The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	0	61907	2816598	portal,protease,capsid,holin,tail,head,terminase	Staphylococcus_phage(81.08%)	64	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_160194356.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	99.0	3.7e-217
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_061823656.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	99.7	3.6e-214
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268740.1|6484_7129_+|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_061823657.1|8039_12584_+|tail	phage tail tape measure protein	tail	A0A075M036	Staphylococcus_phage	99.2	0.0e+00
WP_000567390.1|12580_14065_+|tail	phage tail protein	tail	A0A068A242	Staphylococcus_phage	100.0	1.5e-297
WP_160194357.1|14080_17866_+	hypothetical protein	NA	C8CH32	Staphylococcus_phage	99.6	0.0e+00
WP_001153681.1|17855_18008_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040261.1|18054_18342_+	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
WP_000539688.1|18399_18696_+	DUF2951 domain-containing protein	NA	D2JLG2	Staphylococcus_phage	100.0	2.9e-46
WP_011447039.1|18845_19022_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|19074_19182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|19233_19488_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|19499_20255_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000920037.1|20445_20937_+	staphylokinase	NA	A0A1W6JQ12	Staphylococcus_phage	100.0	3.6e-86
WP_020444758.1|21463_21922_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000727649.1|22016_22466_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|23150_23501_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|23553_23814_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|24124_24304_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_061823659.1|25262_27011_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_001068523.1|27590_28877_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|29076_29175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681968.1|29417_29594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|29852_30233_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991303.1|30229_31126_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645725.1|31126_31807_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|31803_32676_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
WP_001221651.1|32675_33416_+	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000966288.1|34166_34691_+	membrane protein	NA	NA	NA	NA	NA
WP_001033971.1|34750_35308_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000713059.1|35304_36147_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001188074.1|36203_37244_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000267034.1|37694_37868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205106.1|38497_38899_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
WP_000181322.1|39168_40197_+	lactonase family protein	NA	NA	NA	NA	NA
WP_001021210.1|40316_41696_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001792184.1|41747_41921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140871.1|42113_43043_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_000149686.1|43095_43656_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275706.1|44027_45125_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.9	2.5e-47
WP_000323161.1|45329_46892_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_001802312.1|46902_47010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045173916.1|47081_47876_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000897635.1|47895_48972_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_000284431.1|49155_50625_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	4.5e-108
WP_000040866.1|50617_51439_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
WP_000011542.1|51709_52312_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_000669862.1|52292_52466_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_000434933.1|52757_53084_-	staphostatin A	NA	NA	NA	NA	NA
WP_045173933.1|53114_54281_-|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
WP_045173936.1|55140_56436_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|56544_56847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272070.1|57018_57711_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_045173938.1|57707_59900_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	7.6e-136
WP_045173941.1|59903_61907_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	4.4e-114
>prophage 2
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	69025	74053	2816598		Catovirus(33.33%)	5	NA	NA
WP_001231451.1|69025_69973_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
WP_001147864.1|70053_71415_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.8	6.3e-104
WP_000548781.1|71584_72115_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140176.1|72361_73432_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|73498_74053_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 3
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	77505	77919	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001566709.1|77505_77919_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	37.7	2.3e-17
>prophage 4
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	82973	83603	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|82973_83603_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 5
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	99083	100820	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|99083_100820_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 6
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	117355	207941	2816598	transposase,protease,tRNA	Staphylococcus_phage(90.74%)	93	NA	NA
WP_001144055.1|117355_118084_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
WP_001792805.1|118219_119362_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000181394.1|119366_119837_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_001251224.1|119994_120594_+	glucosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000031108.1|120618_120771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045174101.1|121432_121828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045174099.1|122023_123409_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_045174097.1|123826_124648_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000437970.1|124809_125922_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_001045133.1|125943_126567_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000375864.1|126922_127387_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000992524.1|127565_128690_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000290301.1|128758_129103_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
WP_031867558.1|129596_129695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160194360.1|129985_131191_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_000584628.1|131171_134108_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001244175.1|134104_135046_+	3'-5' exoribonuclease YhaM	NA	NA	NA	NA	NA
WP_000782121.1|135166_136129_-	foldase	NA	NA	NA	NA	NA
WP_000477959.1|136333_136891_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000648118.1|137623_137989_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_160194361.1|138130_138553_-	HIT family protein	NA	NA	NA	NA	NA
WP_000216874.1|138686_139427_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
WP_000551840.1|139419_140643_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000737976.1|140766_141270_-	signal transduction protein TraP	NA	NA	NA	NA	NA
WP_001790154.1|141432_141543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233526.1|141532_142570_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_000162872.1|142627_143551_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000167551.1|143574_144975_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_000132890.1|145294_145849_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_000195429.1|147302_148475_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_010922839.1|148540_149323_+	staphylococcal enterotoxin type O	NA	A0A1X9H080	Staphylococcus_phage	36.7	1.1e-31
WP_000821658.1|149603_150323_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
WP_000713847.1|150357_151086_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
WP_000764686.1|151239_152010_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	43.2	1.1e-44
WP_045174075.1|152048_152804_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	41.4	3.5e-40
WP_000736712.1|153086_153863_+	staphylococcal enterotoxin type G	NA	NA	NA	NA	NA
WP_000848318.1|154414_155191_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000617704.1|155211_155448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253432.1|155525_156020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001792814.1|156547_156676_-|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	66.7	6.6e-08
WP_000209099.1|156853_157642_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	95.0	1.3e-138
WP_045174067.1|159003_159939_+	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	99.3	2.0e-173
WP_045174065.1|159940_160924_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	95.7	6.2e-178
WP_045174063.1|162088_162562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078103504.1|162704_162923_+	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	80.6	2.3e-21
WP_045174061.1|163395_163959_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	61.9	1.8e-49
WP_045174059.1|164914_165622_+|protease	serine protease	protease	A0A2H4PQN3	Staphylococcus_phage	84.7	1.8e-107
WP_045174057.1|165740_166463_+|protease	serine protease	protease	A0A2H4PQN0	Staphylococcus_phage	91.2	1.9e-120
WP_045174055.1|166520_167240_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.3	2.4e-123
WP_064132136.1|167362_168079_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.2	3.5e-82
WP_064132135.1|168246_168963_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	63.9	4.5e-85
WP_045174310.1|169123_169840_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	96.6	9.5e-128
WP_064132134.1|170000_170717_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	3.2e-83
WP_045173743.1|170866_171586_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	94.1	4.9e-124
WP_031835054.1|171650_171785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045173746.1|171948_173505_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	97.5	2.2e-286
WP_061823647.1|173497_174718_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.7	7.4e-48
WP_045173751.1|175372_175819_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000070811.1|176505_176889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000375476.1|176899_177076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045173754.1|177077_177263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045173756.1|177448_177871_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	86.6	7.0e-46
WP_045173758.1|178215_178788_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
WP_045173760.1|179269_179896_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	92.8	1.3e-88
WP_045173763.1|179971_180967_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.6	3.8e-74
WP_078103499.1|181047_181698_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	92.6	4.1e-53
WP_012840523.1|182000_182456_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
WP_023914796.1|182614_184093_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.8	7.4e-284
WP_045173773.1|184097_185099_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.3	1.5e-184
WP_000718107.1|185095_185353_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672014.1|185418_185892_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	4.7e-83
WP_160194462.1|185896_186643_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.4	1.2e-141
WP_000109906.1|187023_188616_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933822.1|188987_190181_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
WP_000366158.1|190305_191214_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.0	1.7e-137
WP_000453314.1|191425_192259_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	100.0	5.4e-159
WP_000623476.1|192641_192995_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	98.3	2.0e-22
WP_001200542.1|192991_193357_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091445.1|193612_193915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|194174_194888_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_045173784.1|196258_196702_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.0	1.6e-56
WP_001153742.1|196688_197132_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671052.1|197244_197715_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	99.4	1.0e-82
WP_000384171.1|197913_198138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|198413_199268_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989121.1|199354_200647_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_000221177.1|200646_200961_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_045173790.1|201483_202986_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
WP_000384185.1|203478_204510_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
WP_000493892.1|204516_205149_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.5	1.7e-112
WP_001159037.1|205159_206341_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
WP_001008551.1|206353_206818_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	99.4	5.8e-70
WP_001196354.1|206939_207941_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.7	9.0e-185
>prophage 7
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	211101	225221	2816598	tRNA	Staphylococcus_phage(100.0%)	7	NA	NA
WP_000764419.1|211101_211665_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_045173807.1|211661_212615_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025061.1|212724_213906_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	100.0	5.6e-218
WP_061823648.1|214196_216617_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.9	0.0e+00
WP_000836465.1|216638_216950_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	100.0	1.6e-52
WP_160194362.1|217275_223836_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	96.8	1.0e-300
WP_045173815.1|223952_225221_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	100.0	4.1e-57
>prophage 8
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	236759	242087	2816598		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|236759_237617_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_045173827.1|237645_238242_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_160194363.1|238262_242087_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 9
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	250833	252540	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_044290202.1|250833_252540_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	100.0	1.2e-274
>prophage 10
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	259156	261787	2816598	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|259156_260419_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_045173851.1|260512_261787_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 11
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	267546	271681	2816598		Staphylococcus_phage(50.0%)	4	NA	NA
WP_045173091.1|267546_269151_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_045173090.1|269137_270298_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553929.1|270411_270858_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174286.1|270937_271681_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.5	1.4e-17
>prophage 12
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	289220	292418	2816598		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226910.1|289220_292418_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	7.7e-137
>prophage 13
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	297351	299109	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160194364.1|297351_299109_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 14
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	305970	314134	2816598		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080029.1|305970_306675_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_015445861.1|306674_308336_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849439.1|308834_310322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038289.1|310615_313246_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114452.1|313261_314134_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.0e-42
>prophage 15
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	318048	329201	2816598	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|318048_318969_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_001790562.1|319061_319184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160194365.1|319381_321319_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	3.5e-116
WP_160194366.1|321744_323238_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|323466_323994_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|324022_324223_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|324269_324626_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|324767_325376_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_001280022.1|325394_326324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|326328_326439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127573.1|326486_327788_+	trigger factor	NA	NA	NA	NA	NA
WP_000472302.1|327938_329201_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 16
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	338768	341399	2816598	tRNA	Catovirus(100.0%)	1	NA	NA
WP_045173060.1|338768_341399_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	4.8e-153
>prophage 17
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	351853	387406	2816598	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|351853_352858_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019172.1|352859_353885_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|353907_355047_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|355065_355326_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749795.1|355600_357880_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_045173054.1|358082_360356_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.0	5.2e-63
WP_000364542.1|360377_360896_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058587.1|361323_363513_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869983.1|363524_363977_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|363973_364849_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_045173052.1|365309_366572_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|366587_368354_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001790559.1|368686_368815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|368814_369588_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_045173051.1|369748_371023_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	4.8e-106
WP_000704122.1|371107_371530_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|371629_371812_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|371851_371998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985872.1|372234_373248_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|373559_374702_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|374702_375821_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_160194368.1|376455_377124_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283312.1|377125_379603_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_045173048.1|379945_382576_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|382638_382899_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|382902_383331_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|383345_383654_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342266.1|383938_384577_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|384579_385503_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|385514_386783_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|386782_387406_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 18
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	394233	394986	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045173043.1|394233_394986_+	enterotoxin	NA	A0EX09	Staphylococcus_phage	40.6	3.2e-49
>prophage 19
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	402258	408422	2816598		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|402258_402720_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_078103485.1|402778_404926_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
WP_001282562.1|404982_405957_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_160194369.1|406001_406253_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_045173037.1|406598_408422_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 20
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	411974	415082	2816598		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|411974_413807_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_045173035.1|413942_415082_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.0	2.3e-27
>prophage 21
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	421552	422500	2816598		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|421552_422500_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 22
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	425553	439299	2816598	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|425553_426945_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001794939.1|427279_427903_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|427913_428732_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_045173034.1|428792_430610_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.6e-54
WP_001283055.1|430833_431940_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624571.1|432070_432748_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683933.1|432750_433851_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	29.6	5.2e-08
WP_001062177.1|433964_435311_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924220.1|435320_436211_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
WP_001213908.1|436336_437122_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|437163_438027_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|438013_438424_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|438699_439299_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 23
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	445471	446095	2816598		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|445471_446095_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 24
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	451639	454451	2816598		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_043854778.1|451639_452986_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.7	6.3e-64
WP_000202188.1|452978_454451_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 25
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	461951	468522	2816598		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|461951_463289_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|463281_463512_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_045173378.1|463489_464371_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.2	1.5e-10
WP_001124985.1|464802_465255_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942210.1|465270_466950_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291528.1|467100_468522_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	3.9e-40
>prophage 26
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	475352	476759	2816598		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|475352_476759_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 27
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	483186	484671	2816598		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|483186_484671_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 28
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	490337	582092	2816598	integrase,portal,capsid,holin,tail,plate,transposase,head,tRNA,terminase	Staphylococcus_phage(67.86%)	117	496742:496801	565394:566717
WP_000447733.1|490337_491225_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183429.1|491302_491809_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273369.1|491900_492632_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	4.7e-05
WP_000368657.1|492624_493167_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|493159_493897_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|494029_494755_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987769.1|494735_496487_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
496742:496801	attL	AGTCAAGTCCAGACTCCTGTGTAAAATGCTATACAATGTTTTTACCATTTCTACTTATCA	NA	NA	NA	NA
WP_000195429.1|496791_497964_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_031927934.1|498198_499236_-|integrase	site-specific integrase	integrase	A0A0K1LKK4	Staphylococcus_phage	98.3	1.8e-191
WP_115399516.1|499296_499797_-	hypothetical protein	NA	Q4ZB84	Staphylococcus_virus	97.6	1.2e-44
WP_160194370.1|499814_500276_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0H4J322	Staphylococcus_phage	98.7	2.3e-82
WP_015978337.1|500297_500627_-	helix-turn-helix transcriptional regulator	NA	A0A0H4ITV7	Staphylococcus_phage	100.0	2.4e-54
WP_015978340.1|500803_501052_+	helix-turn-helix transcriptional regulator	NA	A0A0H4IPU8	Staphylococcus_phage	100.0	3.7e-39
WP_063125012.1|501064_501508_+	hypothetical protein	NA	A0A0H4ISP7	Staphylococcus_phage	99.3	6.6e-79
WP_000933365.1|501858_502044_+	helix-turn-helix transcriptional regulator	NA	A0A0H4IP57	Staphylococcus_phage	100.0	1.3e-25
WP_160194371.1|502045_502801_+	oxidoreductase	NA	A0A0H4J326	Staphylococcus_phage	99.2	3.7e-138
WP_031927929.1|502816_502960_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	91.3	6.2e-15
WP_031927928.1|502949_503162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120197.1|503216_503537_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_031927927.1|503533_503695_+	DUF1270 family protein	NA	A0A2I6PDF7	Staphylococcus_phage	94.3	1.2e-19
WP_115399515.1|503789_504092_+	DUF2482 family protein	NA	A0A0F6N3N3	Staphylococcus_phage	67.0	3.8e-30
WP_115399514.1|504096_504357_+	DUF1108 family protein	NA	A1KWZ6	Staphylococcus_virus	95.3	5.4e-41
WP_000815403.1|504366_504588_+	DUF2483 domain-containing protein	NA	A0A1X9H047	Staphylococcus_phage	100.0	1.2e-33
WP_029625654.1|504580_505369_+	ATP-binding protein	NA	Q4ZBM5	Staphylococcus_phage	99.6	5.7e-142
WP_160194372.1|505399_505951_+	single-stranded DNA-binding protein	NA	Q4ZBM4	Staphylococcus_phage	98.9	3.8e-100
WP_001199438.1|505963_506656_+	hypothetical protein	NA	Q8SDW3	Staphylococcus_phage	99.1	5.2e-131
WP_072470612.1|506627_507449_+	replication protein	NA	A0A059T619	Staphylococcus_phage	98.9	8.6e-117
WP_000443352.1|507461_508247_+	ATP-binding protein	NA	A0A0H4J332	Staphylococcus_phage	99.6	3.2e-145
WP_000628833.1|508243_508402_+	hypothetical protein	NA	A0A2I6PDX0	Staphylococcus_phage	100.0	3.4e-22
WP_001123688.1|508414_508636_+	DUF3269 family protein	NA	Q9G021	Staphylococcus_phage	100.0	1.3e-35
WP_031927920.1|508645_509050_+	DUF1064 domain-containing protein	NA	Q6R835	Staphylococcus_virus	97.8	3.9e-70
WP_031927919.1|509054_509240_+	DUF3113 family protein	NA	A0A2H4JAM6	uncultured_Caudovirales_phage	98.4	6.0e-26
WP_160194373.1|509240_509612_+	hypothetical protein	NA	C5I648	Staphylococcus_phage	95.1	1.4e-53
WP_015984497.1|509611_509869_+	DUF3310 domain-containing protein	NA	A7TWG9	Staphylococcus_phage	100.0	3.4e-43
WP_114668930.1|509871_510072_+	hypothetical protein	NA	A0A2I6PF32	Staphylococcus_phage	98.5	3.7e-29
WP_015968801.1|510080_510329_+	PVL orf 51-like protein	NA	Q8SDR2	Staphylococcus_virus	100.0	1.8e-41
WP_000693987.1|510342_510549_+	hypothetical protein	NA	A0A0N9BAW9	Staphylococcus_phage	100.0	3.0e-34
WP_000695759.1|510551_510953_+	hypothetical protein	NA	A0A0N7E0T5	Staphylococcus_phage	100.0	7.0e-72
WP_000979209.1|510949_511297_+	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
WP_000144708.1|511293_511602_+	hypothetical protein	NA	Q4ZBK6	Staphylococcus_phage	100.0	8.1e-52
WP_160194374.1|511594_511849_+	DUF1024 family protein	NA	A0A2I6PE79	Staphylococcus_phage	97.6	1.9e-38
WP_072324140.1|511811_512006_+	hypothetical protein	NA	A0A2I6PEB2	Staphylococcus_phage	100.0	2.4e-25
WP_031865247.1|511998_512526_+	dUTP pyrophosphatase	NA	A0A2I6PE85	Staphylococcus_phage	100.0	7.8e-95
WP_001282070.1|512562_512808_+	hypothetical protein	NA	A0A0H4ITX2	Staphylococcus_phage	100.0	2.0e-37
WP_160194375.1|512804_512993_+	DUF1381 domain-containing protein	NA	A0A2I6PEH2	Staphylococcus_phage	95.1	5.7e-24
WP_001125015.1|512967_513168_+	hypothetical protein	NA	A0A2I6PF22	Staphylococcus_phage	100.0	1.8e-28
WP_031783647.1|513155_513344_+	transcriptional regulator	NA	Q77FU4	Staphylococcus_phage	98.4	1.5e-24
WP_053504540.1|513344_513491_+	hypothetical protein	NA	Q4ZBJ8	Staphylococcus_phage	95.8	2.2e-15
WP_000162701.1|513514_513937_+	RinA family phage transcriptional activator	NA	A0A0F6N3E5	Staphylococcus_phage	100.0	1.2e-74
WP_053504539.1|514265_514760_+|terminase	terminase	terminase	A0A2I6PCU5	Staphylococcus_phage	98.8	1.9e-82
WP_031927907.1|514752_515961_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4PQK2	Staphylococcus_phage	100.0	2.7e-236
WP_053504537.1|515914_517393_+|portal	phage portal protein	portal	A0A2H4PQK7	Staphylococcus_phage	99.8	1.0e-285
WP_053504536.1|517331_518312_+|capsid	phage capsid protein	capsid	A0A0E3XC69	Staphylococcus_phage	98.8	8.6e-180
WP_031927905.1|518409_519006_+	hypothetical protein	NA	C7F7L8	Staphylococcus_phage	96.0	1.5e-73
WP_031927904.1|519026_519851_+|capsid	N4-gp56 family major capsid protein	capsid	A0A0H4J347	Staphylococcus_phage	98.9	4.7e-147
WP_031927903.1|519867_520194_+	Rho termination protein	NA	W5RAP1	Staphylococcus_phage	99.1	2.1e-50
WP_031927902.1|520193_520508_+|head,tail	phage head-tail adapter protein	head,tail	A7YGU8	Staphylococcus_virus	98.1	1.1e-51
WP_031927901.1|520500_520836_+|head	phage head closure protein	head	A0A0H4ISR6	Staphylococcus_phage	98.2	2.6e-59
WP_031927900.1|520822_521236_+	HK97 gp10 family phage protein	NA	A0A0E3XCY8	Staphylococcus_phage	99.3	3.4e-77
WP_053504535.1|521248_521686_+	DUF3168 domain-containing protein	NA	A0A2H4PQL6	Staphylococcus_phage	99.3	6.1e-77
WP_031927899.1|521672_522233_+	hypothetical protein	NA	A0A0H4ITY2	Staphylococcus_phage	98.9	3.2e-99
WP_031927898.1|522294_522789_+	hypothetical protein	NA	A0A0H4IPX9	Staphylococcus_phage	98.8	3.6e-86
WP_160194376.1|522809_523151_+	hypothetical protein	NA	W5R8J4	Staphylococcus_phage	99.1	7.8e-56
WP_160194377.1|523153_526123_+|terminase	terminase	terminase	A0A2H4PQM1	Staphylococcus_phage	97.4	2.5e-259
WP_015967256.1|526137_527073_+	hypothetical protein	NA	Q9FZZ1	Staphylococcus_virus	100.0	4.8e-180
WP_063125005.1|527083_528970_+	peptidase	NA	Q9FZZ0	Staphylococcus_virus	99.5	0.0e+00
WP_160194378.1|528982_530881_+	hypothetical protein	NA	A0A0H3U448	Staphylococcus_phage	97.6	0.0e+00
WP_160194379.1|530880_532704_+|plate	BppU family phage baseplate upper protein	plate	Q4ZDD5	Staphylococcus_virus	95.7	1.4e-284
WP_048523474.1|532703_533081_+	DUF2977 domain-containing protein	NA	Q9FZY7	Staphylococcus_virus	99.2	4.4e-60
WP_000782200.1|533084_533258_+	XkdX family protein	NA	A0A0F6N3L7	Staphylococcus_phage	100.0	6.6e-27
WP_000466778.1|533297_533597_+	DUF2951 domain-containing protein	NA	A0A0H4ITZ0	Staphylococcus_phage	100.0	7.6e-47
WP_001657240.1|535619_536858_+|plate	BppU family phage baseplate upper protein	plate	E0Y3M8	Staphylococcus_virus	99.8	3.5e-210
WP_000398862.1|536862_537258_+	hypothetical protein	NA	Q4ZBW9	Staphylococcus_virus	100.0	1.6e-68
WP_000351119.1|537312_537588_+|holin	phage holin	holin	A0A0F6N3M0	Staphylococcus_phage	100.0	8.6e-45
WP_143913454.1|537574_538987_+	CHAP domain-containing protein	NA	A0A2H4PQS4	Staphylococcus_phage	99.1	8.3e-285
WP_000504040.1|539518_540241_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000426857.1|540575_541424_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_109683178.1|542307_543597_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	100.0	1.6e-109
WP_000476865.1|543686_544592_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_045173346.1|544649_545546_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001557351.1|545621_545876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045173343.1|546016_546970_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001186912.1|547424_547970_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_045173340.1|548075_548324_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	4.9e-15
WP_001163801.1|548431_549385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902119.1|549374_550754_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.6	2.9e-56
WP_045173334.1|550906_552367_+	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_031864479.1|552491_552608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001174260.1|552768_553755_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_000681756.1|553869_554838_-	asparaginase	NA	NA	NA	NA	NA
WP_000644390.1|554914_555574_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001789945.1|555604_555721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001789944.1|555837_556029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133954.1|556285_557461_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000165530.1|557682_558993_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000161738.1|559009_560008_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001043863.1|560178_560451_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|560881_561454_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774684.1|561456_562182_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_016169114.1|562198_563143_+	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|563234_563684_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_045173318.1|563892_564093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000195429.1|564230_565403_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001269929.1|565809_566976_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.1	7.6e-34
565394:566717	attR	TGATAAGTAGAAATGGTAAAAACATTGTATAGCATTTTACACAGGAGTCTGGACTTGACTTTAAACGGACTGATTAACTTTATTAATAATTAACAGTTCGTTCTTTTGTATTAAGAAATGTAGTCAGTATATTATTTGCTAAAGTTGCGATACGATTATATTAAAACGGCTAATCATTTTTAATTAATGATTATATGATGCAACTGTTTAGAAATTCATGATACTTTTCTACAGACGAATATATTATAATTAATTTTAGTTCGTTTAATATTAAGATAATTCTGACATTTAAAATGAGATGTCATCCATTTTCTTAATTGAGCTTGAAAACAAACATTTATGAATGCACAATGAATATGATAAGATTAACAACATATTATAATGTTATCGTGGAAGTATGAAAGGAGCGAGTGTGTATGAGATACCTAACATCAGGAGAATCACATGGACCTCAATTAACAGTTATTGTTGAAGGTGTACCTGCAAATATAGAAATTAAGGTTGAGGATATTAATAAAGAAATGTTTAAGCGTCAAGGCGGTTACGGACGTGGACGTCGTATGCAAATTGAGAAAGATACAGTAGAAATAGTATCAGGCGTTAGAAATGGTTATACATTAGGTAGTCCAATTACTATGGTTGTAACCAATGATGACTTTACGCATTGGAGAAAAATTATGGGAGCAGCTCCAATAAGTGAAGAAGAACGTGAAAATATGAAACGTACTATTACAAAACCAAGACCTGGTCATGCAGATTTGGTTGGAGGTATGAAATATAATCATCGTGATTTACGAAATGTGCTAGAGCGATCATCTGCTAGAGAAACAGCAGCTCGAGTTGCAGTCGGTGCCTTATGTAAAGTGTTATTACAACAGTTAGATATCGATATATACAGTCGTGTTGTTGAAATAGGTGGAATTAAAGATAAAGATTTTTATGATTCAGAAACATTTAAAGCAAATCTTGATCGTAATGATGTTCGTGTAATTGATGACAGTATCGCACAAGCAATGCGAGATAAAATTGACGAAGCTAAAAATGAAGGAGATTCAATTGGCGGTGTCGTTCAAGTTGTAGTTGAAAATATGCCTGTTGGTGTAGGTAGTTATGTGCATTATGATCGTAAGTTAGATGGTAAGATTGCACAAGGTGTTGTCAGCATAAATGCTTTTAAAGGTGTAAGCTTTGGTGAAGGATTTAAAGCAGCTGAAAAGCCAGGTAGTGAGATTCAAGATGAAATTCTATATAATAGTGAAATTGGTTATTATCGTGGATCTAATCACTTAGGTGGTTTAGAAGGCGGTATGTCAAATGGAATGCC	NA	NA	NA	NA
WP_045173315.1|567001_568066_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_000245900.1|568075_569374_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_045173314.1|569380_570625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005212.1|570638_571214_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
WP_000154682.1|571203_571791_+	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_001827022.1|571862_572543_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000839926.1|572878_573196_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000690027.1|573439_574582_+	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000361549.1|574586_575789_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	1.9e-35
WP_160194380.1|575775_576747_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525078.1|576770_579464_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858789.1|579785_581078_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
WP_000362218.1|581405_582092_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
>prophage 29
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	585831	586458	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_001108889.1|585831_586458_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 30
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	595782	596661	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_001133025.1|595782_596661_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.1	4.0e-19
>prophage 31
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	635551	644941	2816598		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|635551_636256_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|636500_636695_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000691943.1|636706_636958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045174246.1|636995_638120_+	virulence factor	NA	NA	NA	NA	NA
WP_000995287.1|638135_638573_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|638996_639953_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175750.1|640152_640632_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	1.5e-73
WP_045174249.1|640646_641486_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	3.0e-48
WP_000159900.1|641571_642105_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|642097_642526_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473656.1|642537_643038_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|643037_643259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342146.1|643450_644941_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	2.3e-22
>prophage 32
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	649137	651149	2816598		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|649137_649797_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166801.1|649793_651149_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 33
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	657314	658106	2816598		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|657314_658106_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 34
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	661858	669177	2816598	lysis,transposase	Streptococcus_phage(25.0%)	8	NA	NA
WP_106888601.1|661858_663037_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.9	1.4e-54
WP_045173242.1|664146_665283_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.6	3.3e-34
WP_001788788.1|665314_665944_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_160194382.1|665962_666232_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|666394_666703_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|666873_667074_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|667270_667672_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_045173239.1|667911_669177_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	2.8e-13
>prophage 35
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	677022	678624	2816598		Klosneuvirus(100.0%)	1	NA	NA
WP_000942300.1|677022_678624_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 36
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	683709	687162	2816598		Indivirus(50.0%)	3	NA	NA
WP_000079447.1|683709_684561_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
WP_000974847.1|684567_685209_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077576.1|685347_687162_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.0	1.5e-153
>prophage 37
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	690576	691278	2816598		Tupanvirus(100.0%)	1	NA	NA
WP_000571258.1|690576_691278_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	1.5e-13
>prophage 38
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	698649	701004	2816598		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000154120.1|698649_699432_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	5.5e-28
WP_000173831.1|699433_700432_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.5	1.1e-33
WP_000604817.1|700437_701004_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 39
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	705322	706585	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|705322_706585_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 40
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	716244	720638	2816598		Bacillus_phage(50.0%)	2	NA	NA
WP_001289562.1|716244_718647_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.4	7.9e-94
WP_001548666.1|718646_720638_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 41
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	726575	728222	2816598		Vibrio_phage(100.0%)	1	NA	NA
WP_045173181.1|726575_728222_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	3.3e-22
>prophage 42
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	731891	733013	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691303.1|731891_733013_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 43
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	737163	742836	2816598		Phage_Wrath(25.0%)	7	NA	NA
WP_001208755.1|737163_737787_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	5.9e-17
WP_045173170.1|738166_739030_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	4.1e-16
WP_001791425.1|739103_739208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688122.1|739204_740182_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085655.1|740338_740608_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|741078_741228_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000082539.1|741318_742836_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 44
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	752978	757254	2816598		Bacillus_phage(50.0%)	6	NA	NA
WP_000841351.1|752978_753512_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|753650_753839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|753951_754554_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670300.1|754550_755642_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603969.1|755645_756377_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_160194384.1|756345_757254_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	1.8e-22
>prophage 45
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	761220	767902	2816598	capsid,head	Staphylococcus_phage(100.0%)	12	NA	NA
WP_001120914.1|761220_761682_-|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	46.0	3.8e-29
WP_001566611.1|762462_762675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031835011.1|762641_762770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072361166.1|762962_763826_-|head	head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	51.4	3.8e-30
WP_000956747.1|763871_764123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791646.1|764123_764297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477492.1|764251_764356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|764867_765053_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_001788716.1|765480_765591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002340.1|766292_766499_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
WP_001795785.1|766792_767017_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	5.0e-19
WP_001793526.1|767704_767902_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	50.0	9.9e-11
>prophage 46
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	772949	773426	2816598		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448085.1|772949_773426_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.6e-22
>prophage 47
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	779368	785850	2816598		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103743.1|779368_780187_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|780661_781204_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516263.1|781209_783219_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.8	2.2e-60
WP_045173157.1|783231_785850_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
>prophage 48
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	795264	796308	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|795264_796308_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 49
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	800507	806051	2816598		Bacillus_virus(33.33%)	4	NA	NA
WP_000664766.1|800507_801794_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089941.1|801793_803059_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293307.1|803089_803803_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001806691.1|803807_806051_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 50
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	811193	823006	2816598	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864185.1|811193_812165_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282298.1|812179_813097_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|813265_813616_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_061823633.1|814001_816119_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020853.1|816123_816441_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|816437_816722_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097457.1|816742_817918_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|817938_818406_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_078103495.1|818695_823006_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 51
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	827279	828050	2816598		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|827279_828050_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 52
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	832824	847829	2816598	transposase,protease,tRNA	Staphylococcus_phage(28.57%)	12	NA	NA
WP_000379054.1|832824_834228_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	4.9e-27
WP_000072681.1|834293_834839_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_043044510.1|834835_835732_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.5	6.1e-31
WP_000195259.1|836148_837456_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|837611_839687_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000593192.1|839860_840733_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_078162878.1|840905_841526_-	peptidoglycan bridge formation glycyltransferase FemA/FemB family protein	NA	NA	NA	NA	NA
WP_000195429.1|841579_842752_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_001041666.1|843509_844628_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110251.1|844856_845765_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|845786_846953_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176394.1|847061_847829_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 53
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	861213	863851	2816598		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|861213_861945_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|862059_862293_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|863116_863851_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 54
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	874221	876216	2816598		Moumouvirus(100.0%)	1	NA	NA
WP_000579563.1|874221_876216_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 55
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	879363	880299	2816598	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161281.1|879363_880299_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.9	3.6e-10
>prophage 56
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	885308	887565	2816598		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|885308_886508_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|886723_886942_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368226.1|886941_887565_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	1.0e-21
>prophage 57
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	890879	891491	2816598		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|890879_891491_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 58
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	895458	900069	2816598		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|895458_896559_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_045173597.1|896560_897835_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|897852_898734_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|898761_900069_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 59
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	904561	907315	2816598	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384684.1|904561_907315_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 60
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	928874	929063	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245802.1|928874_929063_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	86.9	3.8e-20
>prophage 61
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	937976	941463	2816598	transposase	Staphylococcus_phage(100.0%)	4	NA	NA
WP_001802045.1|937976_938201_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765708.1|938157_938304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857488.1|938976_939936_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
WP_000195429.1|940290_941463_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 62
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	951306	955864	2816598		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|951306_951621_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_045174009.1|951793_954142_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.3	1.1e-15
WP_000161942.1|954151_955864_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	8.9e-15
>prophage 63
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	961001	962060	2816598	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003559.1|961001_962060_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 64
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	973994	974477	2816598		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000401377.1|973994_974477_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
>prophage 65
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	979389	979737	2816598		Streptococcus_phage(100.0%)	1	NA	NA
WP_000119686.1|979389_979737_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	34.9	2.4e-12
>prophage 66
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	996564	1006278	2816598	transposase	Lactococcus_phage(16.67%)	10	NA	NA
WP_012816615.1|996564_996765_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.5	1.9e-17
WP_012816617.1|997462_998071_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	34.4	1.6e-19
WP_042909157.1|998197_998776_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	4.9e-42
WP_001284654.1|999039_999420_-	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_000733269.1|1001273_1002119_+	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	33.7	4.4e-31
WP_160194389.1|1002631_1002823_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_000195429.1|1002908_1004081_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_160194390.1|1004083_1004797_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_001791613.1|1004996_1005089_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000757568.1|1005351_1006278_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	1.7e-12
>prophage 67
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1017795	1019643	2816598		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182654.1|1017795_1019643_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 68
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1023867	1025040	2816598	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_000195429.1|1023867_1025040_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 69
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1029110	1037943	2816598		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|1029110_1030205_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020625.1|1030217_1030757_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455597.1|1030900_1031176_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|1031343_1032750_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863440.1|1032753_1034046_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|1034136_1035114_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|1035117_1036230_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668339.1|1036400_1037027_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957036.1|1037391_1037943_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 70
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1044058	1048438	2816598		Bacillus_virus(50.0%)	5	NA	NA
WP_001289618.1|1044058_1044292_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_160194393.1|1044528_1046247_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1046249_1046516_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505966.1|1046669_1047212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685073.1|1047265_1048438_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	2.4e-75
>prophage 71
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1051617	1066377	2816598		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921973.1|1051617_1053018_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273252.1|1053010_1053817_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_042909151.1|1054081_1055329_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709277.1|1055350_1056829_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_000238664.1|1056843_1057410_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
WP_042909150.1|1057412_1058441_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	42.0	1.2e-62
WP_000483713.1|1058433_1059918_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
WP_000032727.1|1059896_1062086_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	1.0e-140
WP_000666799.1|1062078_1062750_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848350.1|1062751_1063015_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174053.1|1063014_1063719_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_001010406.1|1063722_1064847_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861572.1|1064833_1065316_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
WP_000225837.1|1065516_1066377_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.2	5.3e-40
>prophage 72
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1076420	1080191	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045172698.1|1076420_1080191_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFB0	Staphylococcus_phage	37.9	8.7e-55
>prophage 73
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1083857	1123804	2816598	protease,transposase,bacteriocin	Staphylococcus_phage(28.57%)	41	NA	NA
WP_160194394.1|1083857_1084868_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	4.0e-15
WP_001089095.1|1084949_1086131_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284457.1|1086168_1086498_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|1086735_1087557_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150197.1|1087549_1088353_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526684.1|1088339_1090013_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001804449.1|1089999_1091211_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_001791731.1|1091287_1091392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070966.1|1091542_1092481_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_160194395.1|1092532_1093084_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160194396.1|1093173_1093464_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.0e-07
WP_020978112.1|1093527_1093659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081347.1|1093704_1094664_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|1095151_1095508_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001792676.1|1095596_1095734_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_072361064.1|1095874_1096165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571167.1|1096252_1096894_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-19
WP_000668627.1|1096890_1097211_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870827.1|1097213_1099178_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001797239.1|1099221_1099494_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001790623.1|1099503_1099605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033865.1|1100520_1101123_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000214898.1|1101137_1101314_-	YkvS family protein	NA	NA	NA	NA	NA
WP_000668818.1|1101512_1102499_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000876826.1|1102579_1102798_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000287265.1|1103007_1103577_+	competence protein ComK	NA	NA	NA	NA	NA
WP_000414178.1|1104063_1105575_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000021865.1|1105713_1107072_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_078098579.1|1107088_1109413_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000928413.1|1109631_1110435_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049951.1|1110736_1112299_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
WP_001795833.1|1112298_1112559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000340119.1|1112539_1114024_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_000258645.1|1114456_1115632_+	diglucosyl diacylglycerol synthase	NA	NA	NA	NA	NA
WP_001808062.1|1115591_1116800_+	MFS transporter	NA	NA	NA	NA	NA
WP_000600392.1|1116912_1117422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000889191.1|1117615_1118374_-	esterase family protein	NA	NA	NA	NA	NA
WP_000570700.1|1118518_1120087_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_000933105.1|1120428_1121514_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000933195.1|1121710_1122481_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000195429.1|1122631_1123804_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 74
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1132563	1134372	2816598		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1132563_1134372_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 75
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1140185	1141166	2816598		Planktothrix_phage(100.0%)	1	NA	NA
WP_000427767.1|1140185_1141166_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.6	4.6e-16
>prophage 76
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1145807	1147821	2816598		Planktothrix_phage(100.0%)	2	NA	NA
WP_160194398.1|1145807_1146749_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.3	2.2e-23
WP_000140050.1|1146738_1147821_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 77
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1156415	1163226	2816598		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_042909139.1|1156415_1157561_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047066.1|1157670_1158540_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353955.1|1158598_1161208_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_160194399.1|1161411_1163226_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	3.3e-36
>prophage 78
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1169482	1173136	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_023913617.1|1169482_1173136_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 79
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1183290	1190279	2816598		Staphylococcus_phage(33.33%)	6	NA	NA
WP_160194401.1|1183290_1184220_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	2.2e-39
WP_000138487.1|1184552_1185797_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167314.1|1185905_1187096_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
WP_000838029.1|1187403_1188531_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1188892_1189270_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1189685_1190279_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 80
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1200199	1205438	2816598	transposase	Mycoplasma_phage(33.33%)	5	NA	NA
WP_042909197.1|1200199_1201675_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.2	9.0e-48
WP_000046076.1|1201805_1203014_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1203467_1203827_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
WP_001068337.1|1203839_1204076_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000195429.1|1204265_1205438_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 81
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1209201	1211870	2816598		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1209201_1210416_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_042909198.1|1210412_1211870_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	2.2e-38
>prophage 82
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1224991	1228514	2816598		environmental_halophage(50.0%)	3	NA	NA
WP_160194403.1|1224991_1226233_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.0	4.7e-114
WP_000205572.1|1226347_1227655_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1227752_1228514_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 83
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1232011	1233037	2816598		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571213.1|1232011_1233037_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
>prophage 84
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1236089	1242598	2816598	transposase	Streptococcus_phage(40.0%)	9	NA	NA
WP_000589549.1|1236089_1236446_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001190695.1|1236589_1236910_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1237059_1237599_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150013.1|1237681_1238398_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.6	2.3e-17
WP_000974460.1|1238545_1238968_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000195429.1|1239364_1240537_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000569884.1|1240698_1241193_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255557.1|1241347_1241965_+	amino acid transporter	NA	NA	NA	NA	NA
WP_016187137.1|1242037_1242598_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 85
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1246001	1247245	2816598		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1246001_1246202_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001792695.1|1246558_1247245_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 86
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1256443	1265321	2816598		Staphylococcus_phage(50.0%)	9	NA	NA
WP_000757401.1|1256443_1257172_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	1.4e-17
WP_001057759.1|1257363_1257510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058299.1|1257525_1257849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001085185.1|1259170_1259635_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_031836900.1|1259656_1262029_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.0	2.3e-93
WP_001165961.1|1262062_1262803_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_000556760.1|1262918_1263152_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1263218_1263677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1264016_1265321_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 87
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1274376	1280132	2816598		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1274376_1274964_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1275527_1276472_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1276582_1277578_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369722.1|1277574_1278486_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1279196_1280132_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 88
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1284631	1287478	2816598		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662681.1|1284631_1287478_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
>prophage 89
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1290795	1291635	2816598		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_042909100.1|1290795_1291635_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	43.1	2.0e-12
>prophage 90
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1297713	1303425	2816598		Streptococcus_phage(66.67%)	5	NA	NA
WP_001793589.1|1297713_1298796_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.5	2.0e-44
WP_045173015.1|1299159_1300026_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192949.1|1300169_1300811_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
WP_000258151.1|1300981_1302037_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1302354_1303425_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 91
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1312707	1335883	2816598		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616839.1|1312707_1313469_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
WP_001245577.1|1313465_1314422_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|1314408_1315380_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|1315418_1315574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1315754_1316726_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1316843_1318949_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1318911_1319310_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068503.1|1320110_1320977_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1320996_1321497_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1321837_1323343_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_045173010.1|1323420_1323522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045173009.1|1323612_1324530_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	3.7e-07
WP_000197262.1|1325153_1325696_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663030.1|1325990_1327049_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
WP_000180991.1|1327288_1328803_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589260.1|1328795_1329773_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
WP_000983677.1|1329995_1331777_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525103.1|1331788_1333672_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	6.7e-56
WP_000098285.1|1333942_1335883_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 92
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1339022	1348868	2816598		Pandoravirus(12.5%)	12	NA	NA
WP_001217794.1|1339022_1340174_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	3.5e-23
WP_000604515.1|1340157_1340751_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	43.5	1.2e-38
WP_000446724.1|1341101_1341770_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1341771_1342191_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|1342194_1342908_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637687.1|1343006_1343591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093553.1|1343870_1344311_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1344652_1345126_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1345100_1345787_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_160194405.1|1345786_1346842_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.2	2.1e-14
WP_045173007.1|1346913_1347897_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	4.3e-62
WP_045173005.1|1348028_1348868_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	3.0e-56
>prophage 93
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1360480	1361854	2816598		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_045172985.1|1360480_1361854_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	33.3	5.1e-45
>prophage 94
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1366831	1373111	2816598		Bacillus_phage(33.33%)	6	NA	NA
WP_000857620.1|1366831_1368505_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.4	3.4e-11
WP_000737158.1|1368501_1370133_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	5.2e-12
WP_000469892.1|1370351_1371227_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1371398_1372082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148828.1|1372084_1372543_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_045172980.1|1372544_1373111_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.4	1.8e-20
>prophage 95
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1379824	1380298	2816598		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|1379824_1380298_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 96
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1385561	1386359	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_000731641.1|1385561_1386359_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	9.3e-07
>prophage 97
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1391190	1391952	2816598		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1391190_1391952_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 98
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1396326	1397370	2816598		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_045172966.1|1396326_1397370_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	28.0	4.4e-17
>prophage 99
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1403893	1404691	2816598		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1403893_1404691_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 100
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1407916	1411875	2816598		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1407916_1409644_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793073.1|1410064_1411360_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.6	5.7e-14
WP_000832260.1|1411476_1411875_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 101
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1418809	1419553	2816598		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1418809_1419553_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 102
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1430704	1431265	2816598	integrase	Streptococcus_phage(100.0%)	1	1424858:1424872	1434861:1434875
1424858:1424872	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|1430704_1431265_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|1430704_1431265_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
1434861:1434875	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 103
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1444161	1447515	2816598		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1444161_1445172_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1445670_1446192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180230.1|1446219_1447515_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	2.1e-24
>prophage 104
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1455706	1457029	2816598		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_045172944.1|1455706_1457029_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.1	5.3e-108
>prophage 105
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1468333	1468990	2816598		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1468333_1468990_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 106
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1472631	1475952	2816598		Staphylococcus_phage(50.0%)	2	NA	NA
WP_045172931.1|1472631_1474008_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.1	3.0e-21
WP_000347061.1|1474551_1475952_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 107
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1495205	1495868	2816598		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1495205_1495868_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 108
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1502446	1503634	2816598		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|1502446_1503634_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 109
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1506662	1517616	2816598		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1506662_1508744_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1508866_1509337_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1509402_1509816_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1509913_1510168_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|1510304_1513901_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1514064_1517616_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 110
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1521299	1526082	2816598	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1521299_1521848_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1521860_1522043_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1522098_1522242_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_045174125.1|1522356_1522926_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664738.1|1523006_1523531_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1523530_1524277_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1524284_1524689_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631974.1|1524681_1526082_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.2	1.5e-55
>prophage 111
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1532093	1534550	2816598	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_045174120.1|1532093_1534550_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.4	6.1e-134
>prophage 112
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1554309	1564581	2816598	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1554309_1555797_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1555849_1555942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613715.1|1556335_1556812_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1556808_1557174_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_045174233.1|1557151_1557955_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.3	1.0e-21
WP_000057594.1|1558170_1559103_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1559281_1560163_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_045174227.1|1560391_1562485_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1562741_1563281_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_061823680.1|1563285_1564581_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	8.2e-13
>prophage 113
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1573836	1576301	2816598		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1573836_1574802_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252529.1|1574948_1576301_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 114
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1582187	1585285	2816598	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051132.1|1582187_1584161_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.5e-93
WP_000279926.1|1584445_1585285_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 115
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1589191	1589809	2816598		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1589191_1589809_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 116
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1598747	1600445	2816598		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109040.1|1598747_1600445_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 117
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1617091	1623329	2816598		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170264.1|1617091_1618096_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.2	1.6e-24
WP_000825530.1|1618427_1619270_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000468003.1|1619306_1619966_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_045173140.1|1619969_1620995_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.4e-33
WP_001036657.1|1621288_1622431_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634095.1|1622423_1623329_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	5.0e-49
>prophage 118
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1645394	1648170	2816598		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072580.1|1645394_1646621_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.1	4.8e-47
WP_000028670.1|1646613_1648170_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.3	1.4e-288
>prophage 119
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1662453	1666230	2816598	transposase	Staphylococcus_phage(66.67%)	3	NA	NA
WP_000212549.1|1662453_1662786_-	hypothetical protein	NA	A0A0N9SJ02	Staphylococcus_phage	54.8	1.7e-10
WP_001255834.1|1663285_1664131_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	40.1	5.9e-52
WP_000195429.1|1665057_1666230_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 120
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1669421	1672454	2816598		Hokovirus(50.0%)	2	NA	NA
WP_000424968.1|1669421_1670963_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1670987_1672454_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 121
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1681413	1682937	2816598		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930514.1|1681413_1682937_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.4e-40
>prophage 122
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1690499	1698917	2816598	integrase	Staphylococcus_phage(66.67%)	12	1688465:1688479	1694954:1694968
1688465:1688479	attL	TTTAATGCAATAACA	NA	NA	NA	NA
WP_001808003.1|1690499_1690637_+	hypothetical protein	NA	Q4ZE80	Staphylococcus_phage	75.6	2.8e-12
WP_115304765.1|1690735_1690963_+|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZE80	Staphylococcus_phage	66.0	5.1e-11
WP_001817700.1|1691084_1692023_+	Abi family protein	NA	NA	NA	NA	NA
WP_000897044.1|1692288_1692531_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000934799.1|1692583_1693087_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1693107_1693404_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1693647_1693839_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1693924_1695022_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
1694954:1694968	attR	TGTTATTGCATTAAA	NA	NA	NA	NA
WP_000157345.1|1695033_1695237_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_001077602.1|1695266_1696148_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001566903.1|1696304_1697150_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655707.1|1697813_1698917_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	29.0	4.6e-12
>prophage 123
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1708849	1709692	2816598		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209554.1|1708849_1709692_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	3.8e-11
>prophage 124
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1730907	1733642	2816598		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_045173100.1|1730907_1731930_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_045173099.1|1731907_1732852_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_061823611.1|1732841_1733642_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.9	8.9e-42
>prophage 125
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1751877	1752555	2816598		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911017.1|1751877_1752555_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 126
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1766755	1771186	2816598		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160194420.1|1766755_1771186_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.6e-28
>prophage 127
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1783821	1785480	2816598		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570070.1|1783821_1784481_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736803.1|1784532_1785480_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 128
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1794769	1796206	2816598		Pandoravirus(100.0%)	1	NA	NA
WP_045172772.1|1794769_1796206_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	6.3e-30
>prophage 129
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1799966	1804505	2816598		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1799966_1801706_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_000608821.1|1801965_1802640_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975346.1|1802783_1804505_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 130
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1813832	1814876	2816598		Synechococcus_phage(100.0%)	1	NA	NA
WP_045172781.1|1813832_1814876_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	2.7e-14
>prophage 131
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1822090	1823620	2816598		Vibrio_phage(100.0%)	1	NA	NA
WP_045172784.1|1822090_1823620_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 132
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1832495	1834001	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045172793.1|1832495_1834001_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	4.6e-39
>prophage 133
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1845097	1850456	2816598		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1845097_1847347_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_160194421.1|1847934_1848903_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127985.1|1848899_1850456_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 134
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1860880	1862940	2816598		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818910.1|1860880_1861978_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166919.1|1862361_1862940_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	39.4	9.7e-14
>prophage 135
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1871474	1873067	2816598		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067347.1|1871474_1873067_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.1e-22
>prophage 136
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1891213	1892398	2816598		Klosneuvirus(100.0%)	1	NA	NA
WP_001084432.1|1891213_1892398_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	2.7e-34
>prophage 137
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1897232	1907514	2816598		Tupanvirus(50.0%)	3	NA	NA
WP_160194466.1|1897232_1904408_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.4	1.0e-67
WP_000826856.1|1904854_1906105_-	MFS transporter	NA	NA	NA	NA	NA
WP_045172832.1|1906488_1907514_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 138
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1911052	1914282	2816598		Bacillus_virus(50.0%)	4	NA	NA
WP_000590838.1|1911052_1911793_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	1.9e-38
WP_045172840.1|1912134_1912647_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1912825_1913029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013481.1|1913322_1914282_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 139
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1917623	1920108	2816598		Catovirus(50.0%)	2	NA	NA
WP_000723449.1|1917623_1918769_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.1	3.2e-24
WP_045172848.1|1918845_1920108_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	1.9e-22
>prophage 140
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1926943	1933508	2816598		Catovirus(50.0%)	6	NA	NA
WP_045172857.1|1926943_1928068_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.8	1.3e-128
WP_045172858.1|1928071_1929181_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1929193_1930222_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940790.1|1930211_1932035_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	5.2e-29
WP_000565293.1|1932054_1932819_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037328.1|1932821_1933508_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 141
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1937530	1938706	2816598		Clostridium_phage(100.0%)	1	NA	NA
WP_045172866.1|1937530_1938706_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.6	2.0e-29
>prophage 142
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1944164	1944938	2816598		Planktothrix_phage(100.0%)	1	NA	NA
WP_000078092.1|1944164_1944938_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.7e-26
>prophage 143
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1952972	1954926	2816598	transposase	Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_000874681.1|1952972_1953572_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
WP_000195429.1|1953753_1954926_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 144
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1959841	1964937	2816598		Catovirus(50.0%)	6	NA	NA
WP_001793242.1|1959841_1960822_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
WP_001789407.1|1960891_1961014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183771.1|1961157_1961934_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_045172884.1|1962145_1962784_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|1962966_1963731_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223709.1|1963734_1964937_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	3.9e-09
>prophage 145
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	1973203	1977413	2816598		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1973203_1974184_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1974414_1975407_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_160194428.1|1975422_1976418_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136643.1|1976414_1977413_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.9	9.8e-14
>prophage 146
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2013356	2020434	2816598	transposase	Staphylococcus_phage(80.0%)	7	NA	NA
WP_000816129.1|2013356_2014424_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.5	3.5e-09
WP_001105087.1|2014560_2014821_+	persulfide-sensing transcriptional repressor CstR	NA	NA	NA	NA	NA
WP_000355844.1|2014820_2015576_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000195429.1|2016070_2017243_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000393259.1|2017299_2017692_+	GNAT family N-acetyltransferase	NA	A0A0N7GFH7	Staphylococcus_phage	100.0	6.9e-72
WP_001028144.1|2017692_2019132_+	aminoglycoside O-phosphotransferase APH(2'')-Ia	NA	A0A1X9I6C2	Streptococcus_phage	100.0	3.8e-285
WP_000195429.1|2019261_2020434_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 147
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2025379	2035382	2816598		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2025379_2026180_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_045172593.1|2026568_2027357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060140.1|2027357_2028692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|2028684_2030511_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|2030523_2031225_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2032420_2033704_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2033981_2035382_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 148
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2042071	2052449	2816598	transposase,tRNA	Bacillus_virus(40.0%)	6	NA	NA
WP_000884328.1|2042071_2043358_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.4	9.2e-89
WP_000177458.1|2043736_2045251_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.5e-90
WP_000195429.1|2045534_2046707_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_000449218.1|2046908_2047721_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819083.1|2047808_2050478_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	2.7e-119
WP_000255586.1|2050514_2052449_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
>prophage 149
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2062531	2069062	2816598		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_045172596.1|2062531_2063371_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	1.7e-06
WP_000491382.1|2063822_2064176_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779136.1|2064243_2064639_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054118.1|2064870_2065440_+	helix-turn-helix domain-containing protein	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|2065557_2065758_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_045172598.1|2066149_2066341_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_045172599.1|2066433_2068314_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|2068303_2069062_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 150
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2083315	2085028	2816598		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138657.1|2083315_2085028_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 151
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2090656	2091670	2816598		Faustovirus(100.0%)	1	NA	NA
WP_045172606.1|2090656_2091670_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.9	9.6e-09
>prophage 152
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2104057	2104750	2816598		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|2104057_2104750_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 153
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2131422	2133282	2816598		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125614.1|2131422_2133282_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 154
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2158732	2160484	2816598		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143426.1|2158732_2159620_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	3.3e-05
WP_000923760.1|2159728_2160484_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 155
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2163904	2164402	2816598		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2163904_2164402_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 156
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2169450	2171834	2816598		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071717.1|2169450_2171301_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.2e-235
WP_000173329.1|2171297_2171834_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.6	1.3e-41
>prophage 157
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2176711	2181426	2816598	holin	Klosneuvirus(50.0%)	4	NA	NA
WP_000066521.1|2176711_2178421_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2178698_2178911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708240.1|2179190_2179634_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172340.1|2179827_2181426_+	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
>prophage 158
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2185486	2186824	2816598		Klosneuvirus(100.0%)	1	NA	NA
WP_045172628.1|2185486_2186824_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.4	3.9e-18
>prophage 159
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2215925	2219715	2816598		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000751267.1|2215925_2216627_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	4.0e-38
WP_000996736.1|2216902_2217391_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000379830.1|2217903_2219715_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.3	9.7e-36
>prophage 160
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2222815	2223988	2816598	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_000195429.1|2222815_2223988_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 161
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2229469	2233394	2816598		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_153926934.1|2229469_2230468_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076661.1|2230557_2230764_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024143.1|2230985_2233394_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	41.0	4.9e-128
>prophage 162
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2242634	2245670	2816598	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058988.1|2242634_2244740_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
WP_000455987.1|2245148_2245670_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
>prophage 163
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2253014	2259383	2816598		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062658.1|2253014_2254754_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.3	2.7e-35
WP_000473675.1|2255054_2257121_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2257485_2257896_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240662.1|2257937_2258282_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228169.1|2258414_2259383_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	5.2e-12
>prophage 164
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2268967	2269960	2816598		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161536.1|2268967_2269960_-	D-lactate dehydrogenase	NA	M1HYB0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-36
>prophage 165
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2279241	2279937	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382904.1|2279241_2279937_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	3.0e-38
>prophage 166
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2296662	2297835	2816598	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_000195429.1|2296662_2297835_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 167
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2301510	2302377	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_000721336.1|2301510_2302377_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	1.3e-78
>prophage 168
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2310177	2314911	2816598		Streptococcus_phage(100.0%)	3	NA	NA
WP_160194438.1|2310177_2311986_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.7	1.3e-93
WP_000446878.1|2312103_2313573_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
WP_001033636.1|2313672_2314911_+	DNA cytosine methyltransferase	NA	A0A141E0F9	Streptococcus_phage	29.5	8.4e-31
>prophage 169
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2322769	2323465	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_000217471.1|2322769_2323465_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	37.5	2.3e-09
>prophage 170
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2326893	2327712	2816598		Moumouvirus(100.0%)	1	NA	NA
WP_000824941.1|2326893_2327712_+	SDR family oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	27.7	5.0e-08
>prophage 171
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2335580	2337138	2816598		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173870.1|2335580_2336396_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	2.3e-13
WP_000590515.1|2336388_2337138_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 172
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2344273	2348700	2816598		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_006191024.1|2344273_2344936_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	7.9e-20
WP_006191020.1|2344928_2345705_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_160194439.1|2346098_2347286_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700929.1|2347347_2348700_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 173
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2353428	2355287	2816598		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948981.1|2353428_2354655_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|2354651_2355287_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 174
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2373014	2379221	2816598		Bacillus_phage(66.67%)	5	NA	NA
WP_064131794.1|2373014_2374157_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779360.1|2374424_2374811_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2374944_2375052_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_045172654.1|2375699_2377463_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	6.5e-37
WP_000486494.1|2377487_2379221_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 175
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2382682	2388453	2816598		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971547.1|2382682_2383798_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	7.1e-21
WP_160194441.1|2383808_2384501_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200945.1|2384511_2384979_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_000783428.1|2385030_2386008_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916713.1|2386009_2386957_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.1	1.2e-138
WP_000594519.1|2387523_2388453_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 176
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2396400	2397132	2816598		Planktothrix_phage(100.0%)	1	NA	NA
WP_000615461.1|2396400_2397132_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.6	1.0e-31
>prophage 177
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2403014	2404187	2816598	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_000195429.1|2403014_2404187_-|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 178
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2415038	2416598	2816598		Escherichia_phage(100.0%)	1	NA	NA
WP_000692645.1|2415038_2416598_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 179
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2438074	2439109	2816598		Bacillus_virus(100.0%)	1	NA	NA
WP_000655972.1|2438074_2439109_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 180
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2448960	2455103	2816598	transposase	Hokovirus(25.0%)	5	NA	NA
WP_045172664.1|2448960_2450334_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	2.3e-13
WP_000249497.1|2450326_2451001_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761399.1|2451136_2452192_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229920.1|2452191_2452857_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
WP_106888601.1|2453924_2455103_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.9	1.4e-54
>prophage 181
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2458994	2460203	2816598		Salmonella_phage(100.0%)	1	NA	NA
WP_000999131.1|2458994_2460203_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	3.9e-33
>prophage 182
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2472297	2473197	2816598		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524832.1|2472297_2473197_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 183
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2480567	2480987	2816598		Bacillus_phage(100.0%)	1	NA	NA
WP_045174195.1|2480567_2480987_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.1	1.0e-36
>prophage 184
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2487040	2487922	2816598		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730043.1|2487040_2487922_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	2.2e-62
>prophage 185
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2495800	2496436	2816598		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2495800_2496436_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 186
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2502026	2503205	2816598	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_106888601.1|2502026_2503205_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.9	1.4e-54
>prophage 187
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2511564	2518001	2816598	transposase	Staphylococcus_phage(60.0%)	6	NA	NA
WP_078103498.1|2511564_2512203_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_045173640.1|2512871_2513996_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	5.5e-13
WP_045173642.1|2514087_2515041_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.6	3.2e-30
WP_000737705.1|2515402_2515903_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
WP_000206114.1|2516139_2516562_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_000195429.1|2516828_2518001_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
>prophage 188
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2521152	2521983	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160194450.1|2521152_2521983_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	44.3	1.4e-05
>prophage 189
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2540964	2541570	2816598		Planktothrix_phage(100.0%)	1	NA	NA
WP_000913021.1|2540964_2541570_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.3	8.5e-21
>prophage 190
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2553653	2556821	2816598		Leptospira_phage(100.0%)	1	NA	NA
WP_045173679.1|2553653_2556821_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	6.2e-62
>prophage 191
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2580515	2582182	2816598		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_045173697.1|2580515_2581325_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	4.8e-19
WP_045173699.1|2581321_2582182_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 192
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2585732	2591101	2816598		Yellowstone_lake_phycodnavirus(50.0%)	5	NA	NA
WP_000130145.1|2585732_2587397_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_000186134.1|2587433_2588138_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_045173705.1|2588501_2588927_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044362.1|2589220_2590036_+	hydrolase	NA	NA	NA	NA	NA
WP_045173708.1|2590246_2591101_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	37.9	3.8e-06
>prophage 193
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2594481	2596791	2816598		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001015500.1|2594481_2595330_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
WP_000875476.1|2595562_2595766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557494.1|2596050_2596791_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 194
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2603111	2604524	2816598		Pandoravirus(100.0%)	1	NA	NA
WP_000169224.1|2603111_2604524_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 195
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2608492	2610055	2816598		Vibrio_phage(100.0%)	1	NA	NA
WP_000792342.1|2608492_2610055_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 196
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2620258	2621227	2816598		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2620258_2621227_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 197
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2637111	2638020	2816598		Klosneuvirus(100.0%)	1	NA	NA
WP_045173417.1|2637111_2638020_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 198
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2641611	2649033	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045173424.1|2641611_2649033_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	23.9	3.6e-20
>prophage 199
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2655289	2658109	2816598		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334463.1|2655289_2657095_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
WP_000908177.1|2657326_2658109_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.7e-08
>prophage 200
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2670715	2674547	2816598		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2670715_2671159_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_045173446.1|2671279_2671990_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083311.1|2672304_2672967_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242318.1|2673245_2674547_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	2.7e-133
>prophage 201
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2682484	2684095	2816598		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2682484_2684095_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 202
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2691897	2699647	2816598		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2691897_2692497_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2692497_2693574_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248734.1|2693560_2694397_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_072362259.1|2694429_2695527_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|2695523_2695943_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654185.1|2696049_2696574_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2696600_2697839_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2697866_2698496_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723418.1|2698519_2699647_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 203
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2710047	2710410	2816598		Staphylococcus_phage(100.0%)	1	NA	NA
WP_154459863.1|2710047_2710410_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	9.3e-15
>prophage 204
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2716404	2717052	2816598		Moumouvirus(100.0%)	1	NA	NA
WP_001187630.1|2716404_2717052_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 205
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2724252	2725773	2816598		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2724252_2725773_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 206
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2731461	2733489	2816598		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_045173491.1|2731461_2733489_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.2	1.3e-25
>prophage 207
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2738639	2742023	2816598		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2738639_2739002_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_160194457.1|2739350_2740352_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2740470_2740797_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190829.1|2740798_2741278_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041103.1|2741252_2742023_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 208
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2755695	2760419	2816598		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094580.1|2755695_2757225_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_160194459.1|2757254_2758259_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2758395_2758650_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_160194460.1|2758649_2760419_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	3.1e-63
>prophage 209
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2764179	2778027	2816598	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159053.1|2764179_2765205_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.6	5.8e-62
WP_044290669.1|2765306_2766917_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	26.9	4.3e-19
WP_001792272.1|2767005_2767134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602069.1|2767278_2769207_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	30.4	2.4e-53
WP_001283612.1|2769459_2770095_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_072414299.1|2770449_2771478_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581077.1|2771537_2771762_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_045174166.1|2771969_2773220_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.8e-40
WP_160194461.1|2773402_2774353_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141427.1|2774501_2775986_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.6	6.8e-19
WP_001253302.1|2775982_2776942_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688498.1|2777310_2778027_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	3.0e-25
>prophage 210
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2785171	2788487	2816598		uncultured_virus(66.67%)	4	NA	NA
WP_000917289.1|2785171_2785456_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240642.1|2785531_2787148_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
WP_000201397.1|2787684_2787864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000216894.1|2787860_2788487_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	44.5	7.0e-42
>prophage 211
NZ_CP047822	Staphylococcus aureus strain UP_1278 chromosome, complete genome	2816598	2794375	2816129	2816598	integrase	Staphylococcus_phage(100.0%)	39	2797215:2797229	2806141:2806155
WP_000791404.1|2794375_2795428_+	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.6	2.5e-36
WP_000595401.1|2795449_2796466_+	bi-component leukocidin LukGH subunit G	NA	A0A2I6PER8	Staphylococcus_phage	29.3	2.3e-26
2797215:2797229	attL	CTATCATTATCGAAT	NA	NA	NA	NA
WP_000857198.1|2797584_2798622_-|integrase	site-specific integrase	integrase	A0A1X9H022	Staphylococcus_phage	100.0	2.6e-179
WP_000825947.1|2798680_2799145_-	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000705248.1|2799244_2799427_-	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_000591749.1|2799630_2799972_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000759682.1|2799977_2800910_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|2800925_2801639_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_001801500.1|2801601_2801775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061823675.1|2801771_2802035_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	98.9	2.1e-40
WP_001025404.1|2802050_2802266_+	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
WP_000128907.1|2802254_2802584_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001148605.1|2802634_2803387_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_001148862.1|2803402_2803600_+	hypothetical protein	NA	O80075	Staphylococcus_phage	87.7	3.5e-24
WP_000762521.1|2803586_2803967_-	DUF2513 domain-containing protein	NA	Q9T1Z5	Staphylococcus_phage	100.0	1.2e-68
WP_061823677.1|2804021_2804345_+	DUF771 domain-containing protein	NA	A0A075LYF5	Staphylococcus_phage	99.1	5.1e-57
WP_000048129.1|2804341_2804503_+	DUF1270 family protein	NA	A0A1P8L6G0	Staphylococcus_phage	100.0	1.9e-20
WP_000165371.1|2804597_2804900_+	DUF2482 family protein	NA	A0A1P8L6F8	Staphylococcus_phage	100.0	7.0e-48
WP_000291510.1|2804904_2805165_+	DUF1108 family protein	NA	A0A1P8L6F5	Staphylococcus_phage	100.0	5.2e-44
WP_001205732.1|2805173_2805437_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000138475.1|2807390_2808311_+	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
2806141:2806155	attR	ATTCGATAATGATAG	NA	NA	NA	NA
WP_071621397.1|2808391_2809009_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000934769.1|2809009_2809480_+	single-stranded DNA-binding protein	NA	A0A0E3T9H6	Staphylococcus_phage	100.0	5.7e-81
WP_000148329.1|2809509_2810403_+	DnaD domain-containing protein	NA	A0A0E3TAG7	Staphylococcus_phage	100.0	1.1e-141
WP_000338528.1|2810409_2810628_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401964.1|2810636_2811041_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0E3XBN4	Staphylococcus_phage	100.0	1.4e-72
WP_000101270.1|2811053_2811422_+	hypothetical protein	NA	A0A0E3XD52	Staphylococcus_phage	100.0	6.7e-53
WP_000131377.1|2811425_2811668_+	hypothetical protein	NA	R9QT89	Staphylococcus_phage	100.0	3.0e-41
WP_000693615.1|2811681_2812068_+	hypothetical protein	NA	I1W655	Staphylococcus_phage	100.0	4.1e-69
WP_000982708.1|2812255_2812705_+	hypothetical protein	NA	A0A2I6PDH2	Staphylococcus_phage	100.0	9.3e-81
WP_001105621.1|2812701_2812986_+	hypothetical protein	NA	E9LT36	Staphylococcus_phage	100.0	2.7e-46
WP_001065083.1|2812978_2813227_+	DUF1024 family protein	NA	A0A2K9VBU0	Staphylococcus_phage	100.0	3.1e-38
WP_000185669.1|2813219_2813756_+	hypothetical protein	NA	R4IG63	Staphylococcus_phage	100.0	9.4e-96
WP_000195810.1|2813792_2813999_+	DUF1381 domain-containing protein	NA	S4V684	Staphylococcus_phage	100.0	7.6e-30
WP_000595267.1|2813995_2814145_+	hypothetical protein	NA	R9QSU6	Staphylococcus_phage	100.0	1.8e-17
WP_001005262.1|2814303_2814954_+	hypothetical protein	NA	D2JLD8	Staphylococcus_phage	100.0	8.9e-117
WP_000265043.1|2814953_2815154_+	DUF1514 domain-containing protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|2815181_2815598_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988330.1|2815829_2816129_+	HNH endonuclease	NA	G4KNP8	Staphylococcus_phage	100.0	4.6e-52
