The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	0	35818	2949972	capsid,protease,portal,terminase,holin,head,transposase,tail	Staphylococcus_phage(96.55%)	36	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154559.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268735.1|6484_7129_+|tail	phage tail protein	tail	A0EWZ9	Staphylococcus_phage	100.0	3.8e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_000582190.1|14062_17848_+	hypothetical protein	NA	A0EX05	Staphylococcus_phage	100.0	0.0e+00
WP_001153681.1|17837_17990_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040259.1|18036_18324_+	hypothetical protein	NA	G4KNR2	Staphylococcus_phage	100.0	9.9e-44
WP_000340977.1|18379_18754_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_000750406.1|19174_19948_+	staphylococcal enterotoxin type A	NA	A0EX09	Staphylococcus_phage	100.0	2.2e-146
WP_011447039.1|20056_20233_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|20285_20393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|20444_20699_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|20710_21466_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000919350.1|21656_22148_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_020444758.1|22674_23133_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000727649.1|23227_23677_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|24362_24713_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|24765_25026_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|25336_25516_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_000669728.1|26473_28543_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000277741.1|28840_30487_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_001068528.1|30734_32021_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|32220_32319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681966.1|32560_32737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|32994_33375_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991315.1|33371_34268_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645732.1|34268_34949_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|34945_35818_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
>prophage 2
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	41063	41465	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|41063_41465_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 3
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	45661	47692	2949972		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|45661_46222_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275719.1|46594_47692_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
>prophage 4
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	51722	54006	2949972		Bacillus_virus(100.0%)	2	NA	NA
WP_000284434.1|51722_53192_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
WP_000040861.1|53184_54006_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 5
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	57696	64474	2949972		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|57696_58992_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|59100_59403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272063.1|59585_60278_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|60274_62467_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774552.1|62470_64474_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
>prophage 6
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	71703	76731	2949972		Catovirus(33.33%)	5	NA	NA
WP_001231458.1|71703_72651_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001147874.1|72731_74093_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.0	1.5e-102
WP_000548777.1|74262_74793_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140179.1|75039_76110_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|76176_76731_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 7
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	80184	80598	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001643743.1|80184_80598_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.5	3.0e-17
>prophage 8
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	85579	86209	2949972		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|85579_86209_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 9
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	92238	135308	2949972	capsid,portal,plate,terminase,holin,head,tail,integrase	Staphylococcus_phage(72.46%)	69	88758:88775	124362:124379
88758:88775	attL	GTTAATCAAGGATTATTA	NA	NA	NA	NA
WP_001145722.1|92238_93285_-|integrase	site-specific integrase	integrase	Q4ZB10	Staphylococcus_virus	100.0	5.5e-201
WP_000337827.1|93397_93577_+	hypothetical protein	NA	Q4ZBP0	Staphylococcus_phage	100.0	3.7e-25
WP_000392183.1|93556_94489_-	hypothetical protein	NA	A0EX19	Staphylococcus_virus	100.0	6.7e-174
WP_000525004.1|94672_95134_-	hypothetical protein	NA	A0A2K9VBR7	Staphylococcus_phage	100.0	1.2e-83
WP_000333630.1|95146_95461_-	helix-turn-helix transcriptional regulator	NA	A0A0N9BAW4	Staphylococcus_phage	100.0	9.8e-53
WP_001121116.1|95612_95849_+	helix-turn-helix transcriptional regulator	NA	A0A0N9BAY2	Staphylococcus_phage	100.0	1.5e-37
WP_000438352.1|95862_96042_+	hypothetical protein	NA	A0A0N9BAV3	Staphylococcus_phage	100.0	1.7e-25
WP_000394410.1|96142_96625_-	hypothetical protein	NA	A0A0N9BAX2	Staphylococcus_phage	100.0	1.1e-82
WP_000933365.1|97070_97256_+	helix-turn-helix transcriptional regulator	NA	A0A0H4IP57	Staphylococcus_phage	100.0	1.3e-25
WP_031783118.1|97257_97998_+	oxidoreductase	NA	B7T097	Staphylococcus_virus	100.0	6.3e-135
WP_000395455.1|98173_98404_-	hypothetical protein	NA	C8CGY3	Staphylococcus_phage	100.0	2.3e-35
WP_000594789.1|98474_98696_+	hypothetical protein	NA	B2ZYU8	Staphylococcus_phage	100.0	8.7e-32
WP_000066011.1|98688_98850_+	DUF1270 domain-containing protein	NA	Q4ZAZ7	Staphylococcus_virus	100.0	2.5e-20
WP_000291090.1|98946_99207_+	DUF1108 family protein	NA	Q4ZDA1	Staphylococcus_virus	100.0	1.2e-43
WP_001077280.1|99216_99438_+	DUF2483 domain-containing protein	NA	A0A0E3TAJ7	Staphylococcus_phage	100.0	2.4e-34
WP_000139720.1|99430_100054_+	DUF1071 domain-containing protein	NA	A0A2H4PQQ6	Staphylococcus_phage	100.0	1.4e-114
WP_000934782.1|100053_100482_+	single-stranded DNA-binding protein	NA	A0A0E3XC62	Staphylococcus_phage	90.8	1.7e-63
WP_160191355.1|100495_101158_+	hypothetical protein	NA	Q4ZD97	Staphylococcus_virus	98.2	1.1e-125
WP_000240900.1|101163_101928_+	AP2 domain-containing protein	NA	A0A2I6PDA5	Staphylococcus_phage	98.4	5.0e-143
WP_000139436.1|101920_102664_+	alpha/beta hydrolase	NA	A0A2I6PDA9	Staphylococcus_phage	99.6	2.5e-115
WP_000803056.1|102674_103454_+	ATP-binding protein	NA	Q9G022	Staphylococcus_virus	100.0	2.4e-145
WP_001123688.1|103621_103843_+	DUF3269 family protein	NA	Q9G021	Staphylococcus_phage	100.0	1.3e-35
WP_000049812.1|103853_104258_+	DUF1064 domain-containing protein	NA	A0A059T5A5	Staphylococcus_phage	97.0	3.5e-71
WP_001187263.1|104262_104448_+	DUF3113 family protein	NA	Q8SDV9	Staphylococcus_phage	100.0	2.4e-27
WP_000772916.1|104448_104706_+	helix-turn-helix transcriptional regulator	NA	Q4ZBU1	Staphylococcus_virus	100.0	4.1e-41
WP_000029379.1|104717_105077_+	hypothetical protein	NA	Q8SDV7	Staphylococcus_phage	98.3	3.8e-61
WP_001622146.1|105077_105326_+	hypothetical protein	NA	C8CH00	Staphylococcus_phage	96.3	2.0e-40
WP_001062709.1|105340_105733_+	hypothetical protein	NA	A0A2I6PE39	Staphylococcus_phage	100.0	1.6e-68
WP_000983947.1|105729_105921_+	hypothetical protein	NA	Q4ZBT5	Staphylococcus_virus	100.0	1.5e-27
WP_160191356.1|105920_106352_+	acetyltransferase	NA	Q4ZBT4	Staphylococcus_virus	98.6	1.4e-73
WP_001065103.1|106344_106581_+	DUF1024 family protein	NA	A0A0H3U313	Staphylococcus_phage	98.7	1.2e-34
WP_000700108.1|106570_106813_+	hypothetical protein	NA	A0A2I6PF40	Staphylococcus_phage	100.0	3.7e-36
WP_000181819.1|106805_107339_+	dUTP pyrophosphatase	NA	A0A0H3U2T1	Staphylococcus_phage	100.0	1.6e-95
WP_001209219.1|107375_107549_+	hypothetical protein	NA	S4SVD5	Staphylococcus_phage	100.0	3.6e-25
WP_000195781.1|107565_107802_+	DUF1381 domain-containing protein	NA	M1T303	Staphylococcus_phage	96.2	5.3e-35
WP_000483477.1|107826_108063_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_001798107.1|108046_108439_+	hypothetical protein	NA	A7TWI1	Staphylococcus_phage	98.5	3.1e-64
WP_160191433.1|108438_108612_+	transcriptional regulator	NA	Q4ZA36	Staphylococcus_virus	91.2	1.6e-20
WP_000286968.1|108612_109014_+	hypothetical protein	NA	A0A2H4PQK5	Staphylococcus_phage	100.0	5.6e-69
WP_000594088.1|109366_109861_+|terminase	terminase	terminase	A0A0N9BAX3	Staphylococcus_phage	100.0	3.4e-84
WP_001037584.1|109853_111077_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0H3U2R6	Staphylococcus_phage	99.5	6.4e-241
WP_000177426.1|111073_112498_+|portal	phage portal protein	portal	A0A0E3T9I6	Staphylococcus_phage	100.0	4.8e-272
WP_000184131.1|112466_113420_+	hypothetical protein	NA	A0A0N7E0U6	Staphylococcus_phage	99.4	6.6e-177
WP_000346033.1|113421_113628_+	hypothetical protein	NA	A0A0N9BB04	Staphylococcus_phage	100.0	3.2e-28
WP_001019221.1|113730_114315_+	DUF4355 domain-containing protein	NA	A0A2H4JDY6	uncultured_Caudovirales_phage	100.0	7.3e-78
WP_000235168.1|114331_115246_+|capsid	phage major capsid protein	capsid	A0A0H3U2U7	Staphylococcus_phage	100.0	1.2e-170
WP_000177351.1|115406_115757_+|head,tail	phage head-tail adapter protein	head,tail	A0A0H3U2R5	Staphylococcus_phage	100.0	1.9e-60
WP_000483041.1|115768_116104_+|head	phage head closure protein	head	A0A0E3TAH8	Staphylococcus_phage	100.0	8.8e-60
WP_001151323.1|116090_116498_+	HK97 gp10 family phage protein	NA	A0A0E3T8J0	Staphylococcus_phage	100.0	3.4e-74
WP_000270188.1|116510_116936_+	DUF3168 domain-containing protein	NA	A0A0E3XBP2	Staphylococcus_phage	99.3	3.6e-74
WP_000057582.1|116936_117494_+|tail	tail protein	tail	Q4ZBQ8	Staphylococcus_phage	100.0	8.2e-103
WP_000134337.1|117559_118066_+	hypothetical protein	NA	Q4ZBQ7	Staphylococcus_phage	100.0	2.7e-92
WP_000880588.1|118110_118395_+	hypothetical protein	NA	A0A0E3TAI0	Staphylococcus_phage	98.9	1.5e-44
WP_000379439.1|118398_121542_+	hypothetical protein	NA	A0A059T7Q4	Staphylococcus_phage	93.8	0.0e+00
WP_042907189.1|121556_122498_+|tail	phage tail protein	tail	Q4ZBQ4	Staphylococcus_phage	99.4	2.2e-180
WP_160191357.1|122508_124395_+	peptidase	NA	A1KXA8	Staphylococcus_virus	99.7	0.0e+00
124362:124379	attR	GTTAATCAAGGATTATTA	NA	NA	NA	NA
WP_000323268.1|124407_126306_+	hypothetical protein	NA	Q4ZB26	Staphylococcus_virus	98.4	0.0e+00
WP_000259622.1|126305_128129_+|plate	BppU family phage baseplate upper protein	plate	Q4ZDD5	Staphylococcus_virus	95.9	5.3e-284
WP_000406973.1|128128_128506_+	DUF2977 domain-containing protein	NA	Q4ZB23	Staphylococcus_virus	100.0	5.3e-61
WP_001800921.1|128515_128689_+	XkdX family protein	NA	A0A059T7K6	Staphylococcus_phage	100.0	1.3e-27
WP_000466784.1|128729_129029_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000524041.1|129165_131040_+	CHAP domain-containing protein	NA	Q4ZB20	Staphylococcus_virus	100.0	0.0e+00
WP_160191358.1|131052_132225_+|plate	BppU family phage baseplate upper protein	plate	A0A2I6PCW8	Staphylococcus_phage	99.7	1.4e-197
WP_000398864.1|132230_132626_+	hypothetical protein	NA	A9CRD5	Staphylococcus_phage	99.2	4.7e-68
WP_160191359.1|132681_133119_+|holin	phage holin	holin	A7YGY0	Staphylococcus_virus	97.2	2.9e-71
WP_001148115.1|133099_134545_+	CHAP domain-containing protein	NA	Q4ZB16	Staphylococcus_virus	99.6	9.1e-295
WP_001788502.1|134787_134940_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
WP_000139423.1|135010_135121_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
WP_000382163.1|135107_135308_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
>prophage 10
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	147018	149687	2949972		Tupanvirus(50.0%)	2	NA	NA
WP_000129645.1|147018_148476_+	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
WP_000613541.1|148472_149687_+	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
>prophage 11
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	153730	157358	2949972		Lake_Baikal_phage(50.0%)	3	NA	NA
WP_001143497.1|153730_154090_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
WP_000046076.1|154543_155752_+	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001009683.1|155882_157358_+	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	1.2e-47
>prophage 12
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	167292	174342	2949972		Aureococcus_anophage(33.33%)	6	NA	NA
WP_000035058.1|167292_167886_+	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
WP_001067294.1|168300_168678_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000838047.1|169039_170167_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000167321.1|170474_171665_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.3e-33
WP_000138487.1|171773_173018_+	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000185311.1|173412_174342_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.5	1.8e-38
>prophage 13
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	184497	191957	2949972	transposase	Bacillus_phage(50.0%)	4	NA	NA
WP_000154949.1|184497_188151_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
WP_000670753.1|188316_189219_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000902813.1|189544_189934_+	YisL family protein	NA	NA	NA	NA	NA
WP_000277741.1|190310_191957_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 14
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	195222	202033	2949972		Pseudomonas_phage(33.33%)	4	NA	NA
WP_001044234.1|195222_197037_+	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	8.8e-37
WP_000353950.1|197239_199849_+	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001047061.1|199907_200777_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000619360.1|200887_202033_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
>prophage 15
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	210618	263599	2949972	protease,tRNA,holin,transposase	Bacillus_virus(18.18%)	48	NA	NA
WP_000140043.1|210618_211701_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.4e-18
WP_000786746.1|211690_212632_+	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_000197096.1|212650_214306_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000517177.1|214517_214784_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000121211.1|214775_215723_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_073392975.1|215837_217307_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067041.1|217357_218344_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
WP_000427776.1|218346_219327_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_001574526.1|219319_219970_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001180271.1|219981_220863_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_094409958.1|220951_222519_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_160191362.1|222814_224461_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.5	1.2e-290
WP_000448933.1|224487_225477_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000258003.1|225771_226167_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_001217735.1|226537_227257_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_000959276.1|227377_228364_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_000082722.1|228411_230220_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
WP_000896691.1|230679_231486_-	DsbA family protein	NA	NA	NA	NA	NA
WP_000214067.1|231508_231874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224620.1|231977_232571_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_001242102.1|232756_233104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077683.1|233120_233756_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_001270834.1|233772_234582_+	NAD kinase	NA	NA	NA	NA	NA
WP_000669938.1|234578_235433_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000062404.1|235453_236839_+	magnesium transporter	NA	NA	NA	NA	NA
WP_000395156.1|236848_238693_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_000933195.1|238970_239741_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000933105.1|239936_241022_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000570704.1|241363_242932_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_000889176.1|243074_243833_+	esterase family protein	NA	NA	NA	NA	NA
WP_001060545.1|243998_244724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160191363.1|244725_245577_+	base excision DNA repair protein	NA	NA	NA	NA	NA
WP_000600387.1|246318_246828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001794241.1|246940_248149_-	MFS transporter	NA	NA	NA	NA	NA
WP_000258649.1|248108_249284_-	diglucosyl diacylglycerol synthase	NA	NA	NA	NA	NA
WP_000340133.1|249715_251200_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_001794242.1|251180_251441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049957.1|251440_253003_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
WP_000928413.1|253304_254108_+	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001794169.1|254326_256651_+|protease	serine protease	protease	W5SAB9	Pithovirus	26.8	4.0e-10
WP_000021872.1|256667_258026_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_000414169.1|258164_259676_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000287265.1|260164_260734_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000876825.1|260943_261162_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000668820.1|261242_262229_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000214898.1|262427_262604_+	YkvS family protein	NA	NA	NA	NA	NA
WP_001033867.1|262618_263221_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_099119695.1|263521_263599_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
>prophage 16
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	266848	267490	2949972		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571191.1|266848_267490_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	5.0e-19
>prophage 17
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	272119	272410	2949972		Enterococcus_phage(100.0%)	1	NA	NA
WP_001794164.1|272119_272410_-	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.6e-07
>prophage 18
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	280713	281787	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000676568.1|280713_281787_-	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	31.7	1.1e-15
>prophage 19
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	285453	289227	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160191364.1|285453_289227_-	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFB0	Staphylococcus_phage	38.0	1.1e-54
>prophage 20
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	299464	314227	2949972		Synechococcus_phage(22.22%)	14	NA	NA
WP_000225845.1|299464_300325_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
WP_000861576.1|300525_301008_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_001010391.1|300994_302119_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000174050.1|302122_302827_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
WP_000848351.1|302826_303090_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666808.1|303091_303763_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000032734.1|303755_305945_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
WP_000483716.1|305923_307408_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.4	8.5e-46
WP_000030814.1|307400_308429_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
WP_000238673.1|308431_308998_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000709288.1|309012_310491_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
WP_001101912.1|310512_311760_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000273254.1|312027_312834_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000921981.1|312826_314227_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.4e-10
>prophage 21
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	317406	321786	2949972		Streptococcus_phage(50.0%)	5	NA	NA
WP_000685075.1|317406_318579_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.6	1.5e-74
WP_000505964.1|318632_319175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000437472.1|319328_319595_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000040041.1|319597_321316_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_001289622.1|321552_321786_-	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	1.3e-09
>prophage 22
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	327900	328452	2949972		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957036.1|327900_328452_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 23
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	333093	336736	2949972		Erysipelothrix_phage(50.0%)	4	NA	NA
WP_000260117.1|333093_334500_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000455584.1|334670_334946_+	UPF0223 family protein	NA	NA	NA	NA	NA
WP_001020627.1|335089_335629_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000433551.1|335641_336736_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
>prophage 24
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	358377	361288	2949972		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000757584.1|358377_359307_-	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	6.5e-12
WP_001049150.1|359545_359800_+	YlbG family protein	NA	NA	NA	NA	NA
WP_000814565.1|359802_360192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001263793.1|360261_360804_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000401377.1|360805_361288_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
>prophage 25
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	373267	374326	2949972	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|373267_374326_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 26
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	379204	383762	2949972		Bodo_saltans_virus(33.33%)	3	NA	NA
WP_000161937.1|379204_380917_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
WP_001249264.1|380926_383275_+	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_001018928.1|383447_383762_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
>prophage 27
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	395196	395547	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000669541.1|395196_395547_+	complement inhibitor SCIN-C	NA	A7TWS0	Staphylococcus_phage	50.0	1.9e-20
>prophage 28
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	399007	401183	2949972	transposase	Staphylococcus_virus(100.0%)	2	NA	NA
WP_001801391.1|399007_399235_+	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.9e-18
WP_000277741.1|399536_401183_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 29
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	410094	410292	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245800.1|410094_410292_+	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	1.2e-19
>prophage 30
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	429648	432402	2949972	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384706.1|429648_432402_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	2.1e-90
>prophage 31
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	437333	441944	2949972		Enterobacteria_phage(33.33%)	4	NA	NA
WP_001178615.1|437333_438641_+	uracil transporter	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
WP_001016166.1|438668_439550_+	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_000767018.1|439567_440842_+	dihydroorotase	NA	NA	NA	NA	NA
WP_001190910.1|440843_441944_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	9.6e-63
>prophage 32
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	445911	446523	2949972		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|445911_446523_+	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 33
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	449837	452094	2949972		Abalone_herpesvirus(50.0%)	3	NA	NA
WP_000368225.1|449837_450461_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
WP_000933956.1|450460_450679_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000722165.1|450894_452094_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
>prophage 34
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	457103	458039	2949972	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|457103_458039_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 35
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	461186	463181	2949972		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|461186_463181_+	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 36
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	473551	475609	2949972		Trichoplusia_ni_ascovirus(33.33%)	3	NA	NA
WP_000167269.1|473551_474286_+	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
WP_000426914.1|474528_474762_+	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000043237.1|474877_475609_+	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
>prophage 37
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	488993	502664	2949972	protease,tRNA	Emiliania_huxleyi_virus(16.67%)	11	NA	NA
WP_000176401.1|488993_489761_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
WP_001020801.1|489869_491036_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000110252.1|491057_491966_+	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.3e-17
WP_001041658.1|492192_493311_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000672864.1|493338_494583_+	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_000620184.1|494754_495627_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_001557331.1|495800_497876_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_160191365.1|498031_499336_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_061839172.1|499756_500653_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	1.0e-30
WP_000072681.1|500649_501195_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000379051.1|501260_502664_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	6.4e-27
>prophage 38
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	507438	508209	2949972		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|507438_508209_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 39
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	512482	524297	2949972	tRNA	Clostridium_phage(33.33%)	9	NA	NA
WP_000139497.1|512482_516793_+	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
WP_000036631.1|517082_517550_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000097463.1|517570_518746_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000727423.1|518766_519051_+	YlxR family protein	NA	NA	NA	NA	NA
WP_000020856.1|519047_519365_+	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000043642.1|519369_521487_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000097322.1|521873_522224_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000282296.1|522393_523311_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000864182.1|523325_524297_+	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
>prophage 40
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	529437	534981	2949972		Mycobacterium_phage(33.33%)	4	NA	NA
WP_160191434.1|529437_531681_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	2.4e-84
WP_001293307.1|531685_532399_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017431615.1|532429_533695_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.5	3.5e-40
WP_000664777.1|533694_534981_+	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
>prophage 41
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	539180	540224	2949972		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|539180_540224_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 42
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	549638	556120	2949972		Cafeteria_roenbergensis_virus(33.33%)	4	NA	NA
WP_000073334.1|549638_552257_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	3.8e-41
WP_000516249.1|552269_554279_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	4.1e-59
WP_001077635.1|554284_554827_+	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_001103747.1|555301_556120_+	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
>prophage 43
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	562063	562540	2949972		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|562063_562540_-	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 44
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	567611	574485	2949972	transposase	Staphylococcus_phage(50.0%)	8	NA	NA
WP_001659797.1|567611_567809_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
WP_078367270.1|568100_568637_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	1.3e-28
WP_000746372.1|568617_569121_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001255381.1|569229_569586_-	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000810443.1|569641_570232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000247474.1|570238_571285_-	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000681139.1|571274_573122_-	membrane protein	NA	NA	NA	NA	NA
WP_001251205.1|573126_574485_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.9	4.0e-42
>prophage 45
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	581868	588474	2949972	capsid,transposase	Staphylococcus_phage(80.0%)	8	NA	NA
WP_001071312.1|581868_582081_+	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
WP_001002343.1|582377_582584_+	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_031788482.1|583285_583396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|583788_583974_+	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_000121213.1|584185_585133_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	1.6e-183
WP_000477487.1|585559_585976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000585095.1|587496_587748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077670290.1|587808_588474_+|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	53.0	4.6e-60
>prophage 46
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	592411	592747	2949972	head	Staphylococcus_phage(100.0%)	1	NA	NA
WP_077670291.1|592411_592747_+|head	phage head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	60.4	2.6e-27
>prophage 47
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	596701	600977	2949972		Anomala_cuprea_entomopoxvirus(50.0%)	6	NA	NA
WP_001794121.1|596701_597610_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	9.8e-21
WP_000603961.1|597578_598310_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000670311.1|598313_599405_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_160191368.1|599401_600004_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001027143.1|600116_600305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000841344.1|600443_600977_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
>prophage 48
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	611113	616769	2949972		Tupanvirus(25.0%)	7	NA	NA
WP_000089857.1|611113_612631_+	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	2.7e-92
WP_001265708.1|612721_612871_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001085657.1|613324_613594_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_000688127.1|613750_614728_+	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001791425.1|614724_614829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380738.1|614902_615766_+	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.2e-15
WP_001208760.1|616145_616769_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
>prophage 49
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	620918	622040	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691309.1|620918_622040_+	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.1	2.1e-09
>prophage 50
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	625709	627356	2949972		Vibrio_phage(100.0%)	1	NA	NA
WP_001088983.1|625709_627356_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	1.9e-22
>prophage 51
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	632973	637367	2949972		Bacillus_virus(50.0%)	2	NA	NA
WP_001574370.1|632973_634965_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
WP_001289586.1|634964_637367_+	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
>prophage 52
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	646636	650202	2949972	transposase	Staphylococcus_virus(50.0%)	3	NA	NA
WP_000277741.1|646636_648283_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_001123276.1|648606_648792_-	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_000283027.1|648939_650202_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	1.7e-95
>prophage 53
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	654520	656873	2949972		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000604802.1|654520_655087_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.8	1.7e-23
WP_000153717.1|656090_656873_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	1.2e-27
>prophage 54
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	664354	665056	2949972		Tupanvirus(100.0%)	1	NA	NA
WP_000571253.1|664354_665056_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.0e-13
>prophage 55
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	668470	671924	2949972		Streptococcus_phage(50.0%)	3	NA	NA
WP_000077549.1|668470_670285_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	2.3e-154
WP_000974850.1|670424_671066_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000079448.1|671072_671924_-	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
>prophage 56
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	676349	677951	2949972		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|676349_677951_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 57
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	685793	690819	2949972	lysis	Yellowstone_lake_phycodnavirus(33.33%)	7	NA	NA
WP_000216956.1|685793_687059_+	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.0	4.0e-12
WP_000876206.1|687294_687696_-	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000809131.1|687892_688093_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000269923.1|688263_688572_-	DUF1033 family protein	NA	NA	NA	NA	NA
WP_001215907.1|688733_689003_+	acylphosphatase	NA	NA	NA	NA	NA
WP_001794103.1|689021_689651_+|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_000138413.1|689682_690819_+	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
>prophage 58
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	694354	695146	2949972		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|694354_695146_-	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 59
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	701514	703526	2949972		Hokovirus(50.0%)	2	NA	NA
WP_000166793.1|701514_702870_-	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
WP_000192137.1|702866_703526_-	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
>prophage 60
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	706934	717391	2949972	transposase	Staphylococcus_phage(50.0%)	14	NA	NA
WP_000342154.1|706934_708425_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	1.7e-22
WP_000121211.1|708663_709611_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000801007.1|709683_709905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000473654.1|709904_710405_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000913317.1|710416_710845_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000159899.1|710837_711371_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000166055.1|711456_712296_-	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	5.1e-48
WP_000175746.1|712310_712790_-	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000934885.1|712989_713946_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000995290.1|714369_714807_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000404628.1|714822_715947_-	virulence factor C	NA	NA	NA	NA	NA
WP_001165814.1|715984_716236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001814377.1|716247_716442_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000282169.1|716686_717391_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.3	1.9e-11
>prophage 61
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	755752	756631	2949972		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|755752_756631_-	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 62
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	766094	766721	2949972		Bacillus_phage(100.0%)	1	NA	NA
WP_001108885.1|766094_766721_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 63
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	770412	850702	2949972	capsid,plate,tRNA,protease,portal,holin,terminase,head,tail,integrase	Staphylococcus_phage(81.58%)	102	806192:806219	850786:850813
WP_000362222.1|770412_771099_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
WP_000858795.1|771427_772720_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
WP_000525060.1|773041_775735_-	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000049917.1|775758_776730_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000361536.1|776716_777919_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	1.4e-35
WP_000690024.1|777923_779066_-	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000839927.1|779309_779627_-	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_001827022.1|779962_780643_-	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000154479.1|780714_781302_-	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_000005208.1|781291_781867_-	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	4.6e-08
WP_000389521.1|781880_783125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245891.1|783131_784430_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000776318.1|784439_785504_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_001269937.1|785529_786696_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	1.5e-34
WP_000442480.1|787164_787614_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001819897.1|787705_788650_-	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000774679.1|788666_789392_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_000450555.1|789394_789967_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_001043863.1|790397_790670_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000161753.1|790840_791839_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000165530.1|791855_793166_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_160191375.1|793387_794563_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_001791199.1|794819_795011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791200.1|795127_795244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000644393.1|795274_795934_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000681744.1|796010_796979_+	asparaginase	NA	NA	NA	NA	NA
WP_001174260.1|797093_798080_-	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_016186859.1|798240_798327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000069298.1|798464_799925_-	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_000902107.1|800077_801457_-	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
WP_001163814.1|801446_802400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151997.1|802507_802756_+	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001186908.1|802861_803407_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_001799520.1|803685_803850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476878.1|804054_804963_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000913238.1|805020_805926_-	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000333560.1|806015_806363_-	hypothetical protein	NA	Q4ZCJ7	Staphylococcus_virus	98.2	1.5e-25
806192:806219	attL	AAATAAACATATCATCATAATGAGATGG	NA	NA	NA	NA
WP_000051376.1|806478_807093_-	hypothetical protein	NA	C8CH40	Staphylococcus_phage	100.0	1.0e-109
WP_000861038.1|807731_808487_-	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000611512.1|808498_808753_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_031790389.1|808804_808912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011447039.1|808964_809141_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_000466784.1|809293_809593_-	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000916020.1|809638_809803_-	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_001166599.1|809795_810185_-	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000067132.1|810184_811651_-|plate	BppU family phage baseplate upper protein	plate	B5WZQ8	Staphylococcus_phage	100.0	7.6e-257
WP_000429558.1|811650_813561_-	minor structural protein	NA	A0A2I6PEQ9	Staphylococcus_phage	100.0	0.0e+00
WP_000179858.1|813576_813867_-	hypothetical protein	NA	U5U457	Staphylococcus_phage	100.0	2.1e-49
WP_000384474.1|813866_815450_-	peptidase	NA	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
WP_001190533.1|815458_816283_-|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_160191376.1|816282_822483_-|tail	phage tail tape measure protein	tail	A0A2I6PE73	Staphylococcus_phage	99.1	0.0e+00
WP_000438833.1|822496_822655_-	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_000589167.1|822696_823047_-	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000169127.1|823104_823560_-	Ig domain-containing protein	NA	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
WP_000807536.1|823651_824293_-|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_001023802.1|824327_824723_-	DUF3168 domain-containing protein	NA	A0A2I6PDD8	Staphylococcus_phage	100.0	2.6e-66
WP_000110020.1|824723_825125_-	hypothetical protein	NA	A0A2I6PDD3	Staphylococcus_phage	100.0	6.2e-68
WP_000395501.1|825121_825454_-	hypothetical protein	NA	A0A2I6PDD6	Staphylococcus_phage	100.0	6.2e-58
WP_000050973.1|825465_825744_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_031776039.1|825812_826976_-|capsid	phage major capsid protein	capsid	A0A0K1LKB5	Staphylococcus_phage	100.0	2.7e-217
WP_064277996.1|826987_827761_-|protease	Clp protease ClpP	protease	M1TAZ4	Staphylococcus_phage	99.6	2.7e-136
WP_064277997.1|827744_828983_-|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	99.8	1.5e-234
WP_160191377.1|828987_830679_-|terminase	terminase large subunit	terminase	A0A2I6PE44	Staphylococcus_phage	98.6	0.0e+00
WP_000778932.1|830668_830974_-|terminase	terminase	terminase	A0A2I6PE27	Staphylococcus_phage	100.0	2.9e-49
WP_000160687.1|831099_831414_-	HNH endonuclease	NA	A0A2I6PDR3	Staphylococcus_phage	90.4	1.4e-51
WP_000528514.1|831570_832008_-	transcriptional regulator	NA	B5WZN8	Staphylococcus_phage	100.0	2.7e-77
WP_001793488.1|832020_833388_-	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	100.0	1.7e-263
WP_000665205.1|833368_833659_-	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
WP_015978074.1|833793_833898_+	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	2.7e-12
WP_000884879.1|834000_836448_-	hypothetical protein	NA	B5WZN5	Staphylococcus_phage	99.9	0.0e+00
WP_000265258.1|836500_836701_-	DUF1514 domain-containing protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
WP_000595237.1|836768_836921_-	transcriptional activator RinB	NA	B5WZN3	Staphylococcus_phage	100.0	2.6e-19
WP_000483477.1|836913_837150_-	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_000195806.1|837174_837411_-	DUF1381 domain-containing protein	NA	C8CH06	Staphylococcus_phage	98.7	3.1e-35
WP_000185703.1|837447_837984_-	hypothetical protein	NA	S4V978	Staphylococcus_phage	98.9	1.0e-94
WP_000028425.1|837976_838159_-	hypothetical protein	NA	D2JGL7	Staphylococcus_phage	100.0	2.6e-26
WP_001065110.1|838148_838400_-	DUF1024 family protein	NA	W5R8J0	Staphylococcus_phage	100.0	4.9e-39
WP_000132193.1|838414_838657_-	hypothetical protein	NA	A0A2D1G5G2	Staphylococcus_phage	98.8	5.6e-40
WP_000235324.1|838671_838872_-	hypothetical protein	NA	A0A2I6PEM3	Staphylococcus_phage	100.0	2.5e-30
WP_000022730.1|838874_839132_-	DUF3310 domain-containing protein	NA	A0A2I6PEN5	Staphylococcus_phage	98.8	1.3e-42
WP_000113974.1|839131_839533_-	PVL family protein	NA	A0A2I6PEL5	Staphylococcus_phage	100.0	1.2e-68
WP_001164629.1|839532_839718_-	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_160191378.1|839730_841683_-	DNA polymerase	NA	M9QT72	Staphylococcus_phage	99.2	0.0e+00
WP_000645048.1|841750_842308_-	DUF2815 family protein	NA	A0A2I6PEP8	Staphylococcus_phage	100.0	1.8e-97
WP_103152147.1|842333_843500_-	DUF2800 domain-containing protein	NA	R4WAL0	Staphylococcus_phage	99.5	2.0e-220
WP_000985976.1|843496_843859_-	hypothetical protein	NA	A0A2I6PF03	Staphylococcus_phage	100.0	4.9e-56
WP_160191379.1|843873_844197_-	TrmB family transcriptional regulator	NA	B7T0G4	Staphylococcus_virus	99.1	8.5e-52
WP_001285948.1|844275_844437_-	DUF1270 domain-containing protein	NA	A9CR58	Staphylococcus_phage	98.1	1.1e-20
WP_001124194.1|844449_844713_-	helix-turn-helix domain-containing protein	NA	M1SVD9	Staphylococcus_phage	100.0	1.9e-46
WP_001097552.1|844739_844955_-	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
WP_001128433.1|845009_845375_+	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001025401.1|845343_845589_-	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_000773059.1|845655_846036_+	DUF2513 domain-containing protein	NA	Q4ZCQ5	Staphylococcus_virus	100.0	5.8e-68
WP_001148860.1|846022_846220_-	hypothetical protein	NA	A7TWF5	Staphylococcus_phage	100.0	4.6e-24
WP_000362644.1|846289_846502_+	hypothetical protein	NA	D2JGJ1	Staphylococcus_phage	100.0	7.6e-33
WP_001614929.1|846706_847150_-	hypothetical protein	NA	D2JGI9	Staphylococcus_phage	100.0	1.2e-75
WP_000338187.1|847173_847395_-	DUF739 family protein	NA	A0A1X9H090	Staphylococcus_phage	100.0	7.6e-36
WP_001586918.1|847554_848325_+	helix-turn-helix domain-containing protein	NA	A7TW89	Staphylococcus_phage	96.9	1.6e-136
WP_000705240.1|848394_848577_+	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
WP_001795334.1|848613_848760_+	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	100.0	1.2e-16
WP_000191466.1|848756_849371_-	hypothetical protein	NA	A0A2I6PEZ0	Staphylococcus_phage	100.0	6.7e-106
WP_000264751.1|849496_850702_+|integrase	site-specific integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	100.0	7.7e-223
850786:850813	attR	AAATAAACATATCATCATAATGAGATGG	NA	NA	NA	NA
>prophage 64
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	853956	860106	2949972		Hokovirus(33.33%)	7	NA	NA
WP_000987777.1|853956_855708_-	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_000064078.1|855688_856414_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000159577.1|856546_857284_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000368652.1|857276_857819_-	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000273367.1|857811_858543_-	segregation and condensation protein A	NA	NA	NA	NA	NA
WP_001183424.1|858634_859141_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000447733.1|859218_860106_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
>prophage 65
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	865770	867255	2949972		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|865770_867255_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 66
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	874083	877672	2949972	transposase	Paenibacillus_phage(50.0%)	2	NA	NA
WP_094409958.1|874083_875650_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000193707.1|876265_877672_-	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 67
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	884500	891070	2949972		Indivirus(66.67%)	6	NA	NA
WP_001291540.1|884500_885922_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	6.6e-40
WP_000942216.1|886072_887752_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001124985.1|887767_888220_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000183386.1|888650_889532_-	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	5.8e-10
WP_000159866.1|889509_889740_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_001286928.1|889732_891070_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
>prophage 68
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	898590	901402	2949972		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000202178.1|898590_900063_-	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.1	1.4e-80
WP_160191381.1|900055_901402_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	4.8e-64
>prophage 69
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	906946	907570	2949972		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|906946_907570_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 70
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	913742	927470	2949972	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_000863556.1|913742_914342_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
WP_001095260.1|914617_915028_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_000564316.1|915014_915878_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001213908.1|915919_916705_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000924211.1|916830_917721_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001062173.1|917730_919077_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
WP_000683921.1|919190_920291_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
WP_000624581.1|920293_920971_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_001283055.1|921101_922208_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_001217253.1|922431_924231_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
WP_000411298.1|924291_925110_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001794939.1|925120_925744_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001030080.1|926078_927470_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
>prophage 71
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	930524	931472	2949972		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117769.1|930524_931472_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	4.9e-47
>prophage 72
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	937941	941049	2949972		Catovirus(50.0%)	2	NA	NA
WP_001119020.1|937941_939081_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	6.8e-27
WP_000034716.1|939216_941049_-	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
>prophage 73
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	944484	950648	2949972		Streptococcus_phage(33.33%)	5	NA	NA
WP_000368338.1|944484_946308_-	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
WP_001274017.1|946653_946905_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_001282570.1|946949_947924_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_000953291.1|947980_950128_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
WP_000439692.1|950186_950648_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
>prophage 74
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	967112	1002710	2949972	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_000648617.1|967112_967736_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
WP_160191384.1|967735_969004_-	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000137775.1|969015_969939_-	U32 family peptidase	NA	NA	NA	NA	NA
WP_000342267.1|969941_970580_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000134779.1|970864_971173_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000939059.1|971187_971616_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000426912.1|971619_971880_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000734077.1|971942_974573_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_001283316.1|974915_977393_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000567025.1|977394_978063_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_000066097.1|978744_979863_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000409167.1|979863_981006_-	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000985898.1|981315_982329_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000008061.1|982565_982712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000752909.1|982751_982934_-	CsbD family protein	NA	NA	NA	NA	NA
WP_000704122.1|983033_983456_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000102741.1|983540_984815_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.9	6.3e-106
WP_000682640.1|984975_985749_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_001791215.1|985748_985877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044796.1|986209_987976_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_000590826.1|987991_989254_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000717800.1|989714_990590_-	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000869979.1|990586_991039_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001058583.1|991050_993240_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000364542.1|993667_994186_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_000595001.1|994207_996481_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
WP_000749802.1|996683_998963_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_001160682.1|999237_999498_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_160191385.1|999516_1000656_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	9.3e-85
WP_001019178.1|1000678_1001704_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001005767.1|1001705_1002710_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 75
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1012825	1015456	2949972	tRNA	Catovirus(100.0%)	1	NA	NA
WP_160191386.1|1012825_1015456_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 76
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1025022	1036176	2949972	tRNA,protease	Bacillus_virus(20.0%)	12	NA	NA
WP_000472293.1|1025022_1026285_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
WP_000127572.1|1026435_1027737_-	trigger factor	NA	NA	NA	NA	NA
WP_001790560.1|1027784_1027895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280014.1|1027899_1028829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000032653.1|1028847_1029456_-	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	36.4	1.7e-21
WP_001138360.1|1029597_1029954_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001125540.1|1030000_1030201_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001791219.1|1030229_1030757_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	5.3e-11
WP_000049150.1|1030985_1032479_-	amino acid permease	NA	NA	NA	NA	NA
WP_000435132.1|1032905_1034843_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_016186894.1|1035067_1035163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000808621.1|1035255_1036176_-	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
>prophage 77
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1040090	1048255	2949972		Bacillus_virus(25.0%)	5	NA	NA
WP_001114454.1|1040090_1040963_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
WP_001038301.1|1040978_1043609_-	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	1.8e-46
WP_000849445.1|1043901_1045389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073392727.1|1045889_1047551_-	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.0	1.7e-34
WP_000080025.1|1047553_1048255_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
>prophage 78
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1053138	1054896	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160191389.1|1053138_1054896_-	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	3.3e-41
>prophage 79
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1059828	1063026	2949972		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226930.1|1059828_1063026_-	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	5.5e-135
>prophage 80
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1080608	1084744	2949972		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_000174275.1|1080608_1081352_-	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-18
WP_000553919.1|1081431_1081878_+	OsmC family protein	NA	NA	NA	NA	NA
WP_000291426.1|1081992_1083153_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_070045867.1|1083139_1084744_+	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
>prophage 81
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1088512	1091143	2949972	tRNA,protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001279341.1|1088512_1089787_+|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
WP_000186029.1|1089880_1091143_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
>prophage 82
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1097747	1099454	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862084.1|1097747_1099454_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 83
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1108026	1113354	2949972		Mycobacterium_phage(50.0%)	3	NA	NA
WP_000118301.1|1108026_1111851_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
WP_001048371.1|1111871_1112468_-	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_001091387.1|1112496_1113354_-	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
>prophage 84
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1118937	1122874	2949972		Enterobacteria_phage(50.0%)	4	NA	NA
WP_000690628.1|1118937_1119531_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.1	1.1e-41
WP_001284656.1|1119794_1120175_-	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_001096374.1|1120164_1121922_-	beta-lactam sensor/signal transducer BlaR1	NA	NA	NA	NA	NA
WP_000733283.1|1122028_1122874_+	BlaZ family penicillin-hydrolyzing class A beta-lactamase PC1	NA	A0A1B0VBP7	Salmonella_phage	34.0	1.5e-31
>prophage 85
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1131011	1201302	2949972	protease,tRNA	Staphylococcus_phage(93.18%)	65	NA	NA
WP_000284993.1|1131011_1132280_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
WP_001050520.1|1132396_1138966_-	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	88.7	1.7e-295
WP_000836472.1|1139289_1139601_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
WP_001108722.1|1139622_1142037_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
WP_001025064.1|1142328_1143510_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
WP_000526541.1|1143619_1144573_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_000764425.1|1144569_1145133_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
WP_000757543.1|1145251_1145653_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000266099.1|1146225_1147053_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014937042.1|1147055_1147175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001196351.1|1147286_1148288_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
WP_001008556.1|1148409_1148874_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	97.4	1.9e-68
WP_001159032.1|1148886_1150068_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_000493891.1|1150078_1150711_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
WP_001819953.1|1150717_1151749_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
WP_001261683.1|1152241_1153744_-	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
WP_000221181.1|1154386_1154701_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	97.1	1.7e-52
WP_000989104.1|1154700_1155993_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
WP_001032833.1|1156079_1156934_-	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000384171.1|1157209_1157434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000671059.1|1157632_1158103_+	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
WP_001152695.1|1158215_1158659_+	competence protein ComK	NA	NA	NA	NA	NA
WP_001030476.1|1158645_1159089_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
WP_001168914.1|1159386_1160022_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000492901.1|1160188_1160809_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001096494.1|1161266_1161980_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_000091444.1|1162238_1162541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200542.1|1162795_1163161_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000623481.1|1163157_1163511_+	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
WP_000453316.1|1163760_1164594_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
WP_000366165.1|1164805_1165714_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
WP_000933819.1|1165838_1167032_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000109909.1|1167403_1168996_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
WP_001801476.1|1169288_1170035_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
WP_000672010.1|1170039_1170513_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
WP_000718107.1|1170578_1170836_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000778539.1|1170832_1171834_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
WP_000348372.1|1171838_1173317_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
WP_016186903.1|1173475_1173931_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
WP_001794016.1|1174232_1174883_+	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
WP_000070654.1|1174963_1175959_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
WP_000669038.1|1176034_1176661_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
WP_000627550.1|1176701_1177046_+	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
WP_000414222.1|1177143_1177716_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_001093574.1|1177864_1179232_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000125075.1|1179231_1179801_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
WP_000747804.1|1179993_1180440_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001801861.1|1180890_1180986_+	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_001791232.1|1181108_1181210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001037039.1|1181384_1181828_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000731421.1|1181827_1182271_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000182553.1|1183237_1185658_+	polysaccharide lyase 8 family protein	NA	NA	NA	NA	NA
WP_001819963.1|1185783_1186143_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000619920.1|1186370_1186820_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_001053714.1|1186862_1188473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095390.1|1188487_1188787_+	secretion protein	NA	NA	NA	NA	NA
WP_000413389.1|1189048_1190866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072622.1|1190902_1192057_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
WP_001794363.1|1192049_1193789_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	3.2e-286
WP_001038742.1|1193968_1194688_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
WP_001038734.1|1194857_1195574_-|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	97.1	6.6e-129
WP_001038766.1|1196619_1197336_-|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
WP_001039022.1|1197459_1198179_-|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
WP_000595635.1|1199193_1199709_+	membrane protein	NA	NA	NA	NA	NA
WP_000711499.1|1199955_1201302_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.1	2.5e-65
>prophage 86
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1204556	1208836	2949972		Staphylococcus_phage(80.0%)	5	NA	NA
WP_001235656.1|1204556_1205312_-	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	40.8	2.3e-39
WP_000764684.1|1205350_1206136_-	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
WP_000721567.1|1206289_1207018_-	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
WP_000821649.1|1207052_1207772_-	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
WP_147612242.1|1208053_1208836_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	38.6	8.7e-34
>prophage 87
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1216699	1217440	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|1216699_1217440_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 88
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1227028	1227373	2949972		Streptococcus_phage(100.0%)	1	NA	NA
WP_153155018.1|1227028_1227373_-	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 89
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1236275	1316179	2949972	capsid,plate,tRNA,portal,terminase,holin,head,tail,integrase	Staphylococcus_phage(69.86%)	96	1306584:1306600	1321846:1321862
WP_000181394.1|1236275_1236746_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_001793998.1|1236750_1237893_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_001144055.1|1238028_1238757_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
WP_000649898.1|1238743_1240201_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_160191391.1|1240459_1241521_-	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_000110011.1|1250365_1250812_-	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_000869463.1|1250908_1251859_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_000939530.1|1251864_1252320_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_001011603.1|1252400_1253690_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_001236371.1|1253982_1255077_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_000597238.1|1255267_1257004_-	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
WP_000251252.1|1257294_1257837_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_000284755.1|1258139_1259177_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000379091.1|1259328_1260306_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000886472.1|1260566_1261403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000535849.1|1261411_1262929_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000435806.1|1262943_1263258_-	YfhH family protein	NA	NA	NA	NA	NA
WP_001124422.1|1263235_1264054_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000830380.1|1264314_1265124_-	monofunctional peptidoglycan glycosyltransferase SgtB	NA	NA	NA	NA	NA
WP_000163281.1|1265464_1265980_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001005407.1|1266109_1266271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100250272.1|1266617_1266698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000382163.1|1267021_1267222_-	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
WP_000139423.1|1267208_1267319_-	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
WP_001788502.1|1267389_1267542_-	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
WP_001148115.1|1267784_1269230_-	CHAP domain-containing protein	NA	Q4ZB16	Staphylococcus_virus	99.6	9.1e-295
WP_160191359.1|1269210_1269648_-|holin	phage holin	holin	A7YGY0	Staphylococcus_virus	97.2	2.9e-71
WP_000398864.1|1269703_1270099_-	hypothetical protein	NA	A9CRD5	Staphylococcus_phage	99.2	4.7e-68
WP_160191358.1|1270104_1271277_-|plate	BppU family phage baseplate upper protein	plate	A0A2I6PCW8	Staphylococcus_phage	99.7	1.4e-197
WP_000524041.1|1271289_1273164_-	CHAP domain-containing protein	NA	Q4ZB20	Staphylococcus_virus	100.0	0.0e+00
WP_000466784.1|1273300_1273600_-	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_001800921.1|1273640_1273814_-	XkdX family protein	NA	A0A059T7K6	Staphylococcus_phage	100.0	1.3e-27
WP_000406973.1|1273823_1274201_-	DUF2977 domain-containing protein	NA	Q4ZB23	Staphylococcus_virus	100.0	5.3e-61
WP_000259622.1|1274200_1276024_-|plate	BppU family phage baseplate upper protein	plate	Q4ZDD5	Staphylococcus_virus	95.9	5.3e-284
WP_000323268.1|1276023_1277922_-	hypothetical protein	NA	Q4ZB26	Staphylococcus_virus	98.4	0.0e+00
WP_160191357.1|1277934_1279821_-	peptidase	NA	A1KXA8	Staphylococcus_virus	99.7	0.0e+00
WP_042907189.1|1279831_1280773_-|tail	phage tail protein	tail	Q4ZBQ4	Staphylococcus_phage	99.4	2.2e-180
WP_000379439.1|1280787_1283931_-	hypothetical protein	NA	A0A059T7Q4	Staphylococcus_phage	93.8	0.0e+00
WP_000880588.1|1283934_1284219_-	hypothetical protein	NA	A0A0E3TAI0	Staphylococcus_phage	98.9	1.5e-44
WP_000134337.1|1284263_1284770_-	hypothetical protein	NA	Q4ZBQ7	Staphylococcus_phage	100.0	2.7e-92
WP_000057582.1|1284835_1285393_-|tail	tail protein	tail	Q4ZBQ8	Staphylococcus_phage	100.0	8.2e-103
WP_000270188.1|1285393_1285819_-	DUF3168 domain-containing protein	NA	A0A0E3XBP2	Staphylococcus_phage	99.3	3.6e-74
WP_001151323.1|1285831_1286239_-	HK97 gp10 family phage protein	NA	A0A0E3T8J0	Staphylococcus_phage	100.0	3.4e-74
WP_000483041.1|1286225_1286561_-|head	phage head closure protein	head	A0A0E3TAH8	Staphylococcus_phage	100.0	8.8e-60
WP_000177351.1|1286572_1286923_-|head,tail	phage head-tail adapter protein	head,tail	A0A0H3U2R5	Staphylococcus_phage	100.0	1.9e-60
WP_000235168.1|1287083_1287998_-|capsid	phage major capsid protein	capsid	A0A0H3U2U7	Staphylococcus_phage	100.0	1.2e-170
WP_001019221.1|1288014_1288599_-	DUF4355 domain-containing protein	NA	A0A2H4JDY6	uncultured_Caudovirales_phage	100.0	7.3e-78
WP_000346033.1|1288701_1288908_-	hypothetical protein	NA	A0A0N9BB04	Staphylococcus_phage	100.0	3.2e-28
WP_000184131.1|1288909_1289863_-	hypothetical protein	NA	A0A0N7E0U6	Staphylococcus_phage	99.4	6.6e-177
WP_000177426.1|1289831_1291256_-|portal	phage portal protein	portal	A0A0E3T9I6	Staphylococcus_phage	100.0	4.8e-272
WP_001037584.1|1291252_1292476_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0H3U2R6	Staphylococcus_phage	99.5	6.4e-241
WP_000594088.1|1292468_1292963_-|terminase	terminase	terminase	A0A0N9BAX3	Staphylococcus_phage	100.0	3.4e-84
WP_000286968.1|1293315_1293717_-	hypothetical protein	NA	A0A2H4PQK5	Staphylococcus_phage	100.0	5.6e-69
WP_160191433.1|1293717_1293891_-	transcriptional regulator	NA	Q4ZA36	Staphylococcus_virus	91.2	1.6e-20
WP_001798107.1|1293890_1294283_-	hypothetical protein	NA	A7TWI1	Staphylococcus_phage	98.5	3.1e-64
WP_000483477.1|1294266_1294503_-	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_000195781.1|1294527_1294764_-	DUF1381 domain-containing protein	NA	M1T303	Staphylococcus_phage	96.2	5.3e-35
WP_001209219.1|1294780_1294954_-	hypothetical protein	NA	S4SVD5	Staphylococcus_phage	100.0	3.6e-25
WP_000181819.1|1294990_1295524_-	dUTP pyrophosphatase	NA	A0A0H3U2T1	Staphylococcus_phage	100.0	1.6e-95
WP_000700108.1|1295516_1295759_-	hypothetical protein	NA	A0A2I6PF40	Staphylococcus_phage	100.0	3.7e-36
WP_001065103.1|1295748_1295985_-	DUF1024 family protein	NA	A0A0H3U313	Staphylococcus_phage	98.7	1.2e-34
WP_160191356.1|1295977_1296409_-	acetyltransferase	NA	Q4ZBT4	Staphylococcus_virus	98.6	1.4e-73
WP_000983947.1|1296408_1296600_-	hypothetical protein	NA	Q4ZBT5	Staphylococcus_virus	100.0	1.5e-27
WP_001062709.1|1296596_1296989_-	hypothetical protein	NA	A0A2I6PE39	Staphylococcus_phage	100.0	1.6e-68
WP_001622146.1|1297003_1297252_-	hypothetical protein	NA	C8CH00	Staphylococcus_phage	96.3	2.0e-40
WP_000029379.1|1297252_1297612_-	hypothetical protein	NA	Q8SDV7	Staphylococcus_phage	98.3	3.8e-61
WP_000772916.1|1297623_1297881_-	helix-turn-helix transcriptional regulator	NA	Q4ZBU1	Staphylococcus_virus	100.0	4.1e-41
WP_001187263.1|1297881_1298067_-	DUF3113 family protein	NA	Q8SDV9	Staphylococcus_phage	100.0	2.4e-27
WP_000049812.1|1298071_1298476_-	DUF1064 domain-containing protein	NA	A0A059T5A5	Staphylococcus_phage	97.0	3.5e-71
WP_001123688.1|1298486_1298708_-	DUF3269 family protein	NA	Q9G021	Staphylococcus_phage	100.0	1.3e-35
WP_000803056.1|1298875_1299655_-	ATP-binding protein	NA	Q9G022	Staphylococcus_virus	100.0	2.4e-145
WP_000139436.1|1299665_1300409_-	alpha/beta hydrolase	NA	A0A2I6PDA9	Staphylococcus_phage	99.6	2.5e-115
WP_000240900.1|1300401_1301166_-	AP2 domain-containing protein	NA	A0A2I6PDA5	Staphylococcus_phage	98.4	5.0e-143
WP_160191355.1|1301171_1301834_-	hypothetical protein	NA	Q4ZD97	Staphylococcus_virus	98.2	1.1e-125
WP_000934782.1|1301847_1302276_-	single-stranded DNA-binding protein	NA	A0A0E3XC62	Staphylococcus_phage	90.8	1.7e-63
WP_000139720.1|1302275_1302899_-	DUF1071 domain-containing protein	NA	A0A2H4PQQ6	Staphylococcus_phage	100.0	1.4e-114
WP_001077280.1|1302891_1303113_-	DUF2483 domain-containing protein	NA	A0A0E3TAJ7	Staphylococcus_phage	100.0	2.4e-34
WP_000291090.1|1303122_1303383_-	DUF1108 family protein	NA	Q4ZDA1	Staphylococcus_virus	100.0	1.2e-43
WP_000066011.1|1303479_1303641_-	DUF1270 domain-containing protein	NA	Q4ZAZ7	Staphylococcus_virus	100.0	2.5e-20
WP_000594789.1|1303633_1303855_-	hypothetical protein	NA	B2ZYU8	Staphylococcus_phage	100.0	8.7e-32
WP_000395455.1|1303925_1304156_+	hypothetical protein	NA	C8CGY3	Staphylococcus_phage	100.0	2.3e-35
WP_031844841.1|1304331_1305075_-	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	3.6e-138
WP_000394410.1|1305707_1306190_+	hypothetical protein	NA	A0A0N9BAX2	Staphylococcus_phage	100.0	1.1e-82
WP_000438352.1|1306290_1306470_-	hypothetical protein	NA	A0A0N9BAV3	Staphylococcus_phage	100.0	1.7e-25
WP_033860313.1|1306484_1306928_-	hypothetical protein	NA	A0A0H3U2S6	Staphylococcus_phage	98.6	9.8e-75
1306584:1306600	attL	TTCACTTTCACTCAAAT	NA	NA	NA	NA
WP_000272859.1|1306940_1307189_-	helix-turn-helix transcriptional regulator	NA	A0A2K9VBT6	Staphylococcus_phage	100.0	1.7e-39
WP_001260487.1|1307352_1307676_+	helix-turn-helix transcriptional regulator	NA	A0A0H3U2V8	Staphylococcus_phage	100.0	2.0e-53
WP_031869171.1|1307688_1308150_+	toxin	NA	A0A2K9VBR7	Staphylococcus_phage	99.3	4.6e-83
WP_000392183.1|1308333_1309266_+	hypothetical protein	NA	A0EX19	Staphylococcus_virus	100.0	6.7e-174
WP_000337827.1|1309245_1309425_-	hypothetical protein	NA	Q4ZBP0	Staphylococcus_phage	100.0	3.7e-25
WP_031764589.1|1309537_1310587_+|integrase	site-specific integrase	integrase	A1KWY3	Staphylococcus_virus	99.7	5.9e-203
WP_001074405.1|1310654_1312052_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_001010508.1|1312202_1312667_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_000807671.1|1312656_1313898_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
WP_000205572.1|1314012_1315320_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1315417_1316179_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
1321846:1321862	attR	TTCACTTTCACTCAAAT	NA	NA	NA	NA
>prophage 90
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1320128	1321154	2949972		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571209.1|1320128_1321154_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
>prophage 91
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1324263	1329441	2949972		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1324263_1324620_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147955.1|1324763_1325084_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1325233_1325773_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150036.1|1325855_1326572_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.7	6.8e-17
WP_000974455.1|1326719_1327142_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1327540_1328035_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255545.1|1328190_1328808_+	amino acid transporter	NA	NA	NA	NA	NA
WP_016187137.1|1328880_1329441_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 92
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1332846	1334090	2949972		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1332846_1333047_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001574556.1|1333403_1334090_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 93
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1346159	1352320	2949972		Staphylococcus_phage(33.33%)	6	NA	NA
WP_001085185.1|1346159_1346624_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_001050041.1|1346645_1349018_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
WP_001165967.1|1349051_1349792_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1349920_1350154_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785248.1|1350220_1350679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1351015_1352320_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 94
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1363008	1368708	2949972		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1363008_1363596_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1364164_1365109_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1365217_1366213_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369719.1|1366209_1367121_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134960.1|1367772_1368708_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	8.4e-84
>prophage 95
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1373105	1375952	2949972		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662687.1|1373105_1375952_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 96
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1379270	1380110	2949972		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749385.1|1379270_1380110_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 97
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1386548	1392253	2949972		Streptococcus_phage(66.67%)	5	NA	NA
WP_061839152.1|1386548_1387631_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.5	4.4e-44
WP_000686342.1|1387994_1388861_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192947.1|1389004_1389646_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|1389809_1390865_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1391182_1392253_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 98
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1401530	1424501	2949972		uncultured_Caudovirales_phage(35.71%)	18	NA	NA
WP_000616865.1|1401530_1402292_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
WP_001245566.1|1402288_1403245_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
WP_000876311.1|1403231_1404203_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
WP_000562498.1|1404579_1405551_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1405670_1407776_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1407738_1408137_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068491.1|1408938_1409805_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930016.1|1409824_1410325_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_000193750.1|1410664_1412170_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031788440.1|1412247_1412349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429002.1|1412439_1413357_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
WP_000197262.1|1413908_1414451_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663016.1|1414609_1415668_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
WP_000180987.1|1415907_1417422_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589241.1|1417414_1418392_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-25
WP_000983677.1|1418612_1420394_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525101.1|1420405_1422289_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	8.8e-56
WP_000098285.1|1422560_1424501_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 99
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1427640	1437486	2949972		Pandoravirus(12.5%)	12	NA	NA
WP_001217804.1|1427640_1428792_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
WP_000604508.1|1428775_1429369_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_000446724.1|1429719_1430388_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1430389_1430809_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062968.1|1430812_1431526_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637686.1|1431624_1432209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093552.1|1432488_1432929_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1433270_1433744_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1433718_1434405_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244416.1|1434404_1435460_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702776.1|1435531_1436515_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.0	7.3e-62
WP_000931237.1|1436646_1437486_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 100
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1444648	1495158	2949972	transposase,bacteriocin,tRNA	Staphylococcus_phage(31.25%)	53	NA	NA
WP_001107240.1|1444648_1445131_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_000216727.1|1445304_1445757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041284.1|1446053_1447220_-	multidrug efflux MFS transporter NorA	NA	NA	NA	NA	NA
WP_000776010.1|1447429_1447852_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001191871.1|1448038_1448656_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_000154465.1|1448652_1448937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952030.1|1449091_1450465_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.2e-46
WP_000005632.1|1450550_1452104_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_000180420.1|1452386_1452674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435104.1|1452708_1453617_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_000794424.1|1453719_1454646_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_001283444.1|1454872_1455316_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000857616.1|1455442_1457116_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-11
WP_000737163.1|1457112_1458744_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	28.2	2.3e-12
WP_000469883.1|1458962_1459838_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358501.1|1460009_1460693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148821.1|1460695_1461154_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1461155_1461722_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
WP_000638614.1|1461816_1462359_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000545116.1|1462438_1462738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733427.1|1462875_1463265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001259673.1|1463331_1463775_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000842865.1|1463901_1464591_+	DUF1129 family protein	NA	NA	NA	NA	NA
WP_001105942.1|1465253_1465928_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
WP_000361064.1|1466022_1466400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000159128.1|1466637_1467003_+	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	47.8	8.5e-24
WP_000378396.1|1466995_1469176_+	cadmium-translocating P-type ATPase CadA	NA	E4ZFI9	Streptococcus_phage	63.7	9.3e-251
WP_000277738.1|1469538_1471185_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	98.4	1.0e-289
WP_000277154.1|1471251_1472685_-	multi-copper oxidase Mco	NA	NA	NA	NA	NA
WP_000069452.1|1472699_1474745_-	copper-translocating P-type ATPase CopB	NA	E4ZFI9	Streptococcus_phage	29.2	2.3e-65
WP_000690626.1|1475011_1475587_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	2.9e-42
WP_000838599.1|1475921_1476917_-	YeiH family protein	NA	NA	NA	NA	NA
WP_000377738.1|1477041_1477863_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791613.1|1478164_1478257_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000397995.1|1478485_1478809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998976.1|1480025_1480451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843733.1|1481240_1481984_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
WP_001002795.1|1482533_1482629_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_000761344.1|1482843_1483185_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160191393.1|1483271_1484132_-	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_000273007.1|1484496_1484997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001582045.1|1485063_1485390_-	recombinase	NA	NA	NA	NA	NA
WP_001643491.1|1485329_1485707_-	recombinase	NA	NA	NA	NA	NA
WP_000277741.1|1485861_1487508_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
WP_000593106.1|1487869_1488496_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	6.1e-22
WP_000831610.1|1488507_1488819_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000713732.1|1488822_1490757_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_000726502.1|1490831_1491125_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000358995.1|1491504_1491900_-	thioredoxin-dependent arsenate reductase	NA	A0A2H4PQT9	Staphylococcus_phage	86.3	8.5e-62
WP_000153633.1|1491917_1493207_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	81.1	5.6e-187
WP_000120605.1|1493206_1493521_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4PQT4	Staphylococcus_phage	73.1	4.7e-39
WP_001035802.1|1494236_1494449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105942.1|1494483_1495158_-|transposase	IS6-like element ISSau6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	88.4	1.3e-113
>prophage 101
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1500462	1500936	2949972		Pandoravirus(100.0%)	1	NA	NA
WP_000833480.1|1500462_1500936_-	cupin	NA	A0A291AU44	Pandoravirus	38.7	4.6e-14
>prophage 102
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1506186	1506984	2949972		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000731642.1|1506186_1506984_+	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	35.8	2.1e-06
>prophage 103
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1511704	1512466	2949972		Planktothrix_phage(100.0%)	1	NA	NA
WP_000153733.1|1511704_1512466_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.2e-33
>prophage 104
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1516832	1517876	2949972		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030763.1|1516832_1517876_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.1	3.8e-16
>prophage 105
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1524398	1525196	2949972		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1524398_1525196_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 106
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1528423	1532382	2949972		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1528423_1530151_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793055.1|1530571_1531867_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1531983_1532382_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 107
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1539315	1540059	2949972		Indivirus(100.0%)	1	NA	NA
WP_000894458.1|1539315_1540059_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-12
>prophage 108
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1552924	1553485	2949972	integrase	Streptococcus_phage(100.0%)	1	1547078:1547092	1557067:1557081
1547078:1547092	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044966.1|1552924_1553485_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
WP_001044966.1|1552924_1553485_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
1557067:1557081	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 109
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1566434	1569788	2949972		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1566434_1567445_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1567943_1568465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180233.1|1568492_1569788_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 110
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1577319	1578642	2949972		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860607.1|1577319_1578642_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	8.2e-109
>prophage 111
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1589946	1590603	2949972		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|1589946_1590603_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 112
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1594270	1597592	2949972		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000382588.1|1594270_1595647_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	6.7e-21
WP_000347064.1|1596191_1597592_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.0	9.4e-55
>prophage 113
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1621204	1621867	2949972		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1621204_1621867_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 114
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1628455	1629643	2949972		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250820.1|1628455_1629643_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	1.5e-45
>prophage 115
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1632670	1643624	2949972		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1632670_1634752_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1634874_1635345_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1635410_1635824_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1635921_1636176_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001819727.1|1636312_1639909_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	4.3e-67
WP_000918664.1|1640072_1643624_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	6.1e-50
>prophage 116
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1647307	1652090	2949972	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1647307_1647856_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1647868_1648051_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001791441.1|1648106_1648250_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872867.1|1648364_1648934_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664740.1|1649014_1649539_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1649538_1650285_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370181.1|1650292_1650697_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631982.1|1650689_1652090_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 117
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1658101	1660558	2949972	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1658101_1660558_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 118
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1679643	1690101	2949972	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1679643_1681131_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_016186812.1|1681183_1681276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613720.1|1681669_1682146_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154303.1|1682142_1682508_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167936.1|1682485_1683289_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	6.7e-21
WP_000057594.1|1683504_1684437_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1684615_1685497_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1685910_1688004_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1688261_1688801_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176721.1|1688805_1690101_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.3	8.2e-13
>prophage 119
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1699357	1701822	2949972		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1699357_1700323_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252515.1|1700469_1701822_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	1.1e-23
>prophage 120
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1707706	1710804	2949972	tRNA	Hokovirus(50.0%)	2	NA	NA
WP_001051120.1|1707706_1709680_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
WP_000279925.1|1709964_1710804_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 121
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1714710	1715328	2949972		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1714710_1715328_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 122
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1724172	1725870	2949972		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109044.1|1724172_1725870_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 123
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1742507	1748744	2949972		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170274.1|1742507_1743512_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.1	1.4e-23
WP_000825534.1|1743845_1744688_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467992.1|1744724_1745384_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569267.1|1745387_1746413_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.4e-31
WP_001036658.1|1746703_1747846_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_000634110.1|1747838_1748744_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	7.2e-48
>prophage 124
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1772281	1775063	2949972		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072632.1|1772281_1773514_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	2.7e-45
WP_000028598.1|1773506_1775063_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	1.7e-286
>prophage 125
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1786493	1786820	2949972	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001799349.1|1786493_1786820_+|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	85.4	4.3e-11
>prophage 126
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1790127	1793160	2949972		Hokovirus(50.0%)	2	NA	NA
WP_000424963.1|1790127_1791669_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1791693_1793160_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 127
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1802260	1803784	2949972		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930503.1|1802260_1803784_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.2	5.5e-40
>prophage 128
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1812936	1833941	2949972	terminase,coat,integrase	Staphylococcus_phage(81.82%)	30	1812213:1812230	1827314:1827331
1812213:1812230	attL	ATATTATTGTTCTTCTTT	NA	NA	NA	NA
WP_160191405.1|1812936_1813449_-	hypothetical protein	NA	Q4ZE83	Staphylococcus_phage	99.4	5.5e-69
WP_073392942.1|1813566_1814004_-	DUF3102 domain-containing protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	58.2	9.8e-27
WP_000801980.1|1814145_1815114_-	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	2.7e-24
WP_001293071.1|1815390_1815960_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	4.6e-101
WP_001656917.1|1815956_1816169_-	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	97.1	5.4e-31
WP_000771361.1|1816300_1816828_-|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	100.0	6.8e-91
WP_000214170.1|1816880_1817534_-	hypothetical protein	NA	Q4ZE82	Staphylococcus_phage	99.5	7.6e-116
WP_001288442.1|1817564_1817909_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	91.7	1.3e-50
WP_001019762.1|1818616_1819258_-	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	92.5	4.7e-110
WP_000356942.1|1819254_1819635_-	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	96.8	1.7e-67
WP_000447468.1|1819944_1821654_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	92.8	8.2e-303
WP_001002709.1|1821667_1822537_-	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	96.2	5.3e-165
WP_001103967.1|1822601_1822928_-	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	96.3	3.5e-53
WP_000403837.1|1822928_1823312_-	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	4.8e-62
WP_001231376.1|1823313_1823517_-	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	98.5	2.0e-30
WP_000784892.1|1823483_1823657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138305.1|1823668_1823941_-	winged helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	94.4	1.2e-43
WP_001611932.1|1823941_1824106_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000230361.1|1824254_1824878_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000270135.1|1825038_1826253_+|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	97.3	3.3e-221
WP_000400841.1|1826365_1827085_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q4ZE81	Staphylococcus_phage	29.8	3.7e-23
WP_000897044.1|1827316_1827559_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
1827314:1827331	attR	ATATTATTGTTCTTCTTT	NA	NA	NA	NA
WP_000934799.1|1827610_1828114_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1828134_1828431_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1828674_1828866_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1828951_1830049_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1830060_1830264_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373076.1|1830293_1831175_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001573568.1|1831328_1832174_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655687.1|1832837_1833941_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 129
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1843862	1844705	2949972		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209478.1|1843862_1844705_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	4.5e-12
>prophage 130
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1866115	1867138	2949972		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000280814.1|1866115_1867138_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	28.1	6.7e-10
>prophage 131
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1887087	1887765	2949972		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911024.1|1887087_1887765_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.2e-31
>prophage 132
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1901306	1905755	2949972		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549309.1|1901306_1905755_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 133
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1916359	1918021	2949972		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000570080.1|1916359_1917019_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	5.8e-23
WP_000736790.1|1917070_1918021_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 134
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1926828	1928265	2949972		Pandoravirus(100.0%)	1	NA	NA
WP_000163995.1|1926828_1928265_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	1.3e-30
>prophage 135
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1934774	1939318	2949972		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925396.1|1934774_1936514_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	2.0e-62
WP_000608835.1|1936779_1937454_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975347.1|1937593_1939318_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 136
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1949187	1950231	2949972		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645611.1|1949187_1950231_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	6.0e-14
>prophage 137
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1957447	1958977	2949972		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1957447_1958977_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 138
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1968661	1970167	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008395.1|1968661_1970167_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 139
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1981128	1986487	2949972		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1981128_1983378_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837114.1|1983965_1984934_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127979.1|1984930_1986487_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 140
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	1996798	1998857	2949972		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|1996798_1997896_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166911.1|1998278_1998857_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	43.0	1.6e-13
>prophage 141
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2006668	2008261	2949972		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067363.1|2006668_2008261_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	5.4e-22
>prophage 142
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2024353	2025538	2949972		Klosneuvirus(100.0%)	1	NA	NA
WP_001084444.1|2024353_2025538_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	2.4e-35
>prophage 143
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2030403	2040687	2949972		Tupanvirus(50.0%)	3	NA	NA
WP_000605273.1|2030403_2037579_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.9	3.4e-68
WP_000826855.1|2038025_2039276_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706134.1|2039661_2040687_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 144
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2044223	2047222	2949972		Bacillus_virus(50.0%)	4	NA	NA
WP_000590840.1|2044223_2044964_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.5e-39
WP_000171926.1|2045305_2045818_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356967.1|2045997_2046201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013476.1|2046262_2047222_-	cation transporter	NA	A0A1V0SED0	Indivirus	33.6	2.8e-10
>prophage 145
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2050563	2053048	2949972		Catovirus(50.0%)	2	NA	NA
WP_000723445.1|2050563_2051709_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
WP_000779509.1|2051785_2053048_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	2.5e-22
>prophage 146
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2060065	2066630	2949972		Catovirus(50.0%)	6	NA	NA
WP_000413167.1|2060065_2061190_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	3.9e-128
WP_001028294.1|2061193_2062303_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|2062315_2063344_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940769.1|2063333_2065157_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.4	3.0e-29
WP_000565301.1|2065176_2065941_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037317.1|2065943_2066630_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	8.2e-28
>prophage 147
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2070653	2071829	2949972		Clostridium_phage(100.0%)	1	NA	NA
WP_000469818.1|2070653_2071829_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.2e-30
>prophage 148
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2077287	2078061	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078278.1|2077287_2078061_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	6.4e-13
>prophage 149
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2085947	2086547	2949972		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|2085947_2086547_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 150
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2091481	2096576	2949972		Catovirus(50.0%)	5	NA	NA
WP_001793810.1|2091481_2092462_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.3	1.3e-47
WP_000183771.1|2092796_2093573_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414632.1|2093783_2094410_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|2094605_2095370_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223717.1|2095373_2096576_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.3	5.1e-09
>prophage 151
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2104842	2109052	2949972		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|2104842_2105823_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045124.1|2106053_2107046_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000925002.1|2107061_2108057_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136645.1|2108053_2109052_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.6e-14
>prophage 152
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2141147	2146482	2949972	transposase	Acidithiobacillus_phage(33.33%)	5	NA	NA
WP_000649665.1|2141147_2142848_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.8	4.1e-20
WP_001794509.1|2143137_2143512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160191417.1|2143697_2144645_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	4.2e-184
WP_000370465.1|2144649_2145165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088356251.1|2145352_2146482_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
>prophage 153
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2152362	2162359	2949972		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2152362_2153163_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104171.1|2153550_2154339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060146.1|2154339_2155674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871610.1|2155666_2157493_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.1e-30
WP_000101976.1|2157505_2158207_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2159396_2160680_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2160958_2162359_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 154
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2169041	2178077	2949972	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884337.1|2169041_2170328_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177483.1|2170705_2172220_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	4.4e-90
WP_000449218.1|2172545_2173358_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819098.1|2173445_2176106_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	4.6e-119
WP_000255583.1|2176142_2178077_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
>prophage 155
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2188164	2191464	2949972		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742840.1|2188164_2189004_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.4	1.4e-05
WP_160191439.1|2189498_2189852_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2189919_2190315_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054111.1|2190567_2191137_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	34.8	2.8e-05
WP_001059079.1|2191263_2191464_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 156
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2197257	2198016	2949972		Planktothrix_phage(100.0%)	1	NA	NA
WP_160191418.1|2197257_2198016_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.0	3.4e-35
>prophage 157
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2222501	2223515	2949972		Faustovirus(100.0%)	1	NA	NA
WP_000639198.1|2222501_2223515_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.2	8.2e-08
>prophage 158
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2235906	2236599	2949972		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185860.1|2235906_2236599_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 159
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2260474	2262334	2949972		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125631.1|2260474_2262334_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 160
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2287934	2289685	2949972		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143418.1|2287934_2288822_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	7.4e-05
WP_000923764.1|2288929_2289685_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-31
>prophage 161
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2293122	2293620	2949972		Canarypox_virus(100.0%)	1	NA	NA
WP_001065267.1|2293122_2293620_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	2.4e-21
>prophage 162
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2298670	2301054	2949972		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071721.1|2298670_2300521_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.9	1.3e-234
WP_000173336.1|2300517_2301054_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.5	1.1e-40
>prophage 163
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2305930	2316041	2949972	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2305930_2307640_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2307917_2308130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028789.1|2308409_2308853_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172333.1|2309046_2310645_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.6	2.6e-77
WP_001793854.1|2310704_2310905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2311331_2312828_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031407.1|2313020_2313911_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237625.1|2314033_2314450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030061.1|2314703_2316041_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	6.7e-18
>prophage 164
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2344196	2347396	2949972		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751265.1|2344196_2344898_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
WP_000379825.1|2345584_2347396_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 165
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2355835	2360221	2949972		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161364.1|2355835_2356834_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076662.1|2356923_2357130_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024137.1|2357812_2360221_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
>prophage 166
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2369462	2372452	2949972	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001063330.1|2369462_2371568_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.5	6.9e-118
WP_000262597.1|2371930_2372452_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	2.4e-27
>prophage 167
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2378876	2385259	2949972		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062662.1|2378876_2380616_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473682.1|2380915_2382982_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2383361_2383772_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2383813_2384170_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228158.1|2384290_2385259_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	3.1e-12
>prophage 168
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2394083	2395076	2949972		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161541.1|2394083_2395076_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	9.7e-38
>prophage 169
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2404493	2405189	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382892.1|2404493_2405189_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	2.0e-37
>prophage 170
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2423789	2430965	2949972		Bacillus_phage(66.67%)	6	NA	NA
WP_000721330.1|2423789_2424656_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	4.4e-79
WP_001573690.1|2424782_2425091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2425234_2425501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001793882.1|2425784_2427593_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.5	1.0e-93
WP_000755954.1|2427709_2428102_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000088715.1|2428103_2430965_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	1.2e-27
>prophage 171
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2434350	2436295	2949972	transposase	Staphylococcus_prophage(50.0%)	2	NA	NA
WP_000121211.1|2434350_2435298_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000217452.1|2435599_2436295_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	5.1e-09
>prophage 172
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2441971	2442790	2949972		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824929.1|2441971_2442790_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.8	1.9e-10
>prophage 173
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2450855	2452413	2949972		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173876.1|2450855_2451671_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-14
WP_000590515.1|2451663_2452413_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 174
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2458646	2463073	2949972		Bacillus_phage(50.0%)	4	NA	NA
WP_000923514.1|2458646_2459309_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
WP_000072154.1|2459301_2460078_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026190.1|2460471_2461659_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700902.1|2461720_2463073_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	3.0e-13
>prophage 175
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2466466	2467693	2949972		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948990.1|2466466_2467693_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 176
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2486069	2492276	2949972		Bacillus_phage(66.67%)	5	NA	NA
WP_001176855.1|2486069_2487212_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
WP_000779351.1|2487479_2487866_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2487999_2488107_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064829.1|2488754_2490518_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.6e-35
WP_000486505.1|2490542_2492276_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.5e-30
>prophage 177
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2495737	2501491	2949972		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971554.1|2495737_2496853_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	7.1e-21
WP_000286868.1|2496863_2497556_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200947.1|2497566_2498034_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_001056917.1|2498085_2499063_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	2.4e-142
WP_000916697.1|2499064_2500012_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	2.1e-138
WP_000594516.1|2500561_2501491_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.4	1.5e-120
>prophage 178
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2509383	2510115	2949972		Bacillus_virus(100.0%)	1	NA	NA
WP_000615467.1|2509383_2510115_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.3e-23
>prophage 179
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2526979	2528539	2949972		Escherichia_phage(100.0%)	1	NA	NA
WP_000692650.1|2526979_2528539_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	3.4e-21
>prophage 180
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2539270	2540917	2949972	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_000277741.1|2539270_2540917_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 181
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2551858	2552893	2949972		Bacillus_virus(100.0%)	1	NA	NA
WP_000655979.1|2551858_2552893_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 182
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2563356	2569913	2949972		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000388431.1|2563356_2564085_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-28
WP_000372857.1|2564218_2564782_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793166.1|2564958_2565414_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000977031.1|2565410_2565854_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000477322.1|2566016_2567390_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.3	1.1e-12
WP_000249492.1|2567382_2568057_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	44.7	8.0e-52
WP_000761409.1|2568192_2569248_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229922.1|2569247_2569913_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	7.2e-37
>prophage 183
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2573650	2574859	2949972		Salmonella_phage(100.0%)	1	NA	NA
WP_000999130.1|2573650_2574859_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.5	3.0e-33
>prophage 184
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2587515	2588415	2949972		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524842.1|2587515_2588415_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 185
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2595772	2596192	2949972		Bacillus_phage(100.0%)	1	NA	NA
WP_000920241.1|2595772_2596192_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	7.7e-37
>prophage 186
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2601883	2602765	2949972		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730056.1|2601883_2602765_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	1.7e-62
>prophage 187
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2610644	2611280	2949972		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285452.1|2610644_2611280_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.6	7.1e-10
>prophage 188
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2624284	2628551	2949972		Staphylococcus_phage(50.0%)	4	NA	NA
WP_072460394.1|2624284_2624923_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
WP_000684154.1|2625531_2626656_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_000417008.1|2626747_2627701_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.2	5.8e-32
WP_000737700.1|2628059_2628551_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 189
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2632471	2633281	2949972		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717395.1|2632471_2633281_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 190
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2646760	2648327	2949972	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_094409958.1|2646760_2648327_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
>prophage 191
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2671507	2674675	2949972		Leptospira_phage(100.0%)	1	NA	NA
WP_000592290.1|2671507_2674675_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	4.3e-63
>prophage 192
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2686642	2687248	2949972		Pithovirus(100.0%)	1	NA	NA
WP_000913006.1|2686642_2687248_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 193
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2692837	2696447	2949972	transposase	Paenibacillus_phage(33.33%)	3	NA	NA
WP_094409958.1|2692837_2694405_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000389651.1|2694780_2695590_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
WP_000586768.1|2695586_2696447_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 194
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2699488	2708050	2949972		Mycobacterium_phage(33.33%)	8	NA	NA
WP_000204271.1|2699488_2700925_+	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.2	5.5e-58
WP_000136272.1|2701173_2701353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791584.1|2702002_2702185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130145.1|2702654_2704319_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_000179061.1|2704355_2705060_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769709.1|2705450_2705876_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044369.1|2706169_2706985_+	hydrolase	NA	NA	NA	NA	NA
WP_001044451.1|2707195_2708050_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	34.8	1.3e-06
>prophage 195
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2711428	2714491	2949972		Staphylococcus_phage(50.0%)	5	NA	NA
WP_001015495.1|2711428_2712277_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.3e-43
WP_001573519.1|2712497_2712623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293423.1|2712577_2712871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333457.1|2712884_2713493_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_001573518.1|2713750_2714491_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.3	7.3e-14
>prophage 196
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2720811	2722224	2949972		Pandoravirus(100.0%)	1	NA	NA
WP_000169223.1|2720811_2722224_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	5.0e-48
>prophage 197
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2726192	2727755	2949972		Vibrio_phage(100.0%)	1	NA	NA
WP_000792332.1|2726192_2727755_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	3.5e-18
>prophage 198
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2737954	2738923	2949972		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2737954_2738923_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 199
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2754723	2755632	2949972		Klosneuvirus(100.0%)	1	NA	NA
WP_000162591.1|2754723_2755632_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.7	1.2e-26
>prophage 200
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2772874	2780292	2949972	transposase	Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_000334466.1|2772874_2774680_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
WP_000908186.1|2774911_2775694_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.7e-09
WP_000370937.1|2775761_2776619_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001792784.1|2777277_2777436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073392962.1|2778115_2778220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277741.1|2778645_2780292_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	100.0	3.5e-295
>prophage 201
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2788798	2794294	2949972	transposase	Clostridium_phage(33.33%)	5	NA	NA
WP_000070866.1|2788798_2789242_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_094409958.1|2789347_2790915_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_000160304.1|2791025_2791736_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083335.1|2792050_2792713_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242308.1|2792992_2794294_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	1.4e-132
>prophage 202
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2802227	2803838	2949972		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_069994075.1|2802227_2803838_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 203
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2811641	2819394	2949972		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2811641_2812241_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460244.1|2812241_2813318_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248730.1|2813304_2814141_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001801520.1|2814173_2815271_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|2815267_2815687_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654191.1|2815793_2816318_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_160191428.1|2816344_2817583_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	3.1e-102
WP_000048712.1|2817610_2818240_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723407.1|2818263_2819394_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.1	1.0e-27
>prophage 204
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2830111	2830507	2949972		Bacillus_phage(100.0%)	1	NA	NA
WP_000932696.1|2830111_2830507_+	single-stranded DNA-binding protein	NA	A0A1B1PAE7	Bacillus_phage	36.8	3.0e-14
>prophage 205
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2836616	2837264	2949972		Moumouvirus(100.0%)	1	NA	NA
WP_001187612.1|2836616_2837264_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	4.7e-09
>prophage 206
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2845456	2846977	2949972		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178940.1|2845456_2846977_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 207
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2852651	2854679	2949972		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546609.1|2852651_2854679_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	3.9e-25
>prophage 208
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2859829	2863213	2949972		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621176.1|2859829_2860192_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2860540_2861542_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2861660_2861987_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190825.1|2861988_2862468_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041107.1|2862442_2863213_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 209
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2877326	2882050	2949972		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094572.1|2877326_2878856_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.6	9.4e-08
WP_072399972.1|2878885_2879905_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2880026_2880281_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047828.1|2880280_2882050_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	4.1e-63
>prophage 210
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2885810	2899883	2949972	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159047.1|2885810_2886836_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	3.1e-63
WP_000106312.1|2887149_2888760_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	27.4	5.1e-20
WP_001791590.1|2888854_2888983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602046.1|2889127_2891056_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.1	3.2e-53
WP_001283612.1|2891308_2891944_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_073392939.1|2892299_2893328_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581078.1|2893387_2893612_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052261.1|2893820_2895071_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	9.0e-41
WP_160191430.1|2895254_2896205_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791588.1|2896353_2897838_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	5.2e-19
WP_001253292.1|2897834_2898794_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|2899166_2899883_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 211
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2907024	2921302	2949972	coat,terminase,integrase	Staphylococcus_phage(68.42%)	22	2908984:2909003	2923652:2923671
WP_000917289.1|2907024_2907309_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240651.1|2907384_2909001_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
2908984:2909003	attL	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_000179345.1|2909069_2910242_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	98.2	3.5e-220
WP_000620857.1|2910255_2910930_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000153640.1|2911036_2911255_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000481967.1|2911259_2911577_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000708433.1|2911573_2911729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001231378.1|2911713_2911917_+	hypothetical protein	NA	A0A1W6JQF4	Staphylococcus_phage	97.0	7.5e-30
WP_000403839.1|2911918_2912302_+	hypothetical protein	NA	A0A1W6JQI7	Staphylococcus_phage	96.1	9.7e-63
WP_001103930.1|2912302_2912620_+	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	58.2	1.6e-18
WP_001002721.1|2912683_2913553_+	hypothetical protein	NA	Q4ZE74	Staphylococcus_phage	99.3	6.0e-169
WP_000447451.1|2913566_2915276_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	100.0	0.0e+00
WP_000356937.1|2915587_2915968_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	100.0	6.9e-69
WP_001019766.1|2915964_2916606_+	hypothetical protein	NA	Q4ZE67	Staphylococcus_phage	94.8	3.5e-113
WP_001190608.1|2917141_2917483_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	98.2	7.1e-57
WP_000846285.1|2917494_2918073_+	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
WP_000448775.1|2918090_2918309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000771368.1|2918359_2918887_+|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	97.1	3.5e-87
WP_000358778.1|2918889_2919231_+	hypothetical protein	NA	A0A1W6JQM3	Staphylococcus_phage	100.0	1.7e-58
WP_160191431.1|2919227_2919797_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	97.9	6.6e-100
WP_001035597.1|2919951_2920656_-	toxic shock syndrome toxin TSST-1	NA	NA	NA	NA	NA
WP_000812237.1|2921074_2921302_+	hypothetical protein	NA	A0A2H4JAH5	uncultured_Caudovirales_phage	47.4	1.9e-13
2923652:2923671	attR	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
>prophage 212
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2924386	2925014	2949972		Staphylococcus_phage(100.0%)	2	NA	NA
WP_001573769.1|2924386_2924683_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
WP_001573771.1|2924672_2925014_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
>prophage 213
NZ_CP047781	Staphylococcus aureus strain UP_1452 chromosome, complete genome	2949972	2928992	2949502	2949972	integrase	Staphylococcus_phage(100.0%)	37	2920818:2920834	2942117:2942133
2920818:2920834	attL	AACATTTTAAAGTTACA	NA	NA	NA	NA
WP_000791402.1|2928992_2930048_+	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
WP_000595617.1|2930069_2931089_+	beta-channel forming cytolysin	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
WP_000857191.1|2932228_2933266_-|integrase	site-specific integrase	integrase	A0EWV2	Staphylococcus_phage	100.0	9.1e-180
WP_000825947.1|2933324_2933789_-	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000705248.1|2933888_2934071_-	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_000591749.1|2934274_2934616_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000759682.1|2934621_2935554_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|2935569_2936283_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_061819782.1|2936245_2936395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025874.1|2936459_2936675_+	DUF2829 domain-containing protein	NA	A0EWV9	Staphylococcus_phage	100.0	6.3e-35
WP_000128907.1|2936663_2936993_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001148605.1|2937043_2937796_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_001148855.1|2937811_2938009_+	hypothetical protein	NA	Q8SDM8	Staphylococcus_phage	100.0	7.0e-33
WP_000939496.1|2938039_2938180_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000275058.1|2938194_2938827_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_001120197.1|2938885_2939206_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000066017.1|2939202_2939364_+	DUF1270 domain-containing protein	NA	D2JGJ6	Staphylococcus_phage	100.0	4.3e-20
WP_000165375.1|2939458_2939785_+	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	100.0	1.2e-53
WP_000291503.1|2939765_2940026_+	DUF1108 family protein	NA	A0EWW8	Staphylococcus_phage	100.0	8.9e-44
WP_001205732.1|2940034_2940298_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700577.1|2940306_2942250_+	AAA family ATPase	NA	A0EWX0	Staphylococcus_phage	100.0	0.0e+00
2942117:2942133	attR	AACATTTTAAAGTTACA	NA	NA	NA	NA
WP_000138472.1|2942251_2943172_+	recombinase	NA	S4SUN6	Staphylococcus_phage	100.0	2.3e-166
WP_071621397.1|2943252_2943870_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000934764.1|2943870_2944341_+	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	100.0	7.4e-81
WP_000148316.1|2944370_2945255_+	DnaD domain protein	NA	A0EWX4	Staphylococcus_phage	100.0	5.4e-141
WP_000338531.1|2945261_2945480_+	hypothetical protein	NA	A0A2I6PDG4	Staphylococcus_phage	98.6	1.2e-36
WP_000101274.1|2945810_2946179_+	hypothetical protein	NA	W5RAK8	Staphylococcus_phage	100.0	8.2e-51
WP_000131366.1|2946182_2946425_+	hypothetical protein	NA	A0EWX8	Staphylococcus_phage	100.0	3.9e-41
WP_001065091.1|2946596_2946848_+	DUF1024 family protein	NA	A0EWY0	Staphylococcus_phage	100.0	1.9e-38
WP_000028422.1|2946837_2947020_+	hypothetical protein	NA	A0EWY1	Staphylococcus_phage	100.0	2.6e-26
WP_000185659.1|2947012_2947555_+	dUTP pyrophosphatase	NA	A0EWY2	Staphylococcus_phage	100.0	1.1e-96
WP_000195803.1|2947591_2947798_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000592207.1|2947794_2948181_+	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
WP_000595265.1|2948177_2948327_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_000265043.1|2948326_2948527_+	DUF1514 domain-containing protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|2948554_2948971_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988336.1|2949202_2949502_+	HNH endonuclease	NA	A0EWY8	Staphylococcus_phage	100.0	4.6e-52
