883360	2858867		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|881239_881971_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|882086_882320_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|882625_883360_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 66
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	893730	895725	2858867		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|893730_895725_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 67
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	898872	899808	2858867	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|898872_899808_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 68
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	904817	907074	2858867		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|904817_906017_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|906232_906451_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368225.1|906450_907074_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
>prophage 69
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	910388	911000	2858867		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|910388_911000_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 70
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	914967	919578	2858867		Halovirus(33.33%)	4	NA	NA
WP_001190910.1|914967_916068_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	9.6e-63
WP_000767018.1|916069_917344_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|917361_918243_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178615.1|918270_919578_-	uracil transporter	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 71
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	924509	927263	2858867	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384706.1|924509_927263_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	2.1e-90
>prophage 72
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	946619	946817	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245800.1|946619_946817_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	1.2e-19
>prophage 73
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	955728	957907	2858867	transposase	Staphylococcus_virus(100.0%)	2	NA	NA
WP_160187031.1|955728_957378_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.5	1.3e-289
WP_001801391.1|957679_957907_-	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.9e-18
>prophage 74
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	961367	961718	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000669541.1|961367_961718_-	complement inhibitor SCIN-C	NA	A7TWS0	Staphylococcus_phage	50.0	1.9e-20
>prophage 75
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	973151	977709	2858867		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|973151_973466_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249264.1|973638_975987_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_000161937.1|975996_977709_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 76
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	982587	983646	2858867	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|982587_983646_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 77
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	995625	998536	2858867		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|995625_996108_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263793.1|996109_996652_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|996721_997111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|997113_997368_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757584.1|997606_998536_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	6.5e-12
>prophage 78
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1020177	1023820	2858867		Mycoplasma_phage(50.0%)	4	NA	NA
WP_000433551.1|1020177_1021272_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020627.1|1021284_1021824_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000455584.1|1021967_1022243_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|1022413_1023820_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
>prophage 79
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1028461	1029013	2858867		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957036.1|1028461_1029013_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 80
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1035127	1039507	2858867		Bacillus_virus(50.0%)	5	NA	NA
WP_001289622.1|1035127_1035361_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	1.3e-09
WP_000040041.1|1035597_1037316_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1037318_1037585_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505964.1|1037738_1038281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685075.1|1038334_1039507_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.6	1.5e-74
>prophage 81
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1042686	1057449	2858867		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921981.1|1042686_1044087_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.4e-10
WP_000273254.1|1044079_1044886_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101912.1|1045153_1046401_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709288.1|1046422_1047901_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
WP_000238673.1|1047915_1048482_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000030814.1|1048484_1049513_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
WP_000483716.1|1049505_1050990_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.4	8.5e-46
WP_000032734.1|1050968_1053158_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
WP_000666808.1|1053150_1053822_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_160187034.1|1053823_1054087_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174050.1|1054086_1054791_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
WP_001010391.1|1054794_1055919_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861576.1|1055905_1056388_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225845.1|1056588_1057449_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
>prophage 82
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1067628	1071402	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160187036.1|1067628_1071402_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFB0	Staphylococcus_phage	38.0	1.1e-54
>prophage 83
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1075067	1105414	2858867	holin,protease,bacteriocin	Staphylococcus_phage(16.67%)	33	NA	NA
WP_000676568.1|1075067_1076141_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	31.7	1.1e-15
WP_001088791.1|1076222_1077404_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284455.1|1077441_1077771_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|1078006_1078828_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150205.1|1078820_1079624_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526678.1|1079610_1081284_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001814117.1|1081270_1082482_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_072357920.1|1082585_1082663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070967.1|1082813_1083752_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620943.1|1083803_1084355_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001794164.1|1084444_1084735_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.6e-07
WP_001794249.1|1084798_1084930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081338.1|1084976_1085936_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|1086426_1086783_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000719183.1|1086871_1088353_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000410718.1|1088358_1088646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791476.1|1088986_1089277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571191.1|1089364_1090006_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	5.0e-19
WP_000873929.1|1090002_1090323_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870819.1|1090325_1092290_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001794574.1|1092333_1092606_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001790623.1|1092615_1092717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119695.1|1093255_1093333_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_001033867.1|1093633_1094236_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000214898.1|1094250_1094427_-	YkvS family protein	NA	NA	NA	NA	NA
WP_000668820.1|1094625_1095612_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000876825.1|1095692_1095911_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000287265.1|1096120_1096690_+	competence protein ComK	NA	NA	NA	NA	NA
WP_000414169.1|1097178_1098690_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000021872.1|1098828_1100187_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_001794169.1|1100203_1102528_-|protease	serine protease	protease	W5SAB9	Pithovirus	26.8	4.0e-10
WP_000928413.1|1102746_1103550_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049957.1|1103851_1105414_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
>prophage 84
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1126634	1128443	2858867		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082722.1|1126634_1128443_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
>prophage 85
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1132393	1146236	2858867	transposase	Bacillus_virus(28.57%)	12	NA	NA
WP_160187039.1|1132393_1134040_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.9	3.7e-292
WP_094409958.1|1134335_1135902_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_001180271.1|1135991_1136873_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001574526.1|1136884_1137535_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000427776.1|1137527_1138508_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001067041.1|1138510_1139497_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
WP_073392975.1|1139547_1141017_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_134521521.1|1141131_1142079_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	1.2e-183
WP_000517177.1|1142070_1142337_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000197096.1|1142548_1144204_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000786746.1|1144222_1145164_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_160187040.1|1145153_1146236_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.4e-18
>prophage 86
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1154830	1161641	2858867		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1154830_1155976_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047061.1|1156086_1156956_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353950.1|1157014_1159624_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044234.1|1159826_1161641_-	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	8.8e-37
>prophage 87
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1164906	1172366	2858867	transposase	Staphylococcus_virus(50.0%)	4	NA	NA
WP_045178729.1|1164906_1166553_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.3	2.4e-291
WP_000902813.1|1166929_1167319_-	YisL family protein	NA	NA	NA	NA	NA
WP_000670753.1|1167644_1168547_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_160187041.1|1168712_1172366_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	1.0e-23
>prophage 88
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1182521	1189571	2858867		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185311.1|1182521_1183451_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.5	1.8e-38
WP_000138487.1|1183845_1185090_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167321.1|1185198_1186389_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.3e-33
WP_000838047.1|1186696_1187824_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1188185_1188563_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1188977_1189571_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 89
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1199505	1203133	2858867		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009683.1|1199505_1200981_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	1.2e-47
WP_000046076.1|1201111_1202320_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1202773_1203133_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 90
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1207176	1209845	2858867		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1207176_1208391_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129645.1|1208387_1209845_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
>prophage 91
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1223055	1226578	2858867		environmental_halophage(50.0%)	3	NA	NA
WP_000807671.1|1223055_1224297_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
WP_000205572.1|1224411_1225719_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1225816_1226578_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 92
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1230527	1231553	2858867		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571209.1|1230527_1231553_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
>prophage 93
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1234662	1239840	2858867		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1234662_1235019_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147955.1|1235162_1235483_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1235632_1236172_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150036.1|1236254_1236971_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	6.8e-17
WP_000974455.1|1237118_1237541_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1237939_1238434_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255545.1|1238589_1239207_+	amino acid transporter	NA	NA	NA	NA	NA
WP_016187137.1|1239279_1239840_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 94
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1243245	1244489	2858867		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1243245_1243446_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001574556.1|1243802_1244489_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 95
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1253621	1262378	2858867		Staphylococcus_phage(50.0%)	8	NA	NA
WP_001574560.1|1253621_1254350_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	4.8e-18
WP_000999096.1|1254637_1255252_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_001085185.1|1256217_1256682_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_160187043.1|1256703_1259076_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.6	5.6e-92
WP_001165967.1|1259109_1259850_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1259978_1260212_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785248.1|1260278_1260737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1261073_1262378_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 96
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1273066	1278882	2858867		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1273066_1273654_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1274222_1275167_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1275275_1276271_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369719.1|1276267_1277179_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134960.1|1277946_1278882_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	8.4e-84
>prophage 97
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1283279	1286126	2858867		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_160187044.1|1283279_1286126_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 98
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1289444	1290284	2858867		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749385.1|1289444_1290284_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 99
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1295389	1303501	2858867	transposase	Streptococcus_phage(50.0%)	8	NA	NA
WP_000121211.1|1295389_1296337_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000617735.1|1296496_1297069_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001057973.1|1297129_1297804_-	ComF family protein	NA	NA	NA	NA	NA
WP_000370984.1|1297796_1298879_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.8	1.2e-44
WP_000686342.1|1299242_1300109_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192947.1|1300252_1300894_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|1301057_1302113_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1302430_1303501_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 100
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1312778	1335749	2858867		uncultured_Caudovirales_phage(35.71%)	18	NA	NA
WP_000616865.1|1312778_1313540_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
WP_001245566.1|1313536_1314493_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
WP_000876311.1|1314479_1315451_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
WP_000562498.1|1315827_1316799_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1316918_1319024_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1318986_1319385_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068491.1|1320186_1321053_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930016.1|1321072_1321573_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_000193750.1|1321912_1323418_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031788440.1|1323495_1323597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429002.1|1323687_1324605_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
WP_000197262.1|1325156_1325699_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663016.1|1325857_1326916_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
WP_000180987.1|1327155_1328670_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589241.1|1328662_1329640_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-25
WP_000983677.1|1329860_1331642_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525101.1|1331653_1333537_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	8.8e-56
WP_000098285.1|1333808_1335749_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 101
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1338888	1348734	2858867		Pandoravirus(12.5%)	12	NA	NA
WP_001217804.1|1338888_1340040_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
WP_000604508.1|1340023_1340617_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_000446724.1|1340967_1341636_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_160187045.1|1341637_1342057_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	4.9e-07
WP_001062968.1|1342060_1342774_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637686.1|1342872_1343457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093552.1|1343736_1344177_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1344518_1344992_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1344966_1345653_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244416.1|1345652_1346708_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702776.1|1346779_1347763_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.0	7.3e-62
WP_000931237.1|1347894_1348734_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 102
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1355896	1406405	2858867	transposase,bacteriocin,tRNA	Staphylococcus_phage(31.25%)	52	NA	NA
WP_001107240.1|1355896_1356379_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000216727.1|1356552_1357005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041284.1|1357301_1358468_-	multidrug efflux MFS transporter NorA	NA	NA	NA	NA	NA
WP_000776010.1|1358677_1359100_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001191871.1|1359286_1359904_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_000154465.1|1359900_1360185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952030.1|1360339_1361713_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.2e-46
WP_000005632.1|1361798_1363352_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_000180420.1|1363634_1363922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435104.1|1363956_1364865_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_000794424.1|1364967_1365894_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001283444.1|1366120_1366564_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_160187047.1|1366690_1368364_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-11
WP_160187048.1|1368360_1369992_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	28.2	2.3e-12
WP_000469883.1|1370210_1371086_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358501.1|1371257_1371941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148821.1|1371943_1372402_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1372403_1372970_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
WP_000638614.1|1373064_1373607_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000545116.1|1373686_1373986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733427.1|1374123_1374513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259673.1|1374579_1375023_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000842865.1|1375149_1375839_+	DUF1129 family protein	NA	NA	NA	NA	NA
WP_001105942.1|1376501_1377176_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
WP_000361064.1|1377270_1377648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159128.1|1377885_1378251_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	47.8	8.5e-24
WP_160187049.1|1378243_1380424_+	cadmium-translocating P-type ATPase CadA	NA	E4ZFI9	Streptococcus_phage	63.7	9.3e-251
WP_000277738.1|1380786_1382433_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.4	1.0e-289
WP_000277154.1|1382499_1383933_-	multi-copper oxidase Mco	NA	NA	NA	NA	NA
WP_000069452.1|1383947_1385993_-	copper-translocating P-type ATPase CopB	NA	E4ZFI9	Streptococcus_phage	29.2	2.3e-65
WP_000690626.1|1386259_1386835_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.9e-42
WP_000838599.1|1387169_1388165_-	YeiH family protein	NA	NA	NA	NA	NA
WP_000377738.1|1388289_1389111_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791613.1|1389412_1389505_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000397995.1|1389733_1390057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998976.1|1391273_1391699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002795.1|1393780_1393876_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000761344.1|1394090_1394432_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000145511.1|1394518_1395379_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000273007.1|1395743_1396244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001582045.1|1396310_1396637_-	recombinase	NA	NA	NA	NA	NA
WP_001643491.1|1396576_1396954_-	recombinase	NA	NA	NA	NA	NA
WP_000277741.1|1397108_1398755_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_000593106.1|1399116_1399743_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.1e-22
WP_000831610.1|1399754_1400066_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000713732.1|1400069_1402004_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000726502.1|1402078_1402372_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000358995.1|1402751_1403147_-	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
WP_000153633.1|1403164_1404454_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.1	5.6e-187
WP_000120605.1|1404453_1404768_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4PQT4	Staphylococcus_phage	73.1	4.7e-39
WP_001035802.1|1405483_1405696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105942.1|1405730_1406405_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
>prophage 103
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1411709	1412183	2858867		Pandoravirus(100.0%)	1	NA	NA
WP_000833480.1|1411709_1412183_-	cupin	NA	A0A291AU44	Pandoravirus	38.7	4.6e-14
>prophage 104
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1417432	1418230	2858867		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000731642.1|1417432_1418230_+	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	35.8	2.1e-06
>prophage 105
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1422951	1423713	2858867		Planktothrix_phage(100.0%)	1	NA	NA
WP_000153733.1|1422951_1423713_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.2e-33
>prophage 106
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1428079	1429123	2858867		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030763.1|1428079_1429123_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.1	3.8e-16
>prophage 107
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1435645	1436443	2858867		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1435645_1436443_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 108
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1439670	1443629	2858867		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1439670_1441398_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793055.1|1441818_1443114_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1443230_1443629_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 109
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1450562	1451306	2858867		Indivirus(100.0%)	1	NA	NA
WP_000894458.1|1450562_1451306_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-12
>prophage 110
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1464171	1464732	2858867	integrase	Streptococcus_phage(100.0%)	1	1458325:1458339	1468315:1468329
1458325:1458339	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044968.1|1464171_1464732_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.9	4.3e-19
WP_001044968.1|1464171_1464732_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.9	4.3e-19
1468315:1468329	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 111
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1477758	1481112	2858867		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1477758_1478769_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1479267_1479789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180233.1|1479816_1481112_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 112
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1488643	1489966	2858867		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860607.1|1488643_1489966_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	8.2e-109
>prophage 113
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1501270	1501927	2858867		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|1501270_1501927_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 114
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1505594	1508916	2858867		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000382588.1|1505594_1506971_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	6.7e-21
WP_000347064.1|1507515_1508916_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.0	9.4e-55
>prophage 115
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1532420	1533083	2858867		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1532420_1533083_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 116
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1539671	1540859	2858867		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250820.1|1539671_1540859_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	1.5e-45
>prophage 117
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1543886	1554840	2858867		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1543886_1545968_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1546090_1546561_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1546626_1547040_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1547137_1547392_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001819727.1|1547528_1551125_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
WP_000918664.1|1551288_1554840_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	6.1e-50
>prophage 118
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1558523	1563306	2858867	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1558523_1559072_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1559084_1559267_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001791441.1|1559322_1559466_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872867.1|1559580_1560150_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664740.1|1560230_1560755_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1560754_1561501_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370181.1|1561508_1561913_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631982.1|1561905_1563306_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 119
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1569317	1571774	2858867	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1569317_1571774_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 120
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1590856	1601314	2858867	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1590856_1592344_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_016186812.1|1592396_1592489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613720.1|1592882_1593359_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154303.1|1593355_1593721_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167936.1|1593698_1594502_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	6.7e-21
WP_000057594.1|1594717_1595650_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1595828_1596710_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1597123_1599217_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1599474_1600014_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176721.1|1600018_1601314_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.3	8.2e-13
>prophage 121
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1610570	1613035	2858867		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1610570_1611536_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252515.1|1611682_1613035_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	1.1e-23
>prophage 122
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1618919	1622017	2858867	tRNA	Hokovirus(50.0%)	2	NA	NA
WP_001051120.1|1618919_1620893_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
WP_000279925.1|1621177_1622017_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 123
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1625923	1626541	2858867		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1625923_1626541_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 124
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1635385	1637083	2858867		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109044.1|1635385_1637083_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 125
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1653720	1659957	2858867		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170274.1|1653720_1654725_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.1	1.4e-23
WP_000825534.1|1655058_1655901_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467992.1|1655937_1656597_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569267.1|1656600_1657626_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.4e-31
WP_001036658.1|1657916_1659059_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_000634110.1|1659051_1659957_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	7.2e-48
>prophage 126
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1682507	1685289	2858867		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072632.1|1682507_1683740_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	2.7e-45
WP_000028598.1|1683732_1685289_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	1.7e-286
>prophage 127
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1696776	1697103	2858867	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001799349.1|1696776_1697103_+|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	85.4	4.3e-11
>prophage 128
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1700410	1703443	2858867		Hokovirus(50.0%)	2	NA	NA
WP_000424963.1|1700410_1701952_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1701976_1703443_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 129
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1712543	1714067	2858867		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930503.1|1712543_1714067_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.2	5.5e-40
>prophage 130
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1723219	1744120	2858867	coat,integrase,terminase	Staphylococcus_phage(82.61%)	30	1722496:1722513	1737493:1737510
1722496:1722513	attL	ATATTATTGTTCTTCTTT	NA	NA	NA	NA
WP_000813311.1|1723219_1723732_-	hypothetical protein	NA	Q4ZE83	Staphylococcus_phage	100.0	1.4e-69
WP_073392942.1|1723849_1724287_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	58.2	9.8e-27
WP_000801980.1|1724428_1725397_-	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	2.7e-24
WP_001293071.1|1725673_1726243_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	4.6e-101
WP_001656917.1|1726239_1726452_-	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	97.1	5.4e-31
WP_000771361.1|1726583_1727111_-|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	100.0	6.8e-91
WP_000214170.1|1727163_1727817_-	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	99.5	7.6e-116
WP_001288442.1|1727847_1728192_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	91.7	1.3e-50
WP_160187057.1|1728899_1729541_-	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	91.5	2.0e-108
WP_001804819.1|1729542_1729806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039165.1|1729807_1730170_-	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	95.8	4.6e-62
WP_053040304.1|1730448_1731918_-	virulence-associated protein E	NA	A0A1W6JQD6	Staphylococcus_phage	96.7	1.7e-280
WP_160187058.1|1731934_1732804_-	mobile element-associated protein	NA	A0A1W6JQL5	Staphylococcus_phage	96.2	1.8e-160
WP_001103939.1|1732867_1733185_-	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	57.0	3.2e-19
WP_001058492.1|1733187_1733397_-	hypothetical protein	NA	Q4ZE76	Staphylococcus_phage	95.7	7.7e-30
WP_000784885.1|1733389_1733536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053040301.1|1733547_1733820_-	winged helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	96.7	1.4e-44
WP_053040300.1|1733820_1734033_-	helix-turn-helix transcriptional regulator	NA	Q4ZE78	Staphylococcus_phage	97.1	4.4e-33
WP_000142630.1|1734182_1734917_+	helix-turn-helix transcriptional regulator	NA	Q4ZE79	Staphylococcus_phage	98.4	8.5e-132
WP_123090135.1|1735215_1736430_+|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	96.5	1.5e-221
WP_000400841.1|1736544_1737264_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	29.8	3.7e-23
WP_000897044.1|1737495_1737738_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
1737493:1737510	attR	ATATTATTGTTCTTCTTT	NA	NA	NA	NA
WP_000934799.1|1737789_1738293_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1738313_1738610_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1738853_1739045_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1739130_1740228_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1740239_1740443_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373076.1|1740472_1741354_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001573568.1|1741507_1742353_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655687.1|1743016_1744120_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 131
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1754041	1754884	2858867		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209478.1|1754041_1754884_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	4.5e-12
>prophage 132
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1776293	1779028	2858867		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_160187062.1|1776293_1777316_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	6.7e-10
WP_001191936.1|1777293_1778238_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449073.1|1778227_1779028_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	44.4	1.5e-41
>prophage 133
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1796053	1799017	2858867	transposase	Staphylococcus_prophage(50.0%)	4	NA	NA
WP_000121211.1|1796053_1797001_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_031825880.1|1797100_1798051_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_011446983.1|1798040_1798181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160187064.1|1798339_1799017_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	7.1e-32
>prophage 134
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1810359	1814808	2858867		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160187065.1|1810359_1814808_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 135
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1825412	1827074	2858867		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000570080.1|1825412_1826072_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	5.8e-23
WP_000736790.1|1826123_1827074_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 136
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1835880	1837317	2858867		Pandoravirus(100.0%)	1	NA	NA
WP_000163995.1|1835880_1837317_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	1.3e-30
>prophage 137
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1840958	1849443	2858867	transposase,holin	Staphylococcus_prophage(33.33%)	7	NA	NA
WP_000121211.1|1840958_1841906_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000607067.1|1842906_1843608_-|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_001792906.1|1843600_1844044_-|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_000645453.1|1844156_1844897_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_000925395.1|1844899_1846639_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	2.0e-62
WP_000608835.1|1846904_1847579_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975347.1|1847718_1849443_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 138
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1859312	1860356	2858867		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645611.1|1859312_1860356_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	6.0e-14
>prophage 139
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1867572	1869102	2858867		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1867572_1869102_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 140
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1878787	1880293	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160187067.1|1878787_1880293_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 141
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1891254	1896613	2858867		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1891254_1893504_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837114.1|1894091_1895060_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127979.1|1895056_1896613_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 142
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1906924	1908983	2858867		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|1906924_1908022_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166911.1|1908404_1908983_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	43.0	1.6e-13
>prophage 143
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1916794	1918387	2858867		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067363.1|1916794_1918387_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	5.4e-22
>prophage 144
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1934479	1935664	2858867		Klosneuvirus(100.0%)	1	NA	NA
WP_001084444.1|1934479_1935664_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	2.4e-35
>prophage 145
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1940522	1950806	2858867		Tupanvirus(50.0%)	3	NA	NA
WP_000605273.1|1940522_1947698_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	3.4e-68
WP_000826855.1|1948144_1949395_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706134.1|1949780_1950806_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 146
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1954342	1957341	2858867		Bacillus_virus(50.0%)	4	NA	NA
WP_160187069.1|1954342_1955083_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.5e-39
WP_000171926.1|1955424_1955937_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356967.1|1956116_1956320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013476.1|1956381_1957341_-	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	2.8e-10
>prophage 147
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1960682	1963167	2858867		Catovirus(50.0%)	2	NA	NA
WP_000723445.1|1960682_1961828_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
WP_000779509.1|1961904_1963167_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	2.5e-22
>prophage 148
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1970184	1976749	2858867		Catovirus(50.0%)	6	NA	NA
WP_000413167.1|1970184_1971309_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	3.9e-128
WP_001028294.1|1971312_1972422_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1972434_1973463_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940769.1|1973452_1975276_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.4	3.0e-29
WP_000565301.1|1975295_1976060_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037317.1|1976062_1976749_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	8.2e-28
>prophage 149
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1980772	1981948	2858867		Clostridium_phage(100.0%)	1	NA	NA
WP_000469818.1|1980772_1981948_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.2e-30
>prophage 150
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1987406	1988180	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078278.1|1987406_1988180_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	6.4e-13
>prophage 151
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	1996066	1996666	2858867		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1996066_1996666_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 152
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2001600	2006695	2858867		Catovirus(50.0%)	5	NA	NA
WP_001793810.1|2001600_2002581_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.3	1.3e-47
WP_000183771.1|2002915_2003692_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414632.1|2003902_2004529_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|2004724_2005489_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223717.1|2005492_2006695_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.3	5.1e-09
>prophage 153
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2014961	2019171	2858867		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|2014961_2015942_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045124.1|2016172_2017165_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000925002.1|2017180_2018176_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136645.1|2018172_2019171_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.6e-14
>prophage 154
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2051219	2056554	2858867	transposase	Acidithiobacillus_phage(33.33%)	5	NA	NA
WP_000649665.1|2051219_2052920_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.8	4.1e-20
WP_001794509.1|2053209_2053584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|2053769_2054717_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000370465.1|2054721_2055237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088356251.1|2055424_2056554_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
>prophage 155
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2062434	2072430	2858867		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2062434_2063235_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104171.1|2063622_2064411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060146.1|2064411_2065746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871610.1|2065738_2067565_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.1e-30
WP_000101976.1|2067577_2068279_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2069468_2070752_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2071029_2072430_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 156
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2079112	2088148	2858867	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884337.1|2079112_2080399_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177483.1|2080776_2082291_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	4.4e-90
WP_000449218.1|2082616_2083429_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819098.1|2083516_2086177_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	4.6e-119
WP_000255583.1|2086213_2088148_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
>prophage 157
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2098235	2101535	2858867		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742840.1|2098235_2099075_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.4	1.4e-05
WP_000491382.1|2099569_2099923_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2099990_2100386_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054111.1|2100638_2101208_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	34.8	2.8e-05
WP_001059079.1|2101334_2101535_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 158
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2107328	2108087	2858867		Cedratvirus(100.0%)	1	NA	NA
WP_160187071.1|2107328_2108087_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	A0A285PWH2	Cedratvirus	32.4	2.2e-18
>prophage 159
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2125791	2127504	2858867		Planktothrix_phage(100.0%)	1	NA	NA
WP_160187074.1|2125791_2127504_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.5	7.1e-20
>prophage 160
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2133132	2134146	2858867		Faustovirus(100.0%)	1	NA	NA
WP_160187075.1|2133132_2134146_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	21.9	1.8e-07
>prophage 161
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2146537	2147230	2858867		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185860.1|2146537_2147230_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 162
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2171105	2172965	2858867		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125631.1|2171105_2172965_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 163
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2198658	2200409	2858867		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143418.1|2198658_2199546_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	7.4e-05
WP_000923764.1|2199653_2200409_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-31
>prophage 164
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2203846	2204344	2858867		Canarypox_virus(100.0%)	1	NA	NA
WP_001065267.1|2203846_2204344_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	2.4e-21
>prophage 165
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2209397	2211781	2858867		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071721.1|2209397_2211248_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.9	1.3e-234
WP_000173336.1|2211244_2211781_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.5	1.1e-40
>prophage 166
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2216657	2226768	2858867	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2216657_2218367_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2218644_2218857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028789.1|2219136_2219580_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172333.1|2219773_2221372_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.6	2.6e-77
WP_001793854.1|2221431_2221632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2222058_2223555_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031407.1|2223747_2224638_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237625.1|2224760_2225177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030061.1|2225430_2226768_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	6.7e-18
>prophage 167
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2254923	2258123	2858867		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751265.1|2254923_2255625_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
WP_000379825.1|2256311_2258123_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 168
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2266568	2270816	2858867		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161364.1|2266568_2267567_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076662.1|2267656_2267863_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024137.1|2268407_2270816_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
>prophage 169
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2280057	2283047	2858867	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001063330.1|2280057_2282163_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.5	6.9e-118
WP_000262597.1|2282525_2283047_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	2.4e-27
>prophage 170
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2289471	2295854	2858867		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062662.1|2289471_2291211_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473682.1|2291510_2293577_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2293956_2294367_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2294408_2294765_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228158.1|2294885_2295854_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	3.1e-12
>prophage 171
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2304678	2305671	2858867		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161541.1|2304678_2305671_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	9.7e-38
>prophage 172
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2315087	2315783	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382892.1|2315087_2315783_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	2.0e-37
>prophage 173
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2334373	2341549	2858867		Bacillus_phage(66.67%)	6	NA	NA
WP_000721330.1|2334373_2335240_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	4.4e-79
WP_001573690.1|2335366_2335675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2335818_2336085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001793882.1|2336368_2338177_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.5	1.0e-93
WP_000755954.1|2338293_2338686_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000088715.1|2338687_2341549_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	1.2e-27
>prophage 174
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2345992	2346688	2858867		Bacillus_phage(100.0%)	1	NA	NA
WP_000217452.1|2345992_2346688_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	5.1e-09
>prophage 175
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2352364	2353183	2858867		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824929.1|2352364_2353183_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.8	1.9e-10
>prophage 176
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2361121	2362679	2858867		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173876.1|2361121_2361937_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-14
WP_000590515.1|2361929_2362679_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 177
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2368912	2373338	2858867		Bacillus_phage(50.0%)	3	NA	NA
WP_000923514.1|2368912_2369575_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
WP_000026190.1|2370736_2371924_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700902.1|2371985_2373338_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	3.0e-13
>prophage 178
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2376731	2377958	2858867		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948990.1|2376731_2377958_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 179
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2396334	2402541	2858867		Bacillus_phage(66.67%)	5	NA	NA
WP_001176855.1|2396334_2397477_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
WP_000779351.1|2397744_2398131_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2398264_2398372_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_160187084.1|2399019_2400783_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.6e-35
WP_000486505.1|2400807_2402541_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.5e-30
>prophage 180
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2406002	2411756	2858867		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971554.1|2406002_2407118_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	7.1e-21
WP_000286868.1|2407128_2407821_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200947.1|2407831_2408299_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_001056917.1|2408350_2409328_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	2.4e-142
WP_000916697.1|2409329_2410277_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	2.1e-138
WP_000594516.1|2410826_2411756_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.4	1.5e-120
>prophage 181
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2419649	2420381	2858867		Bacillus_virus(100.0%)	1	NA	NA
WP_000615467.1|2419649_2420381_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.3e-23
>prophage 182
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2437245	2438805	2858867		Escherichia_phage(100.0%)	1	NA	NA
WP_000692650.1|2437245_2438805_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	3.4e-21
>prophage 183
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2449535	2451182	2858867	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277741.1|2449535_2451182_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 184
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2462123	2463158	2858867		Bacillus_virus(100.0%)	1	NA	NA
WP_000655979.1|2462123_2463158_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 185
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2473622	2480179	2858867		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000388431.1|2473622_2474351_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-28
WP_000372857.1|2474484_2475048_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793166.1|2475224_2475680_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000977031.1|2475676_2476120_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000477322.1|2476282_2477656_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.3	1.1e-12
WP_000249492.1|2477648_2478323_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	44.7	8.0e-52
WP_000761409.1|2478458_2479514_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229922.1|2479513_2480179_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	7.2e-37
>prophage 186
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2483916	2485125	2858867		Salmonella_phage(100.0%)	1	NA	NA
WP_000999130.1|2483916_2485125_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.5	3.0e-33
>prophage 187
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2497781	2498681	2858867		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524842.1|2497781_2498681_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 188
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2506034	2506454	2858867		Bacillus_phage(100.0%)	1	NA	NA
WP_000920241.1|2506034_2506454_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	7.7e-37
>prophage 189
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2512145	2513027	2858867		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730056.1|2512145_2513027_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	1.7e-62
>prophage 190
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2520906	2521542	2858867		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285452.1|2520906_2521542_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.6	7.1e-10
>prophage 191
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2534546	2538813	2858867		Staphylococcus_phage(50.0%)	4	NA	NA
WP_072460394.1|2534546_2535185_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
WP_000684154.1|2535793_2536918_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_000417008.1|2537009_2537963_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.2	5.8e-32
WP_000737700.1|2538321_2538813_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 192
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2542733	2543543	2858867		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717395.1|2542733_2543543_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 193
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2562515	2563121	2858867		Pithovirus(100.0%)	1	NA	NA
WP_000913006.1|2562515_2563121_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 194
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2575088	2578256	2858867		Leptospira_phage(100.0%)	1	NA	NA
WP_000592290.1|2575088_2578256_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	4.3e-63
>prophage 195
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2601435	2605045	2858867	transposase	Paenibacillus_phage(33.33%)	3	NA	NA
WP_094409958.1|2601435_2603003_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000389651.1|2603378_2604188_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
WP_000586768.1|2604184_2605045_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 196
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2608086	2616649	2858867		Mycobacterium_phage(33.33%)	8	NA	NA
WP_000204271.1|2608086_2609523_+	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.2	5.5e-58
WP_000136272.1|2609771_2609951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791584.1|2610600_2610783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130145.1|2611252_2612917_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_000179061.1|2612953_2613658_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769709.1|2614048_2614474_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044369.1|2614768_2615584_+	hydrolase	NA	NA	NA	NA	NA
WP_001044451.1|2615794_2616649_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	34.8	1.3e-06
>prophage 197
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2620027	2623090	2858867		Staphylococcus_phage(50.0%)	5	NA	NA
WP_001015495.1|2620027_2620876_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.3e-43
WP_001573519.1|2621096_2621222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293423.1|2621176_2621470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333457.1|2621483_2622092_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_001573518.1|2622349_2623090_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.3	7.3e-14
>prophage 198
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2629410	2630823	2858867		Pandoravirus(100.0%)	1	NA	NA
WP_000169223.1|2629410_2630823_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	5.0e-48
>prophage 199
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2634791	2636354	2858867		Vibrio_phage(100.0%)	1	NA	NA
WP_000792332.1|2634791_2636354_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	3.5e-18
>prophage 200
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2646557	2647526	2858867		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2646557_2647526_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 201
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2663326	2664235	2858867		Klosneuvirus(100.0%)	1	NA	NA
WP_000162591.1|2663326_2664235_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.7	1.2e-26
>prophage 202
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2681477	2688895	2858867	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000334466.1|2681477_2683283_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
WP_000908186.1|2683514_2684297_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.7e-09
WP_000370937.1|2684364_2685222_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001792784.1|2685880_2686039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073392962.1|2686718_2686823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277709.1|2687248_2688895_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
>prophage 203
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2697401	2702897	2858867	transposase	Clostridium_phage(33.33%)	5	NA	NA
WP_000070866.1|2697401_2697845_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_094409958.1|2697950_2699518_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000160304.1|2699628_2700339_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083335.1|2700653_2701316_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242308.1|2701595_2702897_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	1.4e-132
>prophage 204
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2710830	2712441	2858867		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2710830_2712441_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 205
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2720244	2727997	2858867		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2720244_2720844_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460244.1|2720844_2721921_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248730.1|2721907_2722744_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001801520.1|2722776_2723874_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|2723870_2724290_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654191.1|2724396_2724921_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2724947_2726186_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2726213_2726843_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723407.1|2726866_2727997_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.1	1.0e-27
>prophage 206
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2738714	2739110	2858867		Bacillus_phage(100.0%)	1	NA	NA
WP_000932696.1|2738714_2739110_+	single-stranded DNA-binding protein	NA	A0A1B1PAE7	Bacillus_phage	36.8	3.0e-14
>prophage 207
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2745219	2745867	2858867		Moumouvirus(100.0%)	1	NA	NA
WP_001187612.1|2745219_2745867_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	4.7e-09
>prophage 208
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2754059	2755580	2858867		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178940.1|2754059_2755580_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 209
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2761254	2763282	2858867		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546609.1|2761254_2763282_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	3.9e-25
>prophage 210
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2768432	2771816	2858867		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621176.1|2768432_2768795_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2769143_2770145_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2770263_2770590_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190825.1|2770591_2771071_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041107.1|2771045_2771816_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 211
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2785929	2790653	2858867		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094572.1|2785929_2787459_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.6	9.4e-08
WP_072399972.1|2787488_2788508_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2788629_2788884_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047828.1|2788883_2790653_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	4.1e-63
>prophage 212
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2794413	2808488	2858867	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159047.1|2794413_2795439_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	3.1e-63
WP_000106312.1|2795752_2797363_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.4	5.1e-20
WP_001791590.1|2797457_2797586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602046.1|2797730_2799659_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.1	3.2e-53
WP_001283612.1|2799911_2800547_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_073392939.1|2800903_2801932_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581078.1|2801991_2802216_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052261.1|2802424_2803675_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	9.0e-41
WP_000790325.1|2803858_2804809_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791588.1|2804957_2806442_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	5.2e-19
WP_001253292.1|2806438_2807398_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|2807771_2808488_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 213
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2815626	2829970	2858867	coat,integrase,terminase	Staphylococcus_phage(68.42%)	22	2817586:2817605	2832320:2832339
WP_000917289.1|2815626_2815911_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240651.1|2815986_2817603_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
2817586:2817605	attL	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_000179345.1|2817671_2818844_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	98.2	3.5e-220
WP_000620857.1|2818857_2819532_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000153640.1|2819704_2819923_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000481967.1|2819927_2820245_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000708433.1|2820241_2820397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231378.1|2820381_2820585_+	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	97.0	7.5e-30
WP_000403839.1|2820586_2820970_+	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	9.7e-63
WP_001103930.1|2820970_2821288_+	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	58.2	1.6e-18
WP_001002721.1|2821351_2822221_+	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	99.3	6.0e-169
WP_000447451.1|2822234_2823944_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	100.0	0.0e+00
WP_000356937.1|2824255_2824636_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	100.0	6.9e-69
WP_001019766.1|2824632_2825274_+	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	94.8	3.5e-113
WP_001190608.1|2825809_2826151_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	98.2	7.1e-57
WP_000846285.1|2826162_2826741_+	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
WP_000448775.1|2826758_2826977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771368.1|2827027_2827555_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000358778.1|2827557_2827899_+	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	100.0	1.7e-58
WP_001293073.1|2827895_2828465_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	3.5e-101
WP_001035597.1|2828619_2829324_-	toxic shock syndrome toxin TSST-1	NA	NA	NA	NA	NA
WP_000812237.1|2829742_2829970_+	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	47.4	1.9e-13
2832320:2832339	attR	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
>prophage 214
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2833054	2833682	2858867		Staphylococcus_phage(100.0%)	2	NA	NA
WP_001573769.1|2833054_2833351_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
WP_001573771.1|2833340_2833682_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
>prophage 215
NZ_CP047778	Staphylococcus aureus strain UP_1572 chromosome, complete genome	2858867	2837660	2858396	2858867	integrase	Staphylococcus_phage(86.05%)	43	2833802:2833817	2854127:2854142
2833802:2833817	attL	TGTCTAGCTATTTCAC	NA	NA	NA	NA
WP_000791402.1|2837660_2838716_+	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
WP_000595617.1|2838737_2839757_+	beta-channel forming cytolysin	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
WP_102948857.1|2840013_2840865_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	99.3	2.2e-155
WP_000857198.1|2840895_2841933_-|integrase	site-specific integrase	integrase	A0A1X9H022	Staphylococcus_phage	100.0	2.6e-179
WP_000440838.1|2842126_2842831_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	100.0	4.6e-127
WP_000705241.1|2842970_2843138_-	hypothetical protein	NA	U5U774	Staphylococcus_phage	100.0	1.7e-24
WP_000358224.1|2843207_2843927_-	helix-turn-helix transcriptional regulator	NA	A0A2H4PQQ2	Staphylococcus_phage	100.0	1.3e-132
WP_001198673.1|2844068_2844287_+	helix-turn-helix transcriptional regulator	NA	Q8SDX1	Staphylococcus_phage	100.0	2.9e-35
WP_001148564.1|2844302_2845091_+	phage antirepressor KilAC domain-containing protein	NA	R9QSV3	Staphylococcus_phage	99.2	1.0e-143
WP_001148857.1|2845107_2845302_+	hypothetical protein	NA	A0A1X9H0A2	Staphylococcus_phage	98.4	3.3e-19
WP_000939495.1|2845332_2845473_+	hypothetical protein	NA	A0A2I6PDT8	Staphylococcus_phage	100.0	1.9e-16
WP_000772137.1|2845465_2845675_-	hypothetical protein	NA	A0A2I6PDR8	Staphylococcus_phage	100.0	9.1e-31
WP_001148337.1|2845731_2846481_+	antirepressor	NA	Q8SDM9	Staphylococcus_phage	99.6	4.4e-136
WP_000435343.1|2846493_2846754_+	hypothetical protein	NA	A0A2I6PDT7	Staphylococcus_phage	100.0	3.5e-40
WP_001662405.1|2846773_2846911_+	hypothetical protein	NA	A0ZS11	Staphylococcus_virus	97.8	3.7e-17
WP_001120935.1|2846986_2847307_+	DUF771 domain-containing protein	NA	Q4ZDR7	Staphylococcus_virus	100.0	1.5e-56
WP_000066017.1|2847303_2847465_+	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
WP_000829611.1|2847554_2847884_+	hypothetical protein	NA	A0A2I6PEL3	Staphylococcus_phage	100.0	1.4e-33
WP_001814567.1|2847864_2848125_+	DUF1108 family protein	NA	D2JGJ8	Staphylococcus_phage	100.0	5.8e-43
WP_000802315.1|2848132_2848369_+	hypothetical protein	NA	D2JGJ9	Staphylococcus_phage	100.0	2.7e-39
WP_160187097.1|2848361_2848841_+	siphovirus Gp157 family protein	NA	R4IFK3	Staphylococcus_phage	98.1	1.7e-80
WP_001043065.1|2848840_2849479_+	ERF family protein	NA	R4II59	Staphylococcus_phage	100.0	1.7e-115
WP_000934780.1|2849478_2849904_+	single-stranded DNA-binding protein	NA	R4IG44	Staphylococcus_phage	100.0	3.0e-73
WP_160187098.1|2849917_2850586_+	hypothetical protein	NA	R4IH15	Staphylococcus_phage	99.1	2.6e-127
WP_000240901.1|2850585_2851365_+	AP2 domain-containing protein	NA	A0A2H4J5K3	uncultured_Caudovirales_phage	46.1	7.3e-49
WP_000504989.1|2851336_2852140_+	hypothetical protein	NA	A0A2H4JCF5	uncultured_Caudovirales_phage	99.6	2.5e-121
WP_000803043.1|2852149_2852923_+	ATP-binding protein	NA	A0A2H4PQI3	Staphylococcus_phage	98.4	3.3e-142
WP_000256598.1|2852916_2853075_+	hypothetical protein	NA	Q4ZBL5	Staphylococcus_phage	98.1	4.5e-22
WP_001123673.1|2853087_2853309_+	DUF3269 family protein	NA	A7TWN4	Staphylococcus_phage	100.0	1.3e-35
WP_000049807.1|2853318_2853723_+	DUF1064 domain-containing protein	NA	A7TWN5	Staphylococcus_phage	97.8	3.0e-70
WP_160187099.1|2853727_2853913_+	DUF3113 family protein	NA	M1SNY0	Staphylococcus_phage	96.7	1.7e-25
WP_031769008.1|2854271_2854529_+	DUF3310 domain-containing protein	NA	B5WZM8	Staphylococcus_phage	96.5	1.4e-41
2854127:2854142	attR	GTGAAATAGCTAGACA	NA	NA	NA	NA
WP_031769006.1|2854531_2854732_+	hypothetical protein	NA	C5I650	Staphylococcus_phage	97.0	2.1e-29
WP_075339544.1|2854740_2854989_+	hypothetical protein	NA	A0A2I6PF06	Staphylococcus_phage	97.6	5.2e-41
WP_072489986.1|2855003_2855252_+	DUF1024 family protein	NA	Q9B0F3	Staphylococcus_virus	98.8	7.0e-38
WP_000185693.1|2855244_2855781_+	hypothetical protein	NA	Q9MBR0	Staphylococcus_prophage	100.0	1.6e-95
WP_001282077.1|2855817_2856063_+	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	98.8	2.5e-35
WP_000195784.1|2856059_2856266_+	DUF1381 domain-containing protein	NA	A0A2I6PEA2	Staphylococcus_phage	94.1	1.1e-17
WP_000595265.1|2856262_2856412_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_001005260.1|2856570_2857221_+	hypothetical protein	NA	D2JLD8	Staphylococcus_phage	99.5	3.4e-116
WP_000265041.1|2857220_2857421_+	DUF1514 domain-containing protein	NA	R9QT57	Staphylococcus_phage	100.0	1.1e-28
WP_000590122.1|2857448_2857865_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988332.1|2858096_2858396_+	HNH endonuclease	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
