The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	0	63465	2790390	transposase,holin,portal,terminase,protease,tail,capsid,head	Staphylococcus_phage(78.95%)	65	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_061823655.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	99.2	1.3e-217
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_109683189.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	99.5	1.8e-213
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268740.1|6484_7129_+|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_061823657.1|8039_12584_+|tail	phage tail tape measure protein	tail	A0A075M036	Staphylococcus_phage	99.2	0.0e+00
WP_000567390.1|12580_14065_+|tail	phage tail protein	tail	A0A068A242	Staphylococcus_phage	100.0	1.5e-297
WP_000582186.1|14080_17866_+	hypothetical protein	NA	C8CH32	Staphylococcus_phage	99.7	0.0e+00
WP_001153681.1|17855_18008_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040261.1|18054_18342_+	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
WP_000539688.1|18399_18696_+	DUF2951 domain-containing protein	NA	D2JLG2	Staphylococcus_phage	100.0	2.9e-46
WP_011447039.1|18845_19022_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|19074_19182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|19233_19488_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|19499_20255_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000920037.1|20445_20937_+	staphylokinase	NA	A0A1W6JQ12	Staphylococcus_phage	100.0	3.6e-86
WP_020444758.1|21463_21922_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000727649.1|22016_22466_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|23150_23501_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|23553_23814_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|24124_24304_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_061823659.1|25261_27010_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_064132119.1|27589_28876_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|29075_29174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681968.1|29416_29593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|29851_30232_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991303.1|30228_31125_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645725.1|31125_31806_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|31802_32675_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
WP_001221651.1|32674_33415_+	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000182842.1|33480_34044_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000966288.1|34164_34689_+	membrane protein	NA	NA	NA	NA	NA
WP_001033971.1|34748_35306_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000713059.1|35302_36145_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001188074.1|36201_37242_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000267034.1|37692_37866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000205106.1|38495_38897_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
WP_000181322.1|39166_40195_+	lactonase family protein	NA	NA	NA	NA	NA
WP_001021210.1|40314_41694_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001792184.1|41745_41919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140871.1|42111_43041_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_000149686.1|43093_43654_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275706.1|44025_45123_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.9	2.5e-47
WP_000323161.1|45327_46890_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_001802312.1|46900_47008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045173916.1|47079_47874_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000897635.1|47893_48970_-	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_000284431.1|49153_50623_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	4.5e-108
WP_000040866.1|50615_51437_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
WP_106888601.1|52578_53757_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.9	1.4e-54
WP_001813570.1|53901_54024_+	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_000434933.1|54315_54642_-	staphostatin A	NA	NA	NA	NA	NA
WP_045173933.1|54672_55839_-|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
WP_000572878.1|56698_57994_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|58102_58405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272070.1|58576_59269_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_045173938.1|59265_61458_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	7.6e-136
WP_045173941.1|61461_63465_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	4.4e-114
>prophage 2
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	70583	75611	2790390		Catovirus(33.33%)	5	NA	NA
WP_001231451.1|70583_71531_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
WP_001147864.1|71611_72973_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.8	6.3e-104
WP_000548781.1|73142_73673_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140176.1|73919_74990_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|75056_75611_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 3
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	79063	79477	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001566709.1|79063_79477_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	37.7	2.3e-17
>prophage 4
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	84472	85102	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|84472_85102_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 5
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	100582	102319	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|100582_102319_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 6
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	118854	209666	2790390	protease,transposase,tRNA	Staphylococcus_phage(88.68%)	93	NA	NA
WP_001144055.1|118854_119583_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
WP_160191548.1|119718_120861_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000181394.1|120865_121336_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_001251224.1|121493_122093_+	glucosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000031108.1|122117_122270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045174101.1|122931_123327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045174099.1|123522_124908_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_045174097.1|125325_126147_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000437970.1|126308_127421_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_001045133.1|127442_128066_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000375864.1|128421_128886_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000992524.1|129064_130189_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000290301.1|130257_130602_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
WP_031867558.1|131095_131194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000238227.1|131483_132680_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_000584628.1|132669_135606_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001244175.1|135602_136544_+	3'-5' exoribonuclease YhaM	NA	NA	NA	NA	NA
WP_000782121.1|136664_137627_-	foldase	NA	NA	NA	NA	NA
WP_000477959.1|137831_138389_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000648118.1|139121_139487_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_000004986.1|139628_140051_-	HIT family protein	NA	NA	NA	NA	NA
WP_000216874.1|140184_140925_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
WP_000551840.1|140917_142141_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000737976.1|142264_142768_-	signal transduction protein TraP	NA	NA	NA	NA	NA
WP_001790154.1|142930_143041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233526.1|143030_144068_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_000162872.1|144125_145049_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000167551.1|145072_146473_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_000132890.1|146792_147347_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_010922839.1|148706_149489_+	staphylococcal enterotoxin type O	NA	A0A1X9H080	Staphylococcus_phage	36.7	1.1e-31
WP_000821658.1|149769_150489_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
WP_000713847.1|150523_151252_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
WP_000764686.1|151405_152176_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	43.2	1.1e-44
WP_045174075.1|152214_152970_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	41.4	3.5e-40
WP_000736712.1|153252_154029_+	staphylococcal enterotoxin type G	NA	NA	NA	NA	NA
WP_000848318.1|154580_155357_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000617704.1|155377_155614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253432.1|155691_156186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001792814.1|156713_156842_-|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	66.7	6.6e-08
WP_000209099.1|157019_157808_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	95.0	1.3e-138
WP_000473599.1|159169_160105_+	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	99.7	5.1e-174
WP_045174065.1|160106_161090_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	95.7	6.2e-178
WP_160191549.1|162254_162728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078103504.1|162870_163089_+	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	80.6	2.3e-21
WP_045174061.1|163561_164125_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	61.9	1.8e-49
WP_045174059.1|165080_165788_+|protease	serine protease	protease	A0A2H4PQN3	Staphylococcus_phage	84.7	1.8e-107
WP_045174057.1|165906_166629_+|protease	serine protease	protease	A0A2H4PQN0	Staphylococcus_phage	91.2	1.9e-120
WP_064132137.1|166686_167406_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	4.9e-124
WP_160191551.1|167528_168245_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	61.8	1.3e-81
WP_045174310.1|169288_170005_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	96.6	9.5e-128
WP_064132134.1|170165_170882_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	3.2e-83
WP_064132133.1|171031_171751_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	94.6	1.7e-124
WP_031835054.1|171815_171950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045173746.1|172113_173670_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	97.5	2.2e-286
WP_061823647.1|173662_174883_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.7	7.4e-48
WP_045173751.1|175537_175984_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_000070811.1|176670_177054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000375476.1|177064_177241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045173754.1|177242_177428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045173756.1|177613_178036_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	86.6	7.0e-46
WP_045173758.1|178380_178953_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
WP_045173760.1|179434_180061_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	92.8	1.3e-88
WP_045173763.1|180136_181132_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.6	3.8e-74
WP_078256794.1|181212_181863_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	93.1	3.7e-54
WP_012840523.1|182165_182621_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
WP_023914796.1|182779_184258_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.8	7.4e-284
WP_064132131.1|184262_185264_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.6	1.4e-185
WP_000718107.1|185260_185518_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672014.1|185583_186057_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	4.7e-83
WP_078103501.1|186061_186808_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.9e-142
WP_000109906.1|187188_188781_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933822.1|189152_190346_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
WP_000366158.1|190470_191379_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.0	1.7e-137
WP_000453314.1|191590_192424_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	100.0	5.4e-159
WP_106888601.1|192740_193919_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.9	1.4e-54
WP_000623476.1|194366_194720_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	98.3	2.0e-22
WP_001200542.1|194716_195082_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091445.1|195337_195640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|195899_196613_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168907.1|197052_197688_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_045173784.1|197983_198427_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.0	1.6e-56
WP_001153742.1|198413_198857_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671052.1|198969_199440_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	99.4	1.0e-82
WP_000384171.1|199638_199863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|200138_200993_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989121.1|201079_202372_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_000221177.1|202371_202686_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_045173790.1|203208_204711_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
WP_000384185.1|205203_206235_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
WP_000493892.1|206241_206874_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.5	1.7e-112
WP_001159037.1|206884_208066_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
WP_001008551.1|208078_208543_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	99.4	5.8e-70
WP_001196354.1|208664_209666_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.7	9.0e-185
>prophage 7
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	212827	226947	2790390	tRNA	Staphylococcus_phage(100.0%)	7	NA	NA
WP_000764419.1|212827_213391_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_045173807.1|213387_214341_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025061.1|214450_215632_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	100.0	5.6e-218
WP_061823648.1|215922_218343_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.9	0.0e+00
WP_000836465.1|218364_218676_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	100.0	1.6e-52
WP_160191553.1|219001_225562_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	96.9	3.5e-301
WP_045173815.1|225678_226947_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	100.0	4.1e-57
>prophage 8
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	238485	243807	2790390		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|238485_239343_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_045173827.1|239371_239968_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_160191554.1|239988_243807_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 9
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	252553	254260	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_044290202.1|252553_254260_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	100.0	1.2e-274
>prophage 10
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	260876	263507	2790390	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_072466016.1|260876_262139_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.8	1.0e-84
WP_045173851.1|262232_263507_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 11
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	269266	273401	2790390		Staphylococcus_phage(50.0%)	4	NA	NA
WP_045173091.1|269266_270871_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_045173090.1|270857_272018_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553929.1|272131_272578_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174286.1|272657_273401_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.5	1.4e-17
>prophage 12
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	290941	294139	2790390		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226910.1|290941_294139_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	7.7e-137
>prophage 13
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	299072	300830	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232648.1|299072_300830_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 14
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	307691	315855	2790390		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080029.1|307691_308396_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_015445861.1|308395_310057_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849439.1|310555_312043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038289.1|312336_314967_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114452.1|314982_315855_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.0e-42
>prophage 15
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	319769	330922	2790390	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|319769_320690_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_001790562.1|320782_320905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|321102_323040_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049154.1|323465_324959_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|325187_325715_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|325743_325944_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|325990_326347_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|326488_327097_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_001280022.1|327115_328045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|328049_328160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127573.1|328207_329509_+	trigger factor	NA	NA	NA	NA	NA
WP_000472302.1|329659_330922_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 16
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	340489	343120	2790390	tRNA	Catovirus(100.0%)	1	NA	NA
WP_045173060.1|340489_343120_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	4.8e-153
>prophage 17
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	353440	388993	2790390	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|353440_354445_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_160191564.1|354446_355472_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|355494_356634_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|356652_356913_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749795.1|357187_359467_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_045173054.1|359669_361943_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.0	5.2e-63
WP_000364542.1|361964_362483_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058587.1|362910_365100_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869983.1|365111_365564_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|365560_366436_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|366896_368159_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|368174_369941_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001790559.1|370273_370402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|370401_371175_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_045173051.1|371335_372610_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	4.8e-106
WP_000704122.1|372694_373117_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|373216_373399_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|373438_373585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985872.1|373821_374835_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|375146_376289_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|376289_377408_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567018.1|378042_378711_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283312.1|378712_381190_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_045173048.1|381532_384163_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|384225_384486_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|384489_384918_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|384932_385241_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342266.1|385525_386164_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|386166_387090_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_160191566.1|387101_388370_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.4	7.5e-35
WP_000648617.1|388369_388993_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 18
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	395820	396573	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045173043.1|395820_396573_+	enterotoxin	NA	A0EX09	Staphylococcus_phage	40.6	3.2e-49
>prophage 19
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	403848	410012	2790390		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|403848_404310_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_078103485.1|404368_406516_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
WP_001282562.1|406572_407547_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|407591_407843_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|408188_410012_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 20
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	413448	416556	2790390		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|413448_415281_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_045173035.1|415416_416556_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.0	2.3e-27
>prophage 21
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	423026	423974	2790390		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|423026_423974_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 22
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	427027	440773	2790390	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|427027_428419_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001794939.1|428753_429377_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|429387_430206_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_045173034.1|430266_432084_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.6e-54
WP_001283055.1|432307_433414_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624571.1|433544_434222_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683933.1|434224_435325_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	29.6	5.2e-08
WP_001062177.1|435438_436785_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924220.1|436794_437685_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
WP_001213908.1|437810_438596_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564316.1|438637_439501_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|439487_439898_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|440173_440773_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 23
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	446945	447569	2790390		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|446945_447569_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 24
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	453113	455925	2790390		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_043854778.1|453113_454460_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.7	6.3e-64
WP_000202188.1|454452_455925_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 25
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	463425	469996	2790390		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|463425_464763_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|464755_464986_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183375.1|464963_465845_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	26.1	8.9e-11
WP_001124985.1|466276_466729_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942210.1|466744_468424_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291528.1|468574_469996_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	3.9e-40
>prophage 26
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	476826	478233	2790390		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|476826_478233_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 27
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	484660	486145	2790390		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|484660_486145_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 28
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	491811	501294	2790390		Brevibacillus_phage(20.0%)	9	NA	NA
WP_000447733.1|491811_492699_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183429.1|492776_493283_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_064132113.1|493374_494106_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	3.6e-05
WP_000368657.1|494098_494641_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|494633_495371_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|495503_496229_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987769.1|496209_497961_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_001793476.1|498212_499121_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_109683178.1|500004_501294_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	100.0	1.6e-109
>prophage 29
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	504809	507488	2790390		Bacillus_phage(50.0%)	3	NA	NA
WP_045173340.1|504809_505058_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	4.9e-15
WP_001163801.1|505165_506119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902119.1|506108_507488_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.6	2.9e-56
>prophage 30
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	516912	522379	2790390		Bacillus_phage(25.0%)	7	NA	NA
WP_001043863.1|516912_517185_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|517615_518188_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774684.1|518190_518916_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_016169114.1|518932_519877_+	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|519968_520418_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_045173318.1|520626_520827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269929.1|521212_522379_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.1	7.6e-34
>prophage 31
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	526041	526617	2790390		Bacillus_virus(100.0%)	1	NA	NA
WP_000005212.1|526041_526617_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
>prophage 32
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	529989	537495	2790390	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361549.1|529989_531192_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	1.9e-35
WP_000049923.1|531178_532150_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_109683159.1|532173_534867_+	ATP-dependent helicase	NA	A0A1X9I5C8	Streptococcus_phage	34.6	2.8e-47
WP_000858789.1|535188_536481_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
WP_000362218.1|536808_537495_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
>prophage 33
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	541234	541861	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_001108889.1|541234_541861_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 34
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	551185	552064	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_001133025.1|551185_552064_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.1	4.0e-19
>prophage 35
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	589955	599345	2790390		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|589955_590660_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|590904_591099_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000691943.1|591110_591362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160191582.1|591399_592524_+	virulence factor	NA	NA	NA	NA	NA
WP_000995287.1|592539_592977_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|593400_594357_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175750.1|594556_595036_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	1.5e-73
WP_045174249.1|595050_595890_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	3.0e-48
WP_000159900.1|595975_596509_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|596501_596930_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473656.1|596941_597442_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|597441_597663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342146.1|597854_599345_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	2.3e-22
>prophage 36
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	603541	605553	2790390		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|603541_604201_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166801.1|604197_605553_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 37
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	611718	612510	2790390		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|611718_612510_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 38
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	616262	623581	2790390	transposase,lysis	Streptococcus_phage(25.0%)	8	NA	NA
WP_106888601.1|616262_617441_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.9	1.4e-54
WP_045173242.1|618550_619687_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.6	3.3e-34
WP_001788788.1|619718_620348_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|620366_620636_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|620798_621107_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|621277_621478_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|621674_622076_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_045173239.1|622315_623581_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	2.8e-13
>prophage 39
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	631426	633028	2790390		Klosneuvirus(100.0%)	1	NA	NA
WP_000942300.1|631426_633028_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 40
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	638113	641566	2790390		Indivirus(50.0%)	3	NA	NA
WP_000079447.1|638113_638965_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
WP_000974847.1|638971_639613_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077576.1|639751_641566_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.0	1.5e-153
>prophage 41
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	644980	645682	2790390		Tupanvirus(100.0%)	1	NA	NA
WP_000571258.1|644980_645682_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	1.5e-13
>prophage 42
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	653053	655408	2790390		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000154120.1|653053_653836_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	5.5e-28
WP_000173831.1|653837_654836_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.5	1.1e-33
WP_000604817.1|654841_655408_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 43
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	659726	660989	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|659726_660989_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 44
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	670648	675042	2790390		Bacillus_phage(50.0%)	2	NA	NA
WP_001289562.1|670648_673051_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.4	7.9e-94
WP_001548666.1|673050_675042_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 45
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	680979	682626	2790390		Vibrio_phage(100.0%)	1	NA	NA
WP_045173181.1|680979_682626_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	3.3e-22
>prophage 46
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	686295	687417	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691303.1|686295_687417_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 47
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	691567	697240	2790390		Phage_Wrath(25.0%)	7	NA	NA
WP_001208755.1|691567_692191_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	5.9e-17
WP_045173170.1|692570_693434_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	4.1e-16
WP_001791425.1|693507_693612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688122.1|693608_694586_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085655.1|694742_695012_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|695482_695632_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000082539.1|695722_697240_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 48
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	707382	711658	2790390		Bacillus_phage(50.0%)	6	NA	NA
WP_160191701.1|707382_707916_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	44.3	4.0e-22
WP_001027143.1|708054_708243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|708355_708958_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670300.1|708954_710046_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603969.1|710049_710781_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593436.1|710749_711658_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	3.1e-22
>prophage 49
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	715624	722305	2790390	capsid,head	Staphylococcus_phage(100.0%)	13	NA	NA
WP_001120914.1|715624_716086_-|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	46.0	3.8e-29
WP_001641468.1|716476_716746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064132072.1|716865_717078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031835011.1|717044_717173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072361166.1|717365_718229_-|head	head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	51.4	3.8e-30
WP_000956747.1|718274_718526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791646.1|718526_718700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477492.1|718654_718759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|719270_719456_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_001788716.1|719883_719994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002340.1|720695_720902_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
WP_001795785.1|721195_721420_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	5.0e-19
WP_001793526.1|722107_722305_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	50.0	9.9e-11
>prophage 50
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	727375	727852	2790390		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448085.1|727375_727852_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.6e-22
>prophage 51
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	733794	740276	2790390		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103743.1|733794_734613_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|735087_735630_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516263.1|735635_737645_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.8	2.2e-60
WP_045173157.1|737657_740276_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
>prophage 52
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	749690	750734	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|749690_750734_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 53
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	754934	760478	2790390		Bacillus_virus(33.33%)	4	NA	NA
WP_000664766.1|754934_756221_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089941.1|756220_757486_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293307.1|757516_758230_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001806691.1|758234_760478_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 54
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	765620	777433	2790390	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864185.1|765620_766592_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282298.1|766606_767524_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|767692_768043_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043635.1|768428_770546_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020853.1|770550_770868_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|770864_771149_-	YlxR family protein	NA	NA	NA	NA	NA
WP_160191591.1|771169_772345_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|772365_772833_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_078103495.1|773122_777433_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 55
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	781706	782477	2790390		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|781706_782477_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 56
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	787251	800922	2790390	protease,tRNA	Erwinia_phage(16.67%)	11	NA	NA
WP_000379054.1|787251_788655_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	4.9e-27
WP_000072681.1|788720_789266_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_043044510.1|789262_790159_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.5	6.1e-31
WP_000195259.1|790575_791883_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_160191593.1|792038_794114_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	2.3e-105
WP_000593192.1|794287_795160_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000672867.1|795332_796577_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041666.1|796604_797723_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110251.1|797949_798858_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|798879_800046_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176394.1|800154_800922_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 57
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	814306	816944	2790390		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|814306_815038_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|815152_815386_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|816209_816944_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 58
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	827314	829309	2790390		Moumouvirus(100.0%)	1	NA	NA
WP_000579563.1|827314_829309_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 59
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	832456	833392	2790390	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161281.1|832456_833392_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.9	3.6e-10
>prophage 60
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	838401	840658	2790390		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|838401_839601_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|839816_840035_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368226.1|840034_840658_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	1.0e-21
>prophage 61
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	843972	844584	2790390		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|843972_844584_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 62
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	848551	853162	2790390		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|848551_849652_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_045173597.1|849653_850928_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|850945_851827_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|851854_853162_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 63
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	857654	860408	2790390	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384684.1|857654_860408_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 64
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	881967	882156	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245802.1|881967_882156_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	86.9	3.8e-20
>prophage 65
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	891069	893029	2790390		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001802045.1|891069_891294_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765708.1|891250_891397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857488.1|892069_893029_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
>prophage 66
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	906973	911531	2790390		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|906973_907288_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_045174009.1|907460_909809_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.3	1.1e-15
WP_000161942.1|909818_911531_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	8.9e-15
>prophage 67
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	916668	917727	2790390	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003559.1|916668_917727_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 68
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	929661	930144	2790390		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000401377.1|929661_930144_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
>prophage 69
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	935059	935407	2790390		Streptococcus_phage(100.0%)	1	NA	NA
WP_000119686.1|935059_935407_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	34.9	2.4e-12
>prophage 70
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	951567	959948	2790390		Lactococcus_phage(20.0%)	8	NA	NA
WP_012816615.1|951567_951768_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.5	1.9e-17
WP_012816617.1|952465_953074_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	34.4	1.6e-19
WP_042909157.1|953200_953779_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	4.9e-42
WP_001284654.1|954042_954423_-	penicillinase repressor BlaI	NA	NA	NA	NA	NA
WP_000733269.1|956275_957121_+	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	33.7	4.4e-31
WP_000495113.1|957633_958467_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_001791613.1|958666_958759_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_160191605.1|959021_959948_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	1.7e-12
>prophage 71
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	971465	973313	2790390		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182654.1|971465_973313_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 72
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	981448	990282	2790390		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|981448_982543_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020625.1|982555_983095_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455597.1|983238_983514_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|983681_985088_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863440.1|985091_986384_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|986474_987452_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|987455_988568_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668339.1|988739_989366_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957036.1|989730_990282_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 73
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	996397	1000777	2790390		Bacillus_virus(50.0%)	5	NA	NA
WP_001289618.1|996397_996631_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_000040054.1|996867_998586_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|998588_998855_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505966.1|999008_999551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685073.1|999604_1000777_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	2.4e-75
>prophage 74
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1003956	1018716	2790390		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921973.1|1003956_1005357_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273252.1|1005349_1006156_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_042909151.1|1006420_1007668_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709277.1|1007689_1009168_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_000238664.1|1009182_1009749_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
WP_042909150.1|1009751_1010780_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	42.0	1.2e-62
WP_000483713.1|1010772_1012257_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
WP_000032727.1|1012235_1014425_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.7	1.0e-140
WP_000666799.1|1014417_1015089_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848350.1|1015090_1015354_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174053.1|1015353_1016058_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_001010406.1|1016061_1017186_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861572.1|1017172_1017655_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
WP_000225837.1|1017855_1018716_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.2	5.3e-40
>prophage 75
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1029058	1032829	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045172698.1|1029058_1032829_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFB0	Staphylococcus_phage	37.9	8.7e-55
>prophage 76
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1036495	1037542	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_042909148.1|1036495_1037542_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.4e-16
>prophage 77
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1045847	1049568	2790390		Enterococcus_phage(50.0%)	7	NA	NA
WP_001788574.1|1045847_1046138_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
WP_020978112.1|1046201_1046333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081347.1|1046378_1047338_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|1047825_1048182_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001792676.1|1048270_1048408_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_072361064.1|1048548_1048839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571167.1|1048926_1049568_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-19
>prophage 78
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1059762	1064973	2790390	protease	Pithovirus(33.33%)	3	NA	NA
WP_078098579.1|1059762_1062087_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000928413.1|1062305_1063109_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049951.1|1063410_1064973_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
>prophage 79
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1083906	1085715	2790390		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1083906_1085715_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 80
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1091528	1093498	2790390		Bacillus_virus(100.0%)	2	NA	NA
WP_000427767.1|1091528_1092509_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.3e-15
WP_001067052.1|1092511_1093498_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	1.4e-15
>prophage 81
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1097149	1099163	2790390		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786734.1|1097149_1098091_-	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
WP_000140050.1|1098080_1099163_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 82
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1107757	1114568	2790390		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_042909139.1|1107757_1108903_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047066.1|1109012_1109882_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353955.1|1109940_1112550_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044219.1|1112753_1114568_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	34.2	3.0e-37
>prophage 83
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1120824	1124478	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_023913617.1|1120824_1124478_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 84
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1134632	1141678	2790390		Staphylococcus_phage(33.33%)	6	NA	NA
WP_160191614.1|1134632_1135562_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	8.2e-39
WP_000138487.1|1135951_1137196_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167314.1|1137304_1138495_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
WP_000838029.1|1138802_1139930_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1140291_1140669_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1141084_1141678_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 85
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1151598	1155226	2790390		Mycoplasma_phage(50.0%)	3	NA	NA
WP_042909197.1|1151598_1153074_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	35.2	9.0e-48
WP_000046076.1|1153204_1154413_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1154866_1155226_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 86
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1159268	1161937	2790390		Pseudomonas_phage(50.0%)	2	NA	NA
WP_160191616.1|1159268_1160483_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	1.1e-19
WP_042909198.1|1160479_1161937_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	2.2e-38
>prophage 87
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1175059	1178582	2790390		environmental_halophage(50.0%)	3	NA	NA
WP_000807670.1|1175059_1176301_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
WP_000205572.1|1176415_1177723_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1177820_1178582_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 88
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1182079	1183105	2790390		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571213.1|1182079_1183105_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
>prophage 89
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1186157	1191334	2790390		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1186157_1186514_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001190695.1|1186657_1186978_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1187127_1187667_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150013.1|1187749_1188466_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.6	2.3e-17
WP_000974460.1|1188613_1189036_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1189434_1189929_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255557.1|1190083_1190701_+	amino acid transporter	NA	NA	NA	NA	NA
WP_016187137.1|1190773_1191334_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 90
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1194737	1195981	2790390		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1194737_1194938_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001792695.1|1195294_1195981_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 91
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1205252	1214130	2790390		Staphylococcus_phage(50.0%)	9	NA	NA
WP_000757401.1|1205252_1205981_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	1.4e-17
WP_001057759.1|1206172_1206319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058299.1|1206334_1206658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001085185.1|1207979_1208444_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_031836900.1|1208465_1210838_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.0	2.3e-93
WP_001165961.1|1210871_1211612_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_000556760.1|1211727_1211961_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1212027_1212486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1212825_1214130_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 92
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1223245	1229115	2790390		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1223245_1223833_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1224396_1225341_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1225451_1226447_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_160191623.1|1226443_1227355_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1228179_1229115_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 93
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1233559	1236406	2790390		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662681.1|1233559_1236406_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
>prophage 94
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1239723	1240563	2790390		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_042909100.1|1239723_1240563_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	43.1	2.0e-12
>prophage 95
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1246641	1252353	2790390		Streptococcus_phage(66.67%)	5	NA	NA
WP_001793589.1|1246641_1247724_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.5	2.0e-44
WP_045173015.1|1248087_1248954_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192949.1|1249097_1249739_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
WP_000258151.1|1249909_1250965_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1251282_1252353_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 96
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1261635	1284811	2790390		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616839.1|1261635_1262397_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
WP_001245577.1|1262393_1263350_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|1263336_1264308_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|1264346_1264502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1264682_1265654_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_160191625.1|1265771_1267877_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.6	0.0e+00
WP_000692521.1|1267839_1268238_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068497.1|1269038_1269905_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1269924_1270425_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1270765_1272271_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_045173010.1|1272348_1272450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045173009.1|1272540_1273458_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	3.7e-07
WP_000197262.1|1274081_1274624_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663030.1|1274918_1275977_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
WP_160191627.1|1276216_1277731_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589260.1|1277723_1278701_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
WP_000983677.1|1278923_1280705_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525103.1|1280716_1282600_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	6.7e-56
WP_000098285.1|1282870_1284811_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 97
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1287950	1297796	2790390		Pandoravirus(12.5%)	12	NA	NA
WP_001217794.1|1287950_1289102_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	3.5e-23
WP_000604515.1|1289085_1289679_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	43.5	1.2e-38
WP_000446724.1|1290029_1290698_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1290699_1291119_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|1291122_1291836_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637687.1|1291934_1292519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093553.1|1292798_1293239_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1293580_1294054_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1294028_1294715_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244415.1|1294714_1295770_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_045173007.1|1295841_1296825_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	4.3e-62
WP_045173005.1|1296956_1297796_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	3.0e-56
>prophage 98
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1309408	1310782	2790390		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_064132033.1|1309408_1310782_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	33.6	3.9e-45
>prophage 99
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1315759	1322039	2790390		Bacillus_phage(33.33%)	6	NA	NA
WP_000857620.1|1315759_1317433_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.4	3.4e-11
WP_000737158.1|1317429_1319061_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	5.2e-12
WP_000469892.1|1319279_1320155_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1320326_1321010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148828.1|1321012_1321471_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_045172980.1|1321472_1322039_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.4	1.8e-20
>prophage 100
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1328752	1329226	2790390		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|1328752_1329226_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 101
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1334488	1335286	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_000731641.1|1334488_1335286_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	9.3e-07
>prophage 102
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1340118	1340880	2790390		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1340118_1340880_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 103
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1345250	1346294	2790390		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_045172966.1|1345250_1346294_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	28.0	4.4e-17
>prophage 104
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1352817	1353615	2790390		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1352817_1353615_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 105
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1356840	1360799	2790390		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1356840_1358568_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793073.1|1358988_1360284_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.6	5.7e-14
WP_000832260.1|1360400_1360799_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 106
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1367733	1368477	2790390		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1367733_1368477_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 107
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1379628	1380189	2790390	integrase	Streptococcus_phage(100.0%)	1	1373782:1373796	1383785:1383799
1373782:1373796	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|1379628_1380189_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|1379628_1380189_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
1383785:1383799	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 108
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1393085	1396439	2790390		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1393085_1394096_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_160191702.1|1394594_1395116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180230.1|1395143_1396439_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	2.1e-24
>prophage 109
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1404630	1405953	2790390		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_045172944.1|1404630_1405953_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.1	5.3e-108
>prophage 110
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1417257	1417914	2790390		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1417257_1417914_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 111
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1421555	1424876	2790390		Staphylococcus_phage(50.0%)	2	NA	NA
WP_045172931.1|1421555_1422932_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.1	3.0e-21
WP_000347061.1|1423475_1424876_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 112
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1448379	1449042	2790390		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1448379_1449042_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 113
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1455620	1456808	2790390		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|1455620_1456808_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 114
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1459836	1470790	2790390		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1459836_1461918_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1462040_1462511_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1462576_1462990_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1463087_1463342_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|1463478_1467075_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1467238_1470790_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 115
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1474473	1479256	2790390	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1474473_1475022_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1475034_1475217_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1475272_1475416_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_045174125.1|1475530_1476100_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664738.1|1476180_1476705_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1476704_1477451_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1477458_1477863_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631974.1|1477855_1479256_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.2	1.5e-55
>prophage 116
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1485267	1487724	2790390	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_045174120.1|1485267_1487724_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.4	6.1e-134
>prophage 117
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1506923	1517195	2790390	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1506923_1508411_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1508463_1508556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613715.1|1508949_1509426_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1509422_1509788_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167924.1|1509765_1510569_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.3	1.3e-21
WP_000057594.1|1510784_1511717_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1511895_1512777_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_045174227.1|1513005_1515099_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1515355_1515895_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_061823680.1|1515899_1517195_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	8.2e-13
>prophage 118
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1526451	1528916	2790390		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1526451_1527417_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252529.1|1527563_1528916_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 119
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1534802	1537900	2790390	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051132.1|1534802_1536776_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.5e-93
WP_000279926.1|1537060_1537900_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 120
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1541806	1542424	2790390		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1541806_1542424_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 121
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1551620	1553318	2790390		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109040.1|1551620_1553318_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 122
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1569964	1576202	2790390		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170264.1|1569964_1570969_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.2	1.6e-24
WP_000825530.1|1571300_1572143_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000468003.1|1572179_1572839_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_045173140.1|1572842_1573868_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	7.4e-33
WP_001036657.1|1574161_1575304_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634095.1|1575296_1576202_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	5.0e-49
>prophage 123
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1598191	1600967	2790390		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072580.1|1598191_1599418_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.1	4.8e-47
WP_000028670.1|1599410_1600967_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.3	1.4e-288
>prophage 124
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1615251	1618270	2790390		Staphylococcus_phage(33.33%)	3	NA	NA
WP_000212549.1|1615251_1615584_-	hypothetical protein	NA	A0A0N9SJ02	Staphylococcus_phage	54.8	1.7e-10
WP_001255834.1|1616083_1616929_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	40.1	5.9e-52
WP_000800379.1|1617517_1618270_+	S8 family serine peptidase	NA	A0A1W6JND5	Lactococcus_phage	32.2	9.6e-14
>prophage 125
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1623356	1626389	2790390		Hokovirus(50.0%)	2	NA	NA
WP_000424968.1|1623356_1624898_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1624922_1626389_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 126
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1635348	1636872	2790390		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930514.1|1635348_1636872_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.4e-40
>prophage 127
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1644434	1652851	2790390	integrase	Staphylococcus_phage(66.67%)	12	1642400:1642414	1648888:1648902
1642400:1642414	attL	TTTAATGCAATAACA	NA	NA	NA	NA
WP_001808003.1|1644434_1644572_+	hypothetical protein	NA	Q4ZE80	Staphylococcus_phage	75.6	2.8e-12
WP_115304765.1|1644670_1644898_+|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZE80	Staphylococcus_phage	66.0	5.1e-11
WP_001817700.1|1645018_1645957_+	Abi family protein	NA	NA	NA	NA	NA
WP_000897044.1|1646222_1646465_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000934799.1|1646517_1647021_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1647041_1647338_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1647581_1647773_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1647858_1648956_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
1648888:1648902	attR	TGTTATTGCATTAAA	NA	NA	NA	NA
WP_000157345.1|1648967_1649171_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_001077602.1|1649200_1650082_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001566903.1|1650238_1651084_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655707.1|1651747_1652851_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	29.0	4.6e-12
>prophage 128
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1662783	1663626	2790390		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209554.1|1662783_1663626_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	3.8e-11
>prophage 129
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1684841	1687576	2790390		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_045173100.1|1684841_1685864_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_045173099.1|1685841_1686786_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_061823611.1|1686775_1687576_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.9	8.9e-42
>prophage 130
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1705811	1706489	2790390		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911017.1|1705811_1706489_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 131
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1720689	1725120	2790390		Mycobacterium_phage(100.0%)	1	NA	NA
WP_160191643.1|1720689_1725120_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.6e-28
>prophage 132
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1737755	1739414	2790390		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570070.1|1737755_1738415_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736803.1|1738466_1739414_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 133
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1748758	1750195	2790390		Pandoravirus(100.0%)	1	NA	NA
WP_045172772.1|1748758_1750195_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	6.3e-30
>prophage 134
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1753955	1758494	2790390		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1753955_1755695_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_000608821.1|1755954_1756629_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975346.1|1756772_1758494_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 135
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1767821	1768865	2790390		Synechococcus_phage(100.0%)	1	NA	NA
WP_045172781.1|1767821_1768865_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	2.7e-14
>prophage 136
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1776079	1777609	2790390		Vibrio_phage(100.0%)	1	NA	NA
WP_045172784.1|1776079_1777609_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 137
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1786484	1787990	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045172793.1|1786484_1787990_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	4.6e-39
>prophage 138
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1799086	1804445	2790390		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1799086_1801336_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_045172802.1|1801923_1802892_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127985.1|1802888_1804445_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 139
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1814869	1816929	2790390		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818910.1|1814869_1815967_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166919.1|1816350_1816929_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	39.4	9.7e-14
>prophage 140
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1845202	1846387	2790390		Klosneuvirus(100.0%)	1	NA	NA
WP_160191650.1|1845202_1846387_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.5e-34
>prophage 141
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1851221	1861503	2790390		Tupanvirus(50.0%)	3	NA	NA
WP_160191704.1|1851221_1858397_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.4	1.0e-67
WP_000826856.1|1858843_1860094_-	MFS transporter	NA	NA	NA	NA	NA
WP_045172832.1|1860477_1861503_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 142
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1865041	1868271	2790390		Bacillus_virus(50.0%)	4	NA	NA
WP_160191654.1|1865041_1865782_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	1.9e-38
WP_045172840.1|1866123_1866636_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1866814_1867018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013481.1|1867311_1868271_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 143
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1871612	1874097	2790390		Catovirus(50.0%)	2	NA	NA
WP_000723449.1|1871612_1872758_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.1	3.2e-24
WP_045172848.1|1872834_1874097_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	1.9e-22
>prophage 144
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1880932	1887497	2790390		Catovirus(50.0%)	6	NA	NA
WP_045172857.1|1880932_1882057_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.8	1.3e-128
WP_001028286.1|1882060_1883170_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1883182_1884211_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940790.1|1884200_1886024_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	5.2e-29
WP_000565293.1|1886043_1886808_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037328.1|1886810_1887497_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 145
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1891519	1892695	2790390		Clostridium_phage(100.0%)	1	NA	NA
WP_045172866.1|1891519_1892695_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.6	2.0e-29
>prophage 146
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1898153	1898927	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1898153_1898927_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 147
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1906961	1907561	2790390		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1906961_1907561_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 148
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1912498	1917595	2790390		Catovirus(50.0%)	6	NA	NA
WP_001793242.1|1912498_1913479_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
WP_001789407.1|1913548_1913671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183771.1|1913814_1914591_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414623.1|1914802_1915429_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|1915624_1916389_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223709.1|1916392_1917595_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	3.9e-09
>prophage 149
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1925861	1930071	2790390		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1925861_1926842_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1927072_1928065_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000924993.1|1928080_1929076_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136643.1|1929072_1930071_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.9	9.8e-14
>prophage 150
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1966182	1967250	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816129.1|1966182_1967250_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.5	3.5e-09
>prophage 151
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1974520	1976395	2790390		Clostridium_phage(100.0%)	1	NA	NA
WP_086041091.1|1974520_1976395_-	DEAD/DEAH box helicase	NA	A0A249XXD7	Clostridium_phage	23.1	3.6e-09
>prophage 152
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	1989985	1999988	2790390		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|1989985_1990786_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_045172593.1|1991174_1991963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060140.1|1991963_1993298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|1993290_1995117_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|1995129_1995831_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|1997026_1998310_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|1998587_1999988_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 153
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2006677	2015723	2790390	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884328.1|2006677_2007964_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.4	9.2e-89
WP_000177458.1|2008342_2009857_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.5e-90
WP_000449218.1|2010182_2010995_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819083.1|2011082_2013752_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	2.7e-119
WP_000255586.1|2013788_2015723_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
>prophage 154
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2025805	2032336	2790390		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_045172596.1|2025805_2026645_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	1.7e-06
WP_000491382.1|2027096_2027450_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779136.1|2027517_2027913_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054118.1|2028144_2028714_+	helix-turn-helix domain-containing protein	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|2028831_2029032_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_045172598.1|2029423_2029615_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_045172599.1|2029707_2031588_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|2031577_2032336_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 155
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2046589	2048302	2790390		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138657.1|2046589_2048302_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 156
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2067332	2068025	2790390		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|2067332_2068025_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 157
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2094697	2096557	2790390		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125614.1|2094697_2096557_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 158
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2122007	2123759	2790390		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_160191665.1|2122007_2122895_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	4.3e-05
WP_000923760.1|2123003_2123759_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 159
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2127179	2127677	2790390		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2127179_2127677_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 160
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2132725	2135109	2790390		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071717.1|2132725_2134576_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.2e-235
WP_000173329.1|2134572_2135109_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.6	1.3e-41
>prophage 161
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2139986	2144701	2790390	holin	Klosneuvirus(50.0%)	4	NA	NA
WP_160191666.1|2139986_2141696_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2141973_2142186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708240.1|2142465_2142909_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172340.1|2143102_2144701_+	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
>prophage 162
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2148761	2150099	2790390		Klosneuvirus(100.0%)	1	NA	NA
WP_045172628.1|2148761_2150099_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.4	3.9e-18
>prophage 163
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2179170	2182959	2790390		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751267.1|2179170_2179872_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	4.0e-38
WP_000379830.1|2181147_2182959_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.3	9.7e-36
>prophage 164
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2191381	2195444	2790390		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161366.1|2191381_2192380_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076661.1|2192469_2192676_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024143.1|2193035_2195444_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	41.0	4.9e-128
>prophage 165
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2204685	2207721	2790390	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_160191668.1|2204685_2206791_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	2.4e-118
WP_000455987.1|2207199_2207721_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
>prophage 166
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2215065	2221434	2790390		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062658.1|2215065_2216805_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.3	2.7e-35
WP_000473675.1|2217105_2219172_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2219536_2219947_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_106459674.1|2219988_2220333_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228169.1|2220465_2221434_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	5.2e-12
>prophage 167
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2231018	2232011	2790390		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161536.1|2231018_2232011_-	D-lactate dehydrogenase	NA	M1HYB0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-36
>prophage 168
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2241292	2241988	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382904.1|2241292_2241988_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.0	3.0e-38
>prophage 169
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2262439	2263306	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_000721336.1|2262439_2263306_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	1.3e-78
>prophage 170
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2271105	2275839	2790390		Streptococcus_phage(100.0%)	3	NA	NA
WP_078103466.1|2271105_2272914_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.9	1.6e-94
WP_000446878.1|2273031_2274501_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
WP_001033636.1|2274600_2275839_+	DNA cytosine methyltransferase	NA	A0A141E0F9	Streptococcus_phage	29.5	8.4e-31
>prophage 171
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2283697	2284393	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_000217471.1|2283697_2284393_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	37.5	2.3e-09
>prophage 172
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2287821	2288640	2790390		Moumouvirus(100.0%)	1	NA	NA
WP_000824941.1|2287821_2288640_+	SDR family oxidoreductase	NA	A0A2P1ELN2	Moumouvirus	27.7	5.0e-08
>prophage 173
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2296508	2298066	2790390		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173870.1|2296508_2297324_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	2.3e-13
WP_064132140.1|2297316_2298066_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.4e-20
>prophage 174
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2305201	2309628	2790390		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_006191024.1|2305201_2305864_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	7.9e-20
WP_006191020.1|2305856_2306633_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026187.1|2307026_2308214_+	MFS transporter	NA	NA	NA	NA	NA
WP_160191672.1|2308275_2309628_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 175
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2314356	2316215	2790390		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948981.1|2314356_2315583_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|2315579_2316215_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 176
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2333942	2340149	2790390		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2333942_2335085_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779360.1|2335352_2335739_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2335872_2335980_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_045172654.1|2336627_2338391_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	6.5e-37
WP_000486494.1|2338415_2340149_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 177
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2343610	2349381	2790390		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971547.1|2343610_2344726_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	7.1e-21
WP_000286879.1|2344736_2345429_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200945.1|2345439_2345907_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_000783428.1|2345958_2346936_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916713.1|2346937_2347885_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.1	1.2e-138
WP_000594519.1|2348451_2349381_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 178
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2357328	2358060	2790390		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|2357328_2358060_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 179
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2374714	2376274	2790390		Escherichia_phage(100.0%)	1	NA	NA
WP_000692645.1|2374714_2376274_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 180
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2397811	2398846	2790390		Bacillus_virus(100.0%)	1	NA	NA
WP_000655972.1|2397811_2398846_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 181
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2408697	2414840	2790390	transposase	Hokovirus(25.0%)	5	NA	NA
WP_045172664.1|2408697_2410071_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	2.3e-13
WP_000249497.1|2410063_2410738_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761399.1|2410873_2411929_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229920.1|2411928_2412594_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
WP_106888601.1|2413661_2414840_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.9	1.4e-54
>prophage 182
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2418731	2419940	2790390		Salmonella_phage(100.0%)	1	NA	NA
WP_000999131.1|2418731_2419940_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	3.9e-33
>prophage 183
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2432034	2432934	2790390		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524832.1|2432034_2432934_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 184
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2440305	2440725	2790390		Bacillus_phage(100.0%)	1	NA	NA
WP_045174195.1|2440305_2440725_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.1	1.0e-36
>prophage 185
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2446838	2447720	2790390		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730043.1|2446838_2447720_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	2.2e-62
>prophage 186
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2455598	2456234	2790390		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2455598_2456234_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 187
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2461824	2463003	2790390	transposase	Streptococcus_phage(100.0%)	1	NA	NA
WP_106888601.1|2461824_2463003_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.9	1.4e-54
>prophage 188
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2471362	2475701	2790390		Staphylococcus_phage(50.0%)	4	NA	NA
WP_078103498.1|2471362_2472001_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_045173640.1|2472669_2473794_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	5.5e-13
WP_045173642.1|2473885_2474839_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.6	3.2e-30
WP_000737705.1|2475200_2475701_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 189
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2479618	2480428	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717388.1|2479618_2480428_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 190
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2499409	2500015	2790390		Pithovirus(100.0%)	1	NA	NA
WP_000913021.1|2499409_2500015_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.1	2.5e-12
>prophage 191
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2512098	2515266	2790390		Leptospira_phage(100.0%)	1	NA	NA
WP_045173679.1|2512098_2515266_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	6.2e-62
>prophage 192
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2538960	2540627	2790390		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_045173697.1|2538960_2539770_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	4.8e-19
WP_045173699.1|2539766_2540627_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 193
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2544177	2549546	2790390		Yellowstone_lake_phycodnavirus(50.0%)	5	NA	NA
WP_000130145.1|2544177_2545842_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_103086499.1|2545878_2546583_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_045173705.1|2546946_2547372_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044362.1|2547665_2548481_+	hydrolase	NA	NA	NA	NA	NA
WP_160191687.1|2548691_2549546_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	37.9	3.8e-06
>prophage 194
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2552926	2555236	2790390		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001015500.1|2552926_2553775_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
WP_000875476.1|2554007_2554211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001557494.1|2554495_2555236_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 195
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2561556	2562969	2790390		Pandoravirus(100.0%)	1	NA	NA
WP_000169224.1|2561556_2562969_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 196
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2566937	2568500	2790390		Vibrio_phage(100.0%)	1	NA	NA
WP_000792342.1|2566937_2568500_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 197
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2578703	2579672	2790390		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2578703_2579672_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 198
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2595556	2596465	2790390		Klosneuvirus(100.0%)	1	NA	NA
WP_045173417.1|2595556_2596465_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 199
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2600056	2607478	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_045173424.1|2600056_2607478_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	23.9	3.6e-20
>prophage 200
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2613734	2616554	2790390		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334463.1|2613734_2615540_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
WP_000908177.1|2615771_2616554_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	1.7e-08
>prophage 201
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2629160	2632992	2790390		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2629160_2629604_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_160191692.1|2629724_2630435_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_103086520.1|2630749_2631412_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242318.1|2631690_2632992_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	2.7e-133
>prophage 202
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2640930	2642541	2790390		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2640930_2642541_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 203
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2650343	2658093	2790390		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2650343_2650943_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2650943_2652020_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248734.1|2652006_2652843_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_072362259.1|2652875_2653973_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|2653969_2654389_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654185.1|2654495_2655020_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2655046_2656285_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2656312_2656942_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723418.1|2656965_2658093_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 204
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2668494	2668890	2790390		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|2668494_2668890_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 205
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2674851	2675499	2790390		Moumouvirus(100.0%)	1	NA	NA
WP_001187630.1|2674851_2675499_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 206
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2682699	2684220	2790390		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2682699_2684220_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 207
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2689908	2691936	2790390		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_045173491.1|2689908_2691936_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.2	1.3e-25
>prophage 208
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2697086	2700471	2790390		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2697086_2697449_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2697798_2698800_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2698918_2699245_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190829.1|2699246_2699726_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041103.1|2699700_2700471_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 209
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2714400	2719124	2790390		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094580.1|2714400_2715930_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_000214552.1|2715959_2716964_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2717100_2717355_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_160191695.1|2717354_2719124_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	7.0e-63
>prophage 210
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2722884	2736732	2790390	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159053.1|2722884_2723910_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.6	5.8e-62
WP_044290669.1|2724011_2725622_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	26.9	4.3e-19
WP_001792272.1|2725710_2725839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602069.1|2725983_2727912_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	30.4	2.4e-53
WP_001283612.1|2728164_2728800_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_160191710.1|2729154_2730183_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581077.1|2730242_2730467_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_045174166.1|2730674_2731925_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.8e-40
WP_000790329.1|2732107_2733058_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141427.1|2733206_2734691_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.6	6.8e-19
WP_001253302.1|2734687_2735647_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688498.1|2736015_2736732_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	3.0e-25
>prophage 211
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2743877	2762279	2790390	terminase,integrase	Staphylococcus_phage(65.0%)	24	2745837:2745856	2760923:2760942
WP_000917289.1|2743877_2744162_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240642.1|2744237_2745854_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
2745837:2745856	attL	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_000179346.1|2745922_2747095_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	97.9	1.3e-219
WP_000620857.1|2747108_2747783_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	45.8	1.6e-39
WP_000153640.1|2747955_2748174_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JB11	uncultured_Caudovirales_phage	66.7	1.3e-19
WP_000481967.1|2748178_2748496_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	98.1	9.2e-51
WP_000708434.1|2748492_2748639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058492.1|2748631_2748841_+	hypothetical protein	NA	Q4ZE76	Staphylococcus_phage	95.7	7.7e-30
WP_103144651.1|2748843_2749164_+	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	50.9	3.8e-20
WP_053040303.1|2749227_2750097_+	mobile element-associated protein	NA	A0A1W6JQL5	Staphylococcus_phage	93.4	5.3e-157
WP_053040304.1|2750113_2751583_+	virulence-associated protein E	NA	A0A1W6JQD6	Staphylococcus_phage	96.7	1.7e-280
WP_001039165.1|2751861_2752224_+	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	95.8	4.6e-62
WP_001804819.1|2752225_2752489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123090293.1|2752490_2753132_+	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	93.0	1.4e-109
WP_001190610.1|2753669_2754011_+	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	99.1	8.4e-58
WP_000846290.1|2754023_2754602_+	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	39.5	1.3e-29
WP_000448775.1|2754619_2754838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001656917.1|2755564_2755777_+	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	97.1	5.4e-31
WP_001293071.1|2755773_2756343_+|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	98.4	4.6e-101
WP_000801980.1|2756619_2757588_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	2.7e-24
WP_031792985.1|2758744_2759545_+	staphylococcal enterotoxin type B	NA	A0A097PAT7	Streptococcus_pyogenes_phage	45.9	2.3e-53
WP_001035619.1|2759622_2760180_-	DUF4888 domain-containing protein	NA	A0A1W6JQE5	Staphylococcus_phage	74.3	8.6e-68
WP_000201397.1|2761476_2761656_+	hypothetical protein	NA	NA	NA	NA	NA
2760923:2760942	attR	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_000216894.1|2761652_2762279_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	44.5	7.0e-42
>prophage 212
NZ_CP047786	Staphylococcus aureus strain UP_1150 chromosome, complete genome	2790390	2768167	2789921	2790390	integrase	Staphylococcus_phage(100.0%)	39	2757497:2757512	2783757:2783772
2757497:2757512	attL	ATTATTCACATTCTTT	NA	NA	NA	NA
WP_000791404.1|2768167_2769220_+	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.6	2.5e-36
WP_000595401.1|2769241_2770258_+	bi-component leukocidin LukGH subunit G	NA	A0A2I6PER8	Staphylococcus_phage	29.3	2.3e-26
WP_000857198.1|2771376_2772414_-|integrase	site-specific integrase	integrase	A0A1X9H022	Staphylococcus_phage	100.0	2.6e-179
WP_000825947.1|2772472_2772937_-	hypothetical protein	NA	A0EWV3	Staphylococcus_phage	100.0	1.1e-28
WP_000705248.1|2773036_2773219_-	hypothetical protein	NA	M9NSW6	Staphylococcus_phage	100.0	4.1e-27
WP_000591749.1|2773422_2773764_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_160191697.1|2773769_2774702_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	99.7	2.2e-172
WP_001031454.1|2774717_2775431_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_001801500.1|2775393_2775567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061823675.1|2775563_2775827_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	98.9	2.1e-40
WP_001025404.1|2775842_2776058_+	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
WP_000128907.1|2776046_2776376_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_001148605.1|2776426_2777179_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_160191699.1|2777194_2777392_+	hypothetical protein	NA	O80075	Staphylococcus_phage	86.2	5.0e-23
WP_000762521.1|2777378_2777759_-	DUF2513 domain-containing protein	NA	Q9T1Z5	Staphylococcus_phage	100.0	1.2e-68
WP_061823677.1|2777813_2778137_+	DUF771 domain-containing protein	NA	A0A075LYF5	Staphylococcus_phage	99.1	5.1e-57
WP_000048129.1|2778133_2778295_+	DUF1270 family protein	NA	A0A1P8L6G0	Staphylococcus_phage	100.0	1.9e-20
WP_000165371.1|2778389_2778692_+	DUF2482 family protein	NA	A0A1P8L6F8	Staphylococcus_phage	100.0	7.0e-48
WP_000291510.1|2778696_2778957_+	DUF1108 family protein	NA	A0A1P8L6F5	Staphylococcus_phage	100.0	5.2e-44
WP_001205732.1|2778965_2779229_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000138475.1|2781182_2782103_+	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
WP_078169454.1|2782183_2782801_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_000934769.1|2782801_2783272_+	single-stranded DNA-binding protein	NA	A0A0E3T9H6	Staphylococcus_phage	100.0	5.7e-81
WP_000148329.1|2783301_2784195_+	DnaD domain-containing protein	NA	A0A0E3TAG7	Staphylococcus_phage	100.0	1.1e-141
2783757:2783772	attR	AAAGAATGTGAATAAT	NA	NA	NA	NA
WP_000338528.1|2784201_2784420_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401964.1|2784428_2784833_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0E3XBN4	Staphylococcus_phage	100.0	1.4e-72
WP_000101270.1|2784845_2785214_+	hypothetical protein	NA	A0A0E3XD52	Staphylococcus_phage	100.0	6.7e-53
WP_000131377.1|2785217_2785460_+	hypothetical protein	NA	R9QT89	Staphylococcus_phage	100.0	3.0e-41
WP_061745477.1|2785473_2785860_+	hypothetical protein	NA	I1W655	Staphylococcus_phage	99.2	1.6e-68
WP_000982708.1|2786047_2786497_+	hypothetical protein	NA	A0A2I6PDH2	Staphylococcus_phage	100.0	9.3e-81
WP_001105621.1|2786493_2786778_+	hypothetical protein	NA	E9LT36	Staphylococcus_phage	100.0	2.7e-46
WP_001065083.1|2786770_2787019_+	DUF1024 family protein	NA	A0A2K9VBU0	Staphylococcus_phage	100.0	3.1e-38
WP_000185669.1|2787011_2787548_+	hypothetical protein	NA	R4IG63	Staphylococcus_phage	100.0	9.4e-96
WP_000195810.1|2787584_2787791_+	DUF1381 domain-containing protein	NA	S4V684	Staphylococcus_phage	100.0	7.6e-30
WP_000595267.1|2787787_2787937_+	hypothetical protein	NA	R9QSU6	Staphylococcus_phage	100.0	1.8e-17
WP_001005262.1|2788095_2788746_+	hypothetical protein	NA	D2JLD8	Staphylococcus_phage	100.0	8.9e-117
WP_000265043.1|2788745_2788946_+	DUF1514 domain-containing protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|2788973_2789390_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988330.1|2789621_2789921_+	HNH endonuclease	NA	G4KNP8	Staphylococcus_phage	100.0	4.6e-52
