The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	0	24289	2798472	protease,holin,capsid,terminase,head,tail,portal	Staphylococcus_phage(100.0%)	28	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154559.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114227.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	99.3	2.1e-68
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268733.1|6484_7129_+|tail	phage tail protein	tail	A0A1X9H0J2	Staphylococcus_phage	100.0	1.5e-119
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_160175949.1|8039_12569_+|tail	phage tail tape measure protein	tail	A0A1X9H084	Staphylococcus_phage	95.4	0.0e+00
WP_000567413.1|12565_14050_+|tail	phage tail protein	tail	A0EX04	Staphylococcus_phage	100.0	4.5e-297
WP_160175950.1|14065_17851_+	hypothetical protein	NA	A0A1X9H0H3	Staphylococcus_phage	98.3	0.0e+00
WP_001153681.1|17840_17993_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040261.1|18039_18327_+	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
WP_000539688.1|18384_18681_+	DUF2951 domain-containing protein	NA	D2JLG2	Staphylococcus_phage	100.0	2.9e-46
WP_011447039.1|18830_19007_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|19059_19167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|19218_19473_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|19484_20240_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000919350.1|20430_20922_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_020444758.1|21448_21907_+	amidase	NA	R9QTN8	Staphylococcus_phage	98.7	4.9e-85
WP_000727649.1|22001_22451_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|23135_23486_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|23538_23799_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|24109_24289_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
>prophage 2
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	30222	32669	2798472		Staphylococcus_phage(100.0%)	3	NA	NA
WP_000991315.1|30222_31119_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645732.1|31119_31800_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|31796_32669_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
>prophage 3
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	37914	38316	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160175952.1|37914_38316_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.1	3.0e-22
>prophage 4
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	42512	44543	2798472		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|42512_43073_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275719.1|43445_44543_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
>prophage 5
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	48573	50857	2798472		Bacillus_virus(100.0%)	2	NA	NA
WP_000284434.1|48573_50043_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
WP_000040861.1|50035_50857_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 6
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	54548	61326	2798472		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|54548_55844_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|55952_56255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272063.1|56437_57130_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|57126_59319_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774552.1|59322_61326_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
>prophage 7
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	68611	73639	2798472		Catovirus(33.33%)	5	NA	NA
WP_001231458.1|68611_69559_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001147874.1|69639_71001_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	43.0	1.5e-102
WP_000548777.1|71170_71701_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140179.1|71947_73018_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|73084_73639_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 8
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	77092	77506	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001643743.1|77092_77506_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.5	3.0e-17
>prophage 9
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	82543	83173	2798472		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|82543_83173_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 10
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	98654	100391	2798472		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|98654_100391_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 11
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	116869	171595	2798472	protease,tRNA,transposase	Staphylococcus_phage(70.59%)	48	NA	NA
WP_078092109.1|116869_117598_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
WP_001793998.1|117733_118876_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000181394.1|118880_119351_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_001251219.1|119509_120109_+	glucosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000031108.1|120133_120286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160175954.1|120886_121282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116227.1|121477_122863_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000669380.1|123318_124140_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000437967.1|124302_125415_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_001045133.1|125436_126060_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000375864.1|126417_126882_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000992513.1|127060_128185_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000290301.1|128253_128598_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
WP_000238227.1|129485_130682_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_160175955.1|130671_133608_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_160175956.1|133604_134546_+	3'-5' exoribonuclease YhaM	NA	NA	NA	NA	NA
WP_000782130.1|134666_135629_-	foldase	NA	NA	NA	NA	NA
WP_000477959.1|135833_136391_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000648118.1|137123_137489_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_000004981.1|137630_138053_-	HIT family protein	NA	NA	NA	NA	NA
WP_000216874.1|138186_138927_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
WP_001245764.1|138919_140143_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000737983.1|140266_140770_-	signal transduction protein TRAP	NA	NA	NA	NA	NA
WP_000233541.1|141031_142069_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_000162875.1|142126_143050_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000167535.1|143073_144474_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_000132893.1|144793_145348_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_147612242.1|146790_147573_+	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	38.6	8.7e-34
WP_000821649.1|147854_148574_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
WP_000721567.1|148608_149337_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
WP_160175957.1|149490_150276_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
WP_001235656.1|150314_151070_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	40.8	2.3e-39
WP_000736707.1|151353_152130_+	staphylococcal enterotoxin type G	NA	NA	NA	NA	NA
WP_000617706.1|153501_153738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000711497.1|154324_155671_-	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.3	6.7e-66
WP_000595635.1|155917_156433_-	membrane protein	NA	NA	NA	NA	NA
WP_001039022.1|157447_158167_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.7	6.4e-124
WP_001038766.1|158290_159007_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
WP_001038730.1|159173_159890_+|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	64.7	2.4e-86
WP_160175958.1|160053_160770_+|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	96.6	1.9e-128
WP_001038742.1|160939_161659_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	98.3	1.0e-129
WP_001794363.1|161838_163578_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	3.2e-286
WP_000072622.1|163570_164725_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
WP_000413389.1|164761_166579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095390.1|166840_167140_-	secretion protein	NA	NA	NA	NA	NA
WP_000619920.1|168808_169258_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_160176124.1|169485_169845_+	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
WP_111223317.1|169948_171595_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	1.3e-294
>prophage 12
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	177740	218252	2798472	tRNA,protease	Staphylococcus_phage(94.29%)	44	NA	NA
WP_000125075.1|177740_178310_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
WP_001093574.1|178309_179677_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000414222.1|179825_180398_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
WP_000627550.1|180495_180840_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
WP_000669038.1|180880_181507_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
WP_000070654.1|181582_182578_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
WP_001794016.1|182658_183309_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
WP_016186903.1|183611_184067_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
WP_000348372.1|184225_185704_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
WP_000778539.1|185708_186710_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
WP_000718107.1|186706_186964_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672010.1|187029_187503_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
WP_001801476.1|187507_188254_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
WP_160175959.1|188546_190139_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.6	0.0e+00
WP_000933819.1|190510_191704_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366165.1|191828_192737_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
WP_000453316.1|192948_193782_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.6	1.2e-158
WP_160175960.1|194031_194385_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	83.8	1.9e-20
WP_001200542.1|194381_194747_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091444.1|195001_195304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|195562_196276_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_160175961.1|196733_197354_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001168914.1|197520_198156_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001030476.1|198453_198897_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
WP_160175962.1|198883_199327_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671059.1|199439_199910_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	85.8	7.7e-70
WP_000384171.1|200108_200333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|200608_201463_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989104.1|201549_202842_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
WP_000221190.1|202841_203156_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	1.3e-52
WP_001261683.1|203798_205301_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
WP_001819953.1|205793_206825_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
WP_000493891.1|206831_207464_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
WP_001159032.1|207474_208656_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
WP_001008553.1|208668_209133_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	98.1	4.9e-69
WP_033844730.1|209254_210256_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	98.8	1.1e-182
WP_014937042.1|210367_210487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266096.1|210489_211317_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|211888_212290_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764425.1|212408_212972_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
WP_000526541.1|212968_213922_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
WP_001025064.1|214031_215213_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
WP_001108722.1|215504_217919_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
WP_000836472.1|217940_218252_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
>prophage 13
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	225262	227854	2798472	transposase	Staphylococcus_phage(50.0%)	2	NA	NA
WP_000284992.1|225262_226531_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
WP_000121211.1|226906_227854_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
>prophage 14
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	238711	244039	2798472		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|238711_239569_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048371.1|239597_240194_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_160175965.1|240214_244039_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 15
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	252611	254318	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862084.1|252611_254318_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.8	2.1e-274
>prophage 16
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	260921	263552	2798472	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|260921_262184_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279341.1|262277_263552_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 17
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	267320	271456	2798472		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|267320_268925_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291426.1|268911_270072_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553919.1|270186_270633_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174275.1|270712_271456_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-18
>prophage 18
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	289038	292236	2798472		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226930.1|289038_292236_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	5.5e-135
>prophage 19
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	297168	298926	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232655.1|297168_298926_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	3.3e-41
>prophage 20
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	303810	311975	2798472		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080025.1|303810_304512_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_073392727.1|304514_306176_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.0	1.7e-34
WP_000849445.1|306676_308164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038301.1|308456_311087_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	32.7	1.8e-46
WP_001114454.1|311102_311975_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 21
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	315889	327043	2798472	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|315889_316810_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_016186894.1|316902_316998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|317222_319160_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049150.1|319586_321080_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791219.1|321308_321836_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	5.3e-11
WP_001125540.1|321864_322065_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|322111_322468_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032653.1|322609_323218_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	36.4	1.7e-21
WP_001280016.1|323236_324166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|324170_324281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127572.1|324328_325630_+	trigger factor	NA	NA	NA	NA	NA
WP_000472293.1|325780_327043_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	61.7	1.1e-139
>prophage 22
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	336609	339240	2798472	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425358.1|336609_339240_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.4	3.7e-153
>prophage 23
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	349298	384842	2798472	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|349298_350303_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_160175974.1|350304_351330_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|351352_352492_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|352510_352771_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749802.1|353046_355326_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000595001.1|355528_357802_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
WP_000364542.1|357823_358342_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_047935967.1|358769_360959_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869979.1|360970_361423_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|361419_362295_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|362755_364018_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_160175975.1|364033_365800_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001791215.1|366132_366261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682640.1|366260_367034_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102741.1|367194_368469_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.9	6.3e-106
WP_000704122.1|368553_368976_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|369075_369258_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000008061.1|369297_369444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160175976.1|369680_370694_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|371003_372146_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|372146_373265_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567025.1|373891_374560_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283316.1|374561_377039_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_160175977.1|377381_380012_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|380074_380335_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|380338_380767_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|380781_381090_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342261.1|381374_382013_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137775.1|382015_382939_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|382950_384219_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|384218_384842_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 24
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	391516	392737	2798472		Lactococcus_phage(100.0%)	1	NA	NA
WP_000542304.1|391516_392737_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.1	1.1e-51
>prophage 25
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	401305	407469	2798472		Bacillus_phage(33.33%)	5	NA	NA
WP_000439692.1|401305_401767_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953291.1|401825_403973_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	9.1e-33
WP_001282570.1|404029_405004_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|405048_405300_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|405645_407469_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 26
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	410904	414012	2798472		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|410904_412737_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_033844587.1|412872_414012_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.5	6.8e-27
>prophage 27
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	420480	421428	2798472		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117769.1|420480_421428_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	4.9e-47
>prophage 28
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	424482	438222	2798472	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|424482_425874_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001794939.1|426208_426832_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|426842_427661_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_160175979.1|427721_429521_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	35.8	6.0e-54
WP_001283055.1|429744_430851_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624581.1|430981_431659_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683921.1|431661_432762_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
WP_033844583.1|432875_434234_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	32.2	4.4e-49
WP_000924211.1|434243_435134_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
WP_001213908.1|435259_436045_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_106459683.1|436086_436950_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|436936_437347_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|437622_438222_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 29
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	444395	445019	2798472		Streptococcus_phage(100.0%)	1	NA	NA
WP_160175980.1|444395_445019_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	36.5	6.1e-30
>prophage 30
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	450563	453375	2798472		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019697.1|450563_451910_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	2.1e-64
WP_000202178.1|451902_453375_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.1	1.4e-80
>prophage 31
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	460895	467465	2798472		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|460895_462233_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159866.1|462225_462456_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183386.1|462433_463315_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	5.8e-10
WP_001124985.1|463745_464198_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_160175983.1|464213_465893_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291540.1|466043_467465_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	6.6e-40
>prophage 32
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	474293	475700	2798472		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|474293_475700_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 33
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	483048	484533	2798472		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|483048_484533_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 34
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	490198	580956	2798472	protease,tRNA,transposase,integrase,holin,capsid,terminase,head,tail,plate,portal	Staphylococcus_phage(73.68%)	105	499492:499517	546112:546137
WP_000447733.1|490198_491086_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183424.1|491163_491670_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273366.1|491761_492493_+	segregation and condensation protein A	NA	NA	NA	NA	NA
WP_160175984.1|492485_493028_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|493020_493758_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|493890_494616_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987777.1|494596_496348_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.6	1.7e-21
WP_001574168.1|496599_497532_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_160175985.1|497518_499561_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	46.0	7.8e-42
499492:499517	attL	ACCATCTCATTATGATGATATGTTTA	NA	NA	NA	NA
WP_000264748.1|499603_500809_-|integrase	site-specific integrase	integrase	Q8SDS6	Staphylococcus_virus	100.0	5.9e-223
WP_000191457.1|500934_501549_+	hypothetical protein	NA	A7TW88	Staphylococcus_phage	99.5	1.8e-106
WP_001013104.1|501545_501692_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
WP_000449655.1|501781_502177_-	hypothetical protein	NA	A0A2I6PEJ7	Staphylococcus_phage	100.0	3.8e-70
WP_160175986.1|502205_502640_-	hypothetical protein	NA	A0A2I6PED5	Staphylococcus_phage	98.6	2.0e-24
WP_054188988.1|502656_503115_-	toxin	NA	B2ZYU2	Staphylococcus_phage	98.0	2.3e-82
WP_000455972.1|503136_503463_-	helix-turn-helix transcriptional regulator	NA	A0A059T5A2	Staphylococcus_phage	100.0	7.0e-54
WP_001114715.1|503625_503835_+	helix-turn-helix transcriptional regulator	NA	A0A059T617	Staphylococcus_phage	100.0	4.8e-32
WP_160175987.1|503873_504650_+	transcriptional regulator	NA	A0A2I6PD87	Staphylococcus_phage	89.1	2.0e-123
WP_001025401.1|504678_504924_+	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_160175988.1|504892_505258_-	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	99.2	1.6e-62
WP_001036302.1|505312_505528_+	hypothetical protein	NA	A0A2I6PDN5	Staphylococcus_phage	100.0	1.3e-32
WP_001124190.1|505552_505816_+	helix-turn-helix domain-containing protein	NA	A0A2I6PDM6	Staphylococcus_phage	100.0	1.1e-44
WP_001285963.1|505828_505990_+	DUF1270 family protein	NA	A0A2I6PEZ9	Staphylococcus_phage	100.0	5.0e-21
WP_000175000.1|506068_506392_+	hypothetical protein	NA	A0A2I6PDL5	Staphylococcus_phage	100.0	1.3e-52
WP_072426435.1|506406_506769_+	hypothetical protein	NA	A0A2I6PF03	Staphylococcus_phage	97.5	7.8e-54
WP_160175989.1|506765_507932_+	DUF2800 domain-containing protein	NA	A0A2I6PDL4	Staphylococcus_phage	99.5	2.0e-220
WP_072426433.1|507957_508515_+	DUF2815 family protein	NA	A0A2I6PF05	Staphylococcus_phage	99.5	3.0e-97
WP_160176125.1|508583_510536_+	DNA polymerase	NA	A0A2I6PF18	Staphylococcus_phage	99.8	0.0e+00
WP_001164629.1|510548_510734_+	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_000113976.1|510733_511135_+	PVL family protein	NA	A0A2I6PF14	Staphylococcus_phage	99.2	2.1e-68
WP_000111491.1|511134_511392_+	DUF3310 domain-containing protein	NA	A0A1X9H067	Staphylococcus_phage	98.8	6.3e-42
WP_072426431.1|511675_511924_+	DUF1024 family protein	NA	A0A0E3XC66	Staphylococcus_phage	97.6	2.0e-37
WP_160175990.1|511916_512444_+	dUTP pyrophosphatase	NA	A7TWB1	Staphylococcus_phage	99.4	3.0e-94
WP_000195831.1|512480_512717_+	DUF1381 domain-containing protein	NA	C8CH06	Staphylococcus_phage	100.0	1.1e-35
WP_160175991.1|512967_513123_+	transcriptional regulator	NA	B5WZN3	Staphylococcus_phage	98.0	2.7e-19
WP_000265258.1|513190_513391_+	DUF1514 domain-containing protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
WP_000884844.1|513442_515890_+	hypothetical protein	NA	R4WAL1	Staphylococcus_phage	100.0	0.0e+00
WP_001801650.1|515998_516097_-	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	3.7e-11
WP_000665203.1|516230_516521_+	VRR-NUC domain-containing protein	NA	A0A2I6PEN7	Staphylococcus_phage	100.0	6.5e-51
WP_072426430.1|516501_517869_+	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	99.8	2.5e-262
WP_000528512.1|517881_518319_+	transcriptional regulator	NA	A0A2I6PEN3	Staphylococcus_phage	100.0	7.9e-77
WP_031910567.1|518475_518790_+	HNH endonuclease	NA	Q8SDQ2	Staphylococcus_virus	98.1	7.2e-56
WP_031912268.1|518917_519223_+|terminase	terminase	terminase	A0A2I6PEQ6	Staphylococcus_phage	99.0	6.4e-49
WP_000153544.1|519212_520904_+|terminase	terminase large subunit	terminase	Q4ZD20	Staphylococcus_virus	100.0	0.0e+00
WP_160175992.1|520908_522147_+|portal	phage portal protein	portal	A0A2I6PF26	Staphylococcus_phage	99.8	1.3e-233
WP_000061866.1|522130_522904_+|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	100.0	2.4e-137
WP_160175993.1|522915_524079_+|capsid	phage major capsid protein	capsid	A0A2I6PEQ3	Staphylococcus_phage	99.5	3.0e-216
WP_000050973.1|524147_524426_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_000121211.1|524595_525543_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_160176126.1|525538_525844_+	hypothetical protein	NA	A0A2I6PES3	Staphylococcus_phage	100.0	1.1e-48
WP_000110023.1|525840_526242_+	hypothetical protein	NA	A0A2I6PF54	Staphylococcus_phage	100.0	8.1e-68
WP_001023806.1|526242_526638_+	DUF3168 domain-containing protein	NA	A0A2I6PEQ4	Staphylococcus_phage	100.0	8.8e-67
WP_000807536.1|526672_527314_+|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_000169128.1|527405_527861_+	Ig domain-containing protein	NA	A0A2I6PF45	Staphylococcus_phage	100.0	1.3e-77
WP_000589166.1|527918_528260_+	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.5e-54
WP_160175994.1|528310_528469_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	96.2	6.0e-19
WP_160175995.1|528482_534683_+|tail	phage tail tape measure protein	tail	A0A2I6PF36	Staphylococcus_phage	99.5	0.0e+00
WP_072426428.1|534682_535507_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	99.6	1.2e-158
WP_000384462.1|535515_537099_+	peptidase	NA	Q8SDP1	Staphylococcus_virus	100.0	7.1e-309
WP_000179860.1|537098_537389_+	hypothetical protein	NA	A0A2I6PF46	Staphylococcus_phage	100.0	2.1e-49
WP_000429551.1|537404_539315_+	minor structural protein	NA	A0A2I6PF35	Staphylococcus_phage	100.0	0.0e+00
WP_072426427.1|539314_540781_+|plate	BppU family phage baseplate upper protein	plate	A0A2I6PES7	Staphylococcus_phage	99.8	1.7e-272
WP_001166599.1|540780_541170_+	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000916020.1|541162_541327_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_000466784.1|541372_541672_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000339146.1|541807_542110_+|holin	phage holin	holin	A0A2I6PET6	Staphylococcus_phage	100.0	7.0e-48
WP_000909220.1|542120_543575_+	CHAP domain-containing protein	NA	A0A2I6PET7	Staphylococcus_phage	100.0	5.7e-289
WP_000239545.1|543964_544903_+	Panton-Valentine bi-component leukocidin subunit S	NA	A0A2I6PER8	Staphylococcus_phage	100.0	3.7e-180
WP_024937002.1|544898_545882_+	Panton-Valentine bi-component leukocidin subunit F	NA	A0A2I6PEU3	Staphylococcus_phage	100.0	4.0e-185
WP_061390271.1|546064_546316_+	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	2.4e-25
546112:546137	attR	ACCATCTCATTATGATGATATGTTTA	NA	NA	NA	NA
WP_000913237.1|546405_547314_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001799520.1|547518_547683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186908.1|547961_548507_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001151997.1|548612_548861_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163814.1|548968_549922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902107.1|549911_551291_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	33.3	2.9e-56
WP_000069298.1|551443_552904_+	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_016186859.1|553041_553128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001174260.1|553288_554275_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_000681744.1|554389_555358_-	asparaginase	NA	NA	NA	NA	NA
WP_000644393.1|555434_556094_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001791200.1|556124_556241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791199.1|556357_556549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160175996.1|556805_557981_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000165530.1|558202_559513_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000161753.1|559529_560528_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001043863.1|560698_560971_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|561401_561974_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774688.1|561976_562702_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001819897.1|562718_563663_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|563754_564204_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_001269937.1|564672_565839_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.3	1.5e-34
WP_000776318.1|565864_566929_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_000245891.1|566938_568237_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000389521.1|568243_569488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160175997.1|569501_570077_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	28.2	4.6e-08
WP_000154479.1|570066_570654_+	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_001827022.1|570725_571406_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000839927.1|571741_572059_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000690024.1|572302_573445_+	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000361536.1|573449_574652_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	42.5	1.4e-35
WP_000049917.1|574638_575610_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525060.1|575633_578327_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858795.1|578648_579941_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	4.3e-54
WP_000362222.1|580269_580956_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 35
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	584647	585274	2798472		Bacillus_phage(100.0%)	1	NA	NA
WP_001108885.1|584647_585274_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 36
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	594737	595616	2798472		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|594737_595616_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 37
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	601645	644896	2798472	transposase	Staphylococcus_phage(57.14%)	16	NA	NA
WP_160175998.1|601645_633739_+	hyperosmolarity resistance protein Ebh	NA	A0A2H4PQU6	Staphylococcus_phage	21.7	1.5e-06
WP_001062938.1|633797_634199_-	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_000282169.1|634439_635144_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.3	1.9e-11
WP_001814377.1|635388_635583_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_001165814.1|635594_635846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404628.1|635883_637008_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995290.1|637023_637461_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934885.1|637884_638841_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|639040_639520_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166055.1|639534_640374_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	76.5	5.1e-48
WP_000159899.1|640459_640993_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|640985_641414_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473654.1|641425_641926_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_031905379.1|641925_642147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|642219_643167_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000342154.1|643405_644896_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	1.7e-22
>prophage 38
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	648305	650317	2798472		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|648305_648965_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166793.1|648961_650317_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 39
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	656685	657477	2798472		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|656685_657477_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 40
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	661012	666038	2798472	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|661012_662149_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001794103.1|662180_662810_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|662828_663098_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|663259_663568_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|663738_663939_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876206.1|664135_664537_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216956.1|664772_666038_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.0	4.0e-12
>prophage 41
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	673880	675482	2798472		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|673880_675482_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 42
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	679907	683361	2798472		Indivirus(50.0%)	3	NA	NA
WP_000079448.1|679907_680759_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	6.8e-16
WP_160176001.1|680765_681407_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077549.1|681546_683361_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	2.3e-154
>prophage 43
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	686775	687477	2798472		Tupanvirus(100.0%)	1	NA	NA
WP_000571253.1|686775_687477_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.0e-13
>prophage 44
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	694959	697314	2798472		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000153717.1|694959_695742_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	36.7	1.2e-27
WP_000173846.1|695743_696742_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.1	2.5e-33
WP_000604802.1|696747_697314_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	31.8	1.7e-23
>prophage 45
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	701632	705198	2798472	transposase	Bacillus_phage(50.0%)	3	NA	NA
WP_000283026.1|701632_702895_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.6	2.6e-96
WP_001123276.1|703042_703228_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_111223317.1|703551_705198_+|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	1.3e-294
>prophage 46
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	714467	718861	2798472		Bacillus_phage(50.0%)	2	NA	NA
WP_001289586.1|714467_716870_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
WP_001574370.1|716869_718861_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 47
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	724478	726125	2798472		Vibrio_phage(100.0%)	1	NA	NA
WP_001088984.1|724478_726125_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.5	3.3e-22
>prophage 48
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	729794	730916	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160176003.1|729794_730916_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.1	3.7e-09
>prophage 49
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	735065	740721	2798472		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|735065_735689_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380738.1|736068_736932_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.2e-15
WP_001791425.1|737005_737110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160176005.1|737106_738084_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.4	3.0e-185
WP_001085657.1|738240_738510_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|738963_739113_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000089857.1|739203_740721_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.8	2.7e-92
>prophage 50
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	750857	755133	2798472		Bacillus_phage(50.0%)	6	NA	NA
WP_000841344.1|750857_751391_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|751529_751718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000624456.1|751830_752433_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670311.1|752429_753521_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603961.1|753524_754256_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001794121.1|754224_755133_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	9.8e-21
>prophage 51
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	759087	759423	2798472	head	Staphylococcus_phage(100.0%)	1	NA	NA
WP_077670291.1|759087_759423_-|head	phage head morphogenesis protein	head	A0A1J0MFV1	Staphylococcus_phage	60.4	2.6e-27
>prophage 52
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	763360	770864	2798472	transposase,capsid	Staphylococcus_phage(71.43%)	10	NA	NA
WP_077670290.1|763360_764026_-|capsid	phage capsid protein	capsid	A0A1J0MF61	Staphylococcus_phage	53.0	4.6e-60
WP_000585095.1|764086_764338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033845159.1|764842_765427_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	45.1	1.0e-31
WP_000477487.1|765857_766274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121213.1|766700_767648_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	1.6e-183
WP_000006110.1|767859_768045_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_031788482.1|768437_768548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002343.1|769249_769456_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	56.7	1.9e-12
WP_001071312.1|769752_769965_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	3.6e-19
WP_001659797.1|770666_770864_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.7e-10
>prophage 53
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	775935	776412	2798472		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|775935_776412_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 54
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	782355	788837	2798472		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103747.1|782355_783174_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	3.1e-26
WP_001077635.1|783648_784191_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516249.1|784196_786206_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	4.1e-59
WP_000073334.1|786218_788837_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	3.8e-41
>prophage 55
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	798250	799294	2798472		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|798250_799294_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 56
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	803493	809037	2798472		Bacillus_virus(33.33%)	4	NA	NA
WP_160176007.1|803493_804780_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.5	1.1e-14
WP_000089941.1|804779_806045_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293307.1|806075_806789_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042907377.1|806793_809037_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 57
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	814177	825992	2798472	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864185.1|814177_815149_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282296.1|815163_816081_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|816250_816601_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043642.1|816987_819105_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020856.1|819109_819427_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|819423_819708_-	YlxR family protein	NA	NA	NA	NA	NA
WP_160176008.1|819728_820904_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036631.1|820924_821392_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_016186828.1|821681_825992_-	DNA polymerase III subunit alpha	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 58
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	830265	831036	2798472		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|830265_831036_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 59
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	835810	849481	2798472	tRNA,protease	Erwinia_phage(16.67%)	11	NA	NA
WP_160176009.1|835810_837214_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	8.3e-27
WP_000072681.1|837279_837825_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015609.1|837821_838718_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	6.1e-31
WP_000195249.1|839135_840443_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_075339464.1|840598_842674_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	7.8e-106
WP_000620184.1|842847_843720_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000672864.1|843891_845136_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041658.1|845163_846282_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_160176010.1|846508_847417_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	2.3e-17
WP_001020801.1|847438_848605_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_160176011.1|848713_849481_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 60
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	862865	864986	2798472		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|862865_863597_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|863712_863946_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|864251_864986_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 61
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	875356	877351	2798472		Moumouvirus(100.0%)	1	NA	NA
WP_000579564.1|875356_877351_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 62
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	880498	881434	2798472	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|880498_881434_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 63
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	886443	888701	2798472		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|886443_887643_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|887859_888078_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368225.1|888077_888701_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	6.1e-22
>prophage 64
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	892015	892627	2798472		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|892015_892627_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 65
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	896594	901205	2798472		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|896594_897695_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_049311929.1|897696_898971_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|898988_899870_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|899897_901205_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 66
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	905080	908892	2798472	transposase,tRNA	Staphylococcus_prophage(50.0%)	2	NA	NA
WP_000121211.1|905080_906028_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000384706.1|906138_908892_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	2.1e-90
>prophage 67
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	928269	928467	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245800.1|928269_928467_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	1.2e-19
>prophage 68
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	937378	943365	2798472	transposase	Staphylococcus_virus(50.0%)	7	NA	NA
WP_000277709.1|937378_939025_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	7.9e-295
WP_001801391.1|939326_939554_-	hypothetical protein	NA	Q4ZBW5	Staphylococcus_virus	67.7	1.9e-18
WP_000765703.1|939510_939657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857479.1|940324_941284_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.6	1.9e-35
WP_000231331.1|941737_941971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032820.1|942580_942766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000669541.1|943014_943365_-	complement inhibitor SCIN-C	NA	A7TWS0	Staphylococcus_phage	50.0	1.9e-20
>prophage 69
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	954800	959358	2798472		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|954800_955115_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249267.1|955287_957636_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_000161937.1|957645_959358_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 70
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	964236	965295	2798472	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|964236_965295_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 71
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	977262	980173	2798472		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|977262_977745_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263796.1|977746_978289_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|978358_978748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|978750_979005_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757584.1|979243_980173_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	6.5e-12
>prophage 72
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1001814	1005457	2798472		Mycoplasma_phage(50.0%)	4	NA	NA
WP_000433551.1|1001814_1002909_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020627.1|1002921_1003461_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000455584.1|1003604_1003880_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|1004050_1005457_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
>prophage 73
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1010098	1010650	2798472		Synechococcus_phage(100.0%)	1	NA	NA
WP_000957036.1|1010098_1010650_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 74
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1016764	1021144	2798472		Bacillus_virus(50.0%)	5	NA	NA
WP_001289622.1|1016764_1016998_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	1.3e-09
WP_000040043.1|1017234_1018953_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1018955_1019222_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505964.1|1019375_1019918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685076.1|1019971_1021144_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	3.1e-75
>prophage 75
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1024323	1039086	2798472		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921970.1|1024323_1025724_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273254.1|1025716_1026523_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101912.1|1026790_1028038_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709288.1|1028059_1029538_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.5	9.2e-77
WP_000238673.1|1029552_1030119_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
WP_000030814.1|1030121_1031150_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
WP_000483708.1|1031142_1032627_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	8.5e-46
WP_000032734.1|1032605_1034795_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
WP_160176018.1|1034787_1035459_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_000848351.1|1035460_1035724_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174050.1|1035723_1036428_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
WP_160176019.1|1036431_1037556_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861570.1|1037542_1038025_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225845.1|1038225_1039086_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	1.2e-39
>prophage 76
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1049149	1052923	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074519.1|1049149_1052923_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	38.0	1.1e-54
>prophage 77
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1056590	1086873	2798472	protease,bacteriocin,holin	Staphylococcus_phage(16.67%)	33	NA	NA
WP_000676569.1|1056590_1057601_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	31.7	1.1e-15
WP_001088793.1|1057682_1058864_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284455.1|1058901_1059231_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|1059466_1060288_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150205.1|1060280_1061084_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526678.1|1061070_1062744_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001814117.1|1062730_1063942_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_072357920.1|1064045_1064123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160176021.1|1064273_1065212_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620943.1|1065263_1065815_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001794164.1|1065904_1066195_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	2.6e-07
WP_001794249.1|1066258_1066390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081338.1|1066436_1067396_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766009.1|1067885_1068242_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000719183.1|1068330_1069812_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000410718.1|1069817_1070105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791476.1|1070445_1070736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571183.1|1070823_1071465_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	2.9e-19
WP_000873929.1|1071461_1071782_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870819.1|1071784_1073749_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001794574.1|1073792_1074065_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001790623.1|1074074_1074176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099119695.1|1074714_1074792_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_160176022.1|1075092_1075695_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000214898.1|1075709_1075886_-	YkvS family protein	NA	NA	NA	NA	NA
WP_000668820.1|1076084_1077071_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000876825.1|1077151_1077370_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_031775450.1|1077579_1078149_+	competence protein ComK	NA	NA	NA	NA	NA
WP_000414169.1|1078637_1080149_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000021872.1|1080287_1081646_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_001794169.1|1081662_1083987_-|protease	serine protease	protease	W5SAB9	Pithovirus	26.8	4.0e-10
WP_000928413.1|1084205_1085009_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049957.1|1085310_1086873_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	2.2e-36
>prophage 78
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1108093	1109902	2798472		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082722.1|1108093_1109902_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
>prophage 79
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1113852	1127617	2798472	transposase	Bacillus_virus(28.57%)	11	NA	NA
WP_111223317.1|1113852_1115499_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	1.3e-294
WP_094409958.1|1115794_1117361_+|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
WP_001180271.1|1117450_1118332_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001574526.1|1118343_1118994_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033844434.1|1118986_1119967_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
WP_160176023.1|1119969_1120956_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
WP_160176024.1|1122512_1123460_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	99.7	3.3e-184
WP_000517177.1|1123451_1123718_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000197096.1|1123929_1125585_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000786746.1|1125603_1126545_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	9.3e-06
WP_000140043.1|1126534_1127617_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	2.4e-18
>prophage 80
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1138390	1143017	2798472		Agrobacterium_phage(50.0%)	2	NA	NA
WP_000353950.1|1138390_1141000_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044234.1|1141202_1143017_-	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	8.8e-37
>prophage 81
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1146282	1153742	2798472	transposase	Staphylococcus_virus(50.0%)	4	NA	NA
WP_111223317.1|1146282_1147929_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	1.3e-294
WP_000902813.1|1148305_1148695_-	YisL family protein	NA	NA	NA	NA	NA
WP_160176025.1|1149020_1149923_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000154949.1|1150088_1153742_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 82
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1163897	1170947	2798472		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185311.1|1163897_1164827_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.5	1.8e-38
WP_000138487.1|1165221_1166466_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167322.1|1166574_1167765_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.0	1.3e-33
WP_000838046.1|1168072_1169200_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1169561_1169939_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1170353_1170947_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 83
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1180881	1184509	2798472		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009683.1|1180881_1182357_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	1.2e-47
WP_000046076.1|1182487_1183696_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1184149_1184509_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 84
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1188553	1191222	2798472		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1188553_1189768_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129645.1|1189764_1191222_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
>prophage 85
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1204433	1207956	2798472		environmental_halophage(50.0%)	3	NA	NA
WP_000807671.1|1204433_1205675_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.5	1.1e-110
WP_000205572.1|1205789_1207097_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1207194_1207956_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 86
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1211675	1212701	2798472		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571209.1|1211675_1212701_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
>prophage 87
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1215810	1220988	2798472		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1215810_1216167_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147955.1|1216310_1216631_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1216780_1217320_-	nitroreductase	NA	NA	NA	NA	NA
WP_160176027.1|1217402_1218119_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	29.3	8.9e-17
WP_000974455.1|1218266_1218689_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1219087_1219582_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255548.1|1219737_1220355_+	amino acid transporter	NA	NA	NA	NA	NA
WP_016187137.1|1220427_1220988_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	3.8e-31
>prophage 88
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1224393	1225640	2798472		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1224393_1224594_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_160176028.1|1224950_1225640_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 89
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1234737	1238152	2798472		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001574560.1|1234737_1235466_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	4.8e-18
WP_000999096.1|1235753_1236368_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_057485548.1|1237591_1238152_+	DUF4888 domain-containing protein	NA	Q4ZBG8	Staphylococcus_virus	68.6	1.4e-62
>prophage 90
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1241368	1258615	2798472	terminase,integrase,coat	Staphylococcus_phage(64.71%)	22	1236884:1236898	1252005:1252019
1236884:1236898	attL	ATGGAGACGGCGGGA	NA	NA	NA	NA
WP_061644650.1|1241368_1241938_-|terminase	terminase small subunit	terminase	Q4ZE85	Staphylococcus_phage	96.8	5.1e-100
WP_057485552.1|1241976_1242147_-	hypothetical protein	NA	Q4ZE86	Staphylococcus_phage	100.0	5.1e-24
WP_057485545.1|1242278_1242806_-|coat	spore coat protein	coat	A0A1W6JQH7	Staphylococcus_phage	96.6	5.1e-86
WP_000853281.1|1242856_1243075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000846291.1|1243092_1243671_-	hypothetical protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.9	6.2e-29
WP_001190610.1|1243683_1244025_-	hypothetical protein	NA	Q4ZE66	Staphylococcus_phage	99.1	8.4e-58
WP_057485544.1|1244586_1245228_-	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	93.0	4.2e-111
WP_000998182.1|1245224_1245509_-	hypothetical protein	NA	A0A1W6JQE4	Staphylococcus_phage	92.6	1.0e-45
WP_001039168.1|1245510_1245873_-	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	99.2	8.9e-66
WP_001806665.1|1246158_1247628_-	virulence-associated protein E	NA	A0A1W6JQD6	Staphylococcus_phage	99.4	7.6e-289
WP_001002687.1|1247644_1248514_-	hypothetical protein	NA	A0A1W6JQL5	Staphylococcus_phage	96.5	9.3e-162
WP_001103953.1|1248601_1248895_-	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	61.8	8.9e-24
WP_000850930.1|1248895_1249306_-	hypothetical protein	NA	A0A2H4JBF1	uncultured_Caudovirales_phage	85.8	2.4e-59
WP_000163542.1|1249457_1249676_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000272128.1|1249863_1250793_+	helix-turn-helix transcriptional regulator	NA	Q9AZH9	Lactococcus_phage	35.6	2.2e-12
WP_160176127.1|1250782_1251892_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	44.9	6.9e-77
WP_001085185.1|1252454_1252919_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
1252005:1252019	attR	ATGGAGACGGCGGGA	NA	NA	NA	NA
WP_001050041.1|1252940_1255313_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	1.9e-92
WP_001165967.1|1255346_1256087_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1256215_1256449_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785248.1|1256515_1256974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1257310_1258615_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 91
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1269303	1275233	2798472		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1269303_1269891_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1270459_1271404_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1271512_1272508_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369719.1|1272504_1273416_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1274297_1275233_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 92
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1279630	1282477	2798472		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662687.1|1279630_1282477_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 93
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1285795	1286635	2798472		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000749385.1|1285795_1286635_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 94
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1293074	1298779	2798472		Streptococcus_phage(66.67%)	5	NA	NA
WP_000370984.1|1293074_1294157_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.8	1.2e-44
WP_000686342.1|1294520_1295387_-	DegV family protein	NA	NA	NA	NA	NA
WP_160176031.1|1295530_1296172_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	4.0e-37
WP_000258151.1|1296335_1297391_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1297708_1298779_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 95
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1308056	1331027	2798472		uncultured_Caudovirales_phage(35.71%)	18	NA	NA
WP_000616865.1|1308056_1308818_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
WP_001245566.1|1308814_1309771_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
WP_000876311.1|1309757_1310729_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
WP_000562498.1|1311105_1312077_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1312196_1314302_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1314264_1314663_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068491.1|1315464_1316331_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930016.1|1316350_1316851_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
WP_000193750.1|1317190_1318696_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031788440.1|1318773_1318875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429002.1|1318965_1319883_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	8.2e-07
WP_000197262.1|1320434_1320977_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663016.1|1321135_1322194_-	histidinol-phosphate transaminase	NA	A0A0H3TLT9	Faustovirus	26.5	5.7e-20
WP_000180987.1|1322433_1323948_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589241.1|1323940_1324918_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.1e-25
WP_000983677.1|1325138_1326920_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525101.1|1326931_1328815_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	8.8e-56
WP_000098285.1|1329086_1331027_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 96
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1334166	1344013	2798472		Pandoravirus(12.5%)	12	NA	NA
WP_001217804.1|1334166_1335318_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
WP_000604508.1|1335301_1335895_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
WP_050974894.1|1336245_1336914_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	7.4e-66
WP_000941336.1|1336915_1337335_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062968.1|1337338_1338052_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000637686.1|1338150_1338735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093552.1|1339014_1339455_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1339797_1340271_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1340245_1340932_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244416.1|1340931_1341987_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702776.1|1342058_1343042_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.0	7.3e-62
WP_000931237.1|1343173_1344013_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 97
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1355618	1356992	2798472		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000952030.1|1355618_1356992_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	34.1	1.2e-46
>prophage 98
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1361969	1368249	2798472		Bacillus_phage(33.33%)	6	NA	NA
WP_000857616.1|1361969_1363643_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	24.2	2.0e-11
WP_000737163.1|1363639_1365271_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	28.2	2.3e-12
WP_000469883.1|1365489_1366365_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358501.1|1366536_1367220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148821.1|1367222_1367681_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1367682_1368249_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
>prophage 99
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1371272	1372919	2798472	transposase	Staphylococcus_virus(100.0%)	1	NA	NA
WP_111223317.1|1371272_1372919_-|transposase	IS1182-like element ISSau3 family transposase	transposase	A0ZS58	Staphylococcus_virus	99.8	1.3e-294
>prophage 100
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1377110	1377584	2798472		Pandoravirus(100.0%)	1	NA	NA
WP_000833480.1|1377110_1377584_-	cupin	NA	A0A291AU44	Pandoravirus	38.7	4.6e-14
>prophage 101
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1382831	1383629	2798472		Lactobacillus_virus(100.0%)	1	NA	NA
WP_000731642.1|1382831_1383629_+	LysM peptidoglycan-binding domain-containing protein	NA	C1KFN7	Lactobacillus_virus	35.8	2.1e-06
>prophage 102
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1388350	1389112	2798472		Planktothrix_phage(100.0%)	1	NA	NA
WP_000153733.1|1388350_1389112_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	3.2e-33
>prophage 103
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1393477	1394521	2798472		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_001030763.1|1393477_1394521_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	27.1	3.8e-16
>prophage 104
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1401043	1401841	2798472		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1401043_1401841_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 105
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1405068	1409027	2798472		Bacillus_phage(33.33%)	3	NA	NA
WP_033845124.1|1405068_1406796_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	6.3e-109
WP_000793055.1|1407216_1408512_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1408628_1409027_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 106
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1415960	1416704	2798472		Indivirus(100.0%)	1	NA	NA
WP_000894458.1|1415960_1416704_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-12
>prophage 107
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1429580	1430141	2798472	integrase	Streptococcus_phage(100.0%)	1	1423734:1423748	1433723:1433737
1423734:1423748	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044966.1|1429580_1430141_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
WP_001044966.1|1429580_1430141_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4J2	Streptococcus_phage	31.3	1.3e-18
1433723:1433737	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 108
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1443089	1446443	2798472		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1443089_1444100_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1444598_1445120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180233.1|1445147_1446443_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 109
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1453974	1455297	2798472		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860607.1|1453974_1455297_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	8.2e-109
>prophage 110
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1466601	1467258	2798472		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455258.1|1466601_1467258_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	6.4e-46
>prophage 111
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1470926	1474248	2798472		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000382588.1|1470926_1472303_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	23.9	6.7e-21
WP_000347063.1|1472847_1474248_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	33.0	9.4e-55
>prophage 112
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1497620	1498283	2798472		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1497620_1498283_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 113
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1504872	1506060	2798472		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250820.1|1504872_1506060_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	1.5e-45
>prophage 114
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1509087	1520041	2798472		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1509087_1511169_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1511291_1511762_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1511827_1512241_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1512338_1512593_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_160176129.1|1512729_1516326_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.5	2.5e-67
WP_000918664.1|1516489_1520041_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.2	6.1e-50
>prophage 115
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1523724	1528507	2798472	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1523724_1524273_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1524285_1524468_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001791441.1|1524523_1524667_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872867.1|1524781_1525351_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664740.1|1525431_1525956_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1525955_1526702_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370181.1|1526709_1527114_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631982.1|1527106_1528507_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 116
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1534518	1536975	2798472	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1534518_1536975_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 117
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1556058	1566516	2798472	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1556058_1557546_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_016186812.1|1557598_1557691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613720.1|1558084_1558561_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154303.1|1558557_1558923_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167936.1|1558900_1559704_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	6.7e-21
WP_000057594.1|1559919_1560852_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148605.1|1561030_1561912_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1562325_1564419_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1564676_1565216_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_160176043.1|1565220_1566516_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.3	8.2e-13
>prophage 118
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1575772	1578237	2798472		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1575772_1576738_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252534.1|1576884_1578237_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 119
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1584121	1587219	2798472	tRNA	Hokovirus(50.0%)	2	NA	NA
WP_001051120.1|1584121_1586095_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	32.6	3.2e-93
WP_000279925.1|1586379_1587219_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 120
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1591125	1591743	2798472		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1591125_1591743_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 121
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1600587	1602285	2798472		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109044.1|1600587_1602285_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 122
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1618922	1625159	2798472		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170274.1|1618922_1619927_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.1	1.4e-23
WP_000825534.1|1620260_1621103_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467992.1|1621139_1621799_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569267.1|1621802_1622828_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	1.4e-31
WP_001036658.1|1623118_1624261_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_000634110.1|1624253_1625159_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.4	7.2e-48
>prophage 123
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1648700	1651482	2798472		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072632.1|1648700_1649933_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.9	2.7e-45
WP_000028598.1|1649925_1651482_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.5	1.7e-286
>prophage 124
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1662910	1663237	2798472	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001799349.1|1662910_1663237_+|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	85.4	4.3e-11
>prophage 125
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1666545	1669578	2798472		Hokovirus(50.0%)	2	NA	NA
WP_000424963.1|1666545_1668087_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1668111_1669578_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 126
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1678678	1680202	2798472		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930503.1|1678678_1680202_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.2	5.5e-40
>prophage 127
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1688925	1695256	2798472		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000934799.1|1688925_1689429_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1689449_1689746_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1689989_1690181_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1690266_1691364_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1691375_1691579_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373076.1|1691608_1692490_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001573568.1|1692643_1693489_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_086045444.1|1694152_1695256_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 128
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1705177	1706020	2798472		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209478.1|1705177_1706020_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.2	4.5e-12
>prophage 129
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1727430	1730165	2798472		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_057485496.1|1727430_1728453_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_001191936.1|1728430_1729375_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449073.1|1729364_1730165_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	44.4	1.5e-41
>prophage 130
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1748402	1749080	2798472		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911024.1|1748402_1749080_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	1.2e-31
>prophage 131
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1767104	1771553	2798472		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549309.1|1767104_1771553_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	23.7	1.7e-28
>prophage 132
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1782157	1783819	2798472		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000570080.1|1782157_1782817_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	5.8e-23
WP_000736790.1|1782868_1783819_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 133
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1792626	1794063	2798472		Pandoravirus(100.0%)	1	NA	NA
WP_000163995.1|1792626_1794063_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.0	1.3e-30
>prophage 134
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1800571	1805115	2798472		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925396.1|1800571_1802311_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	2.0e-62
WP_000608835.1|1802576_1803251_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975347.1|1803390_1805115_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 135
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1814984	1816028	2798472		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645611.1|1814984_1816028_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.6	6.0e-14
>prophage 136
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1823244	1824774	2798472		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1823244_1824774_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 137
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1834459	1835965	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008395.1|1834459_1835965_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 138
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1847088	1852447	2798472		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1847088_1849338_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837114.1|1849925_1850894_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_033845699.1|1850890_1852447_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 139
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1862758	1864817	2798472		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818914.1|1862758_1863856_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166911.1|1864238_1864817_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	43.0	1.6e-13
>prophage 140
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1872628	1874221	2798472		Planktothrix_phage(100.0%)	1	NA	NA
WP_000067363.1|1872628_1874221_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	5.4e-22
>prophage 141
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1890313	1891498	2798472		Klosneuvirus(100.0%)	1	NA	NA
WP_001084444.1|1890313_1891498_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.6	2.4e-35
>prophage 142
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1896356	1906640	2798472		Tupanvirus(50.0%)	3	NA	NA
WP_000605274.1|1896356_1903532_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.7	5.0e-67
WP_000826855.1|1903978_1905229_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706134.1|1905614_1906640_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 143
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1910176	1913174	2798472		Bacillus_virus(50.0%)	4	NA	NA
WP_000590840.1|1910176_1910917_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.5e-39
WP_000171926.1|1911258_1911771_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356967.1|1911949_1912153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013474.1|1912214_1913174_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	2.0e-11
>prophage 144
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1916515	1919000	2798472		Catovirus(50.0%)	2	NA	NA
WP_000723445.1|1916515_1917661_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.4	3.2e-24
WP_000779509.1|1917737_1919000_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	2.5e-22
>prophage 145
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1926017	1932582	2798472		Catovirus(50.0%)	6	NA	NA
WP_000413167.1|1926017_1927142_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	3.9e-128
WP_001028294.1|1927145_1928255_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1928267_1929296_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940769.1|1929285_1931109_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.4	3.0e-29
WP_000565300.1|1931128_1931893_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037317.1|1931895_1932582_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	8.2e-28
>prophage 146
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1936607	1937783	2798472		Clostridium_phage(100.0%)	1	NA	NA
WP_000469818.1|1936607_1937783_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.9	5.2e-30
>prophage 147
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1943241	1944015	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078278.1|1943241_1944015_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	6.4e-13
>prophage 148
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1951901	1952501	2798472		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1951901_1952501_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 149
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1957435	1962530	2798472		Catovirus(50.0%)	5	NA	NA
WP_001793810.1|1957435_1958416_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.3	1.3e-47
WP_000183771.1|1958750_1959527_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414632.1|1959737_1960364_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|1960559_1961324_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223717.1|1961327_1962530_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.3	5.1e-09
>prophage 150
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	1970796	1975006	2798472		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1970796_1971777_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_160176065.1|1972007_1973000_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000925002.1|1973015_1974011_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136645.1|1974007_1975006_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	2.6e-14
>prophage 151
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2007078	2012413	2798472	transposase	Acidithiobacillus_phage(33.33%)	5	NA	NA
WP_000649665.1|2007078_2008779_-	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	26.8	4.1e-20
WP_001794509.1|2009068_2009443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121211.1|2009628_2010576_+|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
WP_000370465.1|2010580_2011096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088356251.1|2011283_2012413_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.0	6.4e-78
>prophage 152
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2018293	2028289	2798472		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2018293_2019094_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104171.1|2019481_2020270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060146.1|2020270_2021605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871610.1|2021597_2023424_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	2.1e-30
WP_000101976.1|2023436_2024138_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2025326_2026610_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2026888_2028289_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 153
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2034972	2044008	2798472	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884337.1|2034972_2036259_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177483.1|2036636_2038151_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	4.4e-90
WP_000449218.1|2038476_2039289_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819098.1|2039376_2042037_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.8	4.6e-119
WP_000255583.1|2042073_2044008_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	4.4e-143
>prophage 154
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2054095	2057453	2798472		Faecalibacterium_phage(33.33%)	5	NA	NA
WP_000742840.1|2054095_2054935_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.4	1.4e-05
WP_000491382.1|2055487_2055841_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2055908_2056304_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054111.1|2056556_2057126_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	34.8	2.8e-05
WP_001059079.1|2057252_2057453_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
>prophage 155
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2063246	2064005	2798472		Planktothrix_phage(100.0%)	1	NA	NA
WP_000154162.1|2063246_2064005_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 156
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2080587	2082300	2798472		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138663.1|2080587_2082300_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	5.4e-20
>prophage 157
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2087928	2088942	2798472		Faustovirus(100.0%)	1	NA	NA
WP_000639198.1|2087928_2088942_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	22.2	8.2e-08
>prophage 158
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2101333	2102026	2798472		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185861.1|2101333_2102026_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 159
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2126525	2128385	2798472		Enterococcus_phage(100.0%)	1	NA	NA
WP_160176077.1|2126525_2128385_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 160
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2154153	2155904	2798472		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143418.1|2154153_2155041_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	7.4e-05
WP_000923764.1|2155148_2155904_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	1.8e-31
>prophage 161
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2159331	2159829	2798472		Canarypox_virus(100.0%)	1	NA	NA
WP_001065267.1|2159331_2159829_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	2.4e-21
>prophage 162
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2164879	2167263	2798472		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071721.1|2164879_2166730_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	63.9	1.3e-234
WP_000173336.1|2166726_2167263_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	47.5	1.1e-40
>prophage 163
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2172139	2182250	2798472	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2172139_2173849_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2174126_2174339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028789.1|2174618_2175062_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172340.1|2175255_2176854_+	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_001793854.1|2176913_2177114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2177540_2179037_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031407.1|2179229_2180120_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237625.1|2180242_2180659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030061.1|2180912_2182250_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	6.7e-18
>prophage 164
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2210405	2213604	2798472		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751265.1|2210405_2211107_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.8	2.1e-39
WP_000379825.1|2211792_2213604_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 165
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2222049	2226228	2798472		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161364.1|2222049_2223048_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	2.6e-35
WP_000076662.1|2223137_2223344_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024137.1|2223819_2226228_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	2.9e-128
>prophage 166
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2235469	2238459	2798472	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001063330.1|2235469_2237575_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	37.5	6.9e-118
WP_000262597.1|2237937_2238459_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.3	2.4e-27
>prophage 167
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2244883	2251266	2798472		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062662.1|2244883_2246623_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473682.1|2246922_2248989_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2249368_2249779_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2249820_2250177_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228158.1|2250297_2251266_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	3.1e-12
>prophage 168
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2260090	2261083	2798472		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161541.1|2260090_2261083_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	9.7e-38
>prophage 169
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2270499	2271195	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382892.1|2270499_2271195_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	2.0e-37
>prophage 170
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2293479	2300655	2798472		Bacillus_phage(66.67%)	6	NA	NA
WP_000721337.1|2293479_2294346_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.9	3.4e-79
WP_001573690.1|2294472_2294781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2294924_2295191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160176087.1|2295474_2297283_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.5	1.0e-93
WP_000755954.1|2297399_2297792_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_160176088.1|2297793_2300655_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	1.2e-27
>prophage 171
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2305099	2305795	2798472		Bacillus_phage(100.0%)	1	NA	NA
WP_000217452.1|2305099_2305795_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	5.1e-09
>prophage 172
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2311471	2312290	2798472		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824929.1|2311471_2312290_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	26.8	1.9e-10
>prophage 173
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2320355	2321913	2798472		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173876.1|2320355_2321171_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	6.1e-14
WP_000590515.1|2321163_2321913_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 174
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2329147	2333574	2798472		Bacillus_phage(50.0%)	4	NA	NA
WP_000923514.1|2329147_2329810_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.5	2.2e-17
WP_000072154.1|2329802_2330579_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026190.1|2330972_2332160_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700902.1|2332221_2333574_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	3.0e-13
>prophage 175
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2336967	2338194	2798472		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948990.1|2336967_2338194_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 176
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2356570	2362777	2798472		Bacillus_phage(66.67%)	5	NA	NA
WP_001176855.1|2356570_2357713_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	43.9	2.6e-55
WP_000779351.1|2357980_2358367_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2358500_2358608_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064829.1|2359255_2361019_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	1.6e-35
WP_000486505.1|2361043_2362777_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	1.5e-30
>prophage 177
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2366238	2371992	2798472		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971554.1|2366238_2367354_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.9	7.1e-21
WP_000286868.1|2367364_2368057_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_160176095.1|2368067_2368535_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_001056917.1|2368586_2369564_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	2.4e-142
WP_000916697.1|2369565_2370513_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	2.1e-138
WP_000594516.1|2371062_2371992_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.4	1.5e-120
>prophage 178
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2379884	2380616	2798472		Bacillus_virus(100.0%)	1	NA	NA
WP_000615467.1|2379884_2380616_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.3e-23
>prophage 179
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2397481	2399041	2798472		Escherichia_phage(100.0%)	1	NA	NA
WP_000692652.1|2397481_2399041_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 180
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2420442	2421477	2798472		Bacillus_virus(100.0%)	1	NA	NA
WP_000655979.1|2420442_2421477_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.2	1.7e-16
>prophage 181
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2431940	2438497	2798472		Staphylococcus_phage(25.0%)	8	NA	NA
WP_000388431.1|2431940_2432669_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.2	6.7e-28
WP_000372857.1|2432802_2433366_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000793166.1|2433542_2433998_-	DUF3021 domain-containing protein	NA	NA	NA	NA	NA
WP_000977031.1|2433994_2434438_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000477323.1|2434600_2435974_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.3	1.1e-12
WP_000249492.1|2435966_2436641_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	44.7	8.0e-52
WP_000761409.1|2436776_2437832_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229922.1|2437831_2438497_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	7.2e-37
>prophage 182
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2442234	2443443	2798472		Salmonella_phage(100.0%)	1	NA	NA
WP_057485631.1|2442234_2443443_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.5	3.9e-33
>prophage 183
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2456099	2456999	2798472		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524841.1|2456099_2456999_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	2.7e-15
>prophage 184
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2464356	2464776	2798472		Bacillus_phage(100.0%)	1	NA	NA
WP_000920241.1|2464356_2464776_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	7.7e-37
>prophage 185
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2470467	2471349	2798472		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730056.1|2470467_2471349_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	1.7e-62
>prophage 186
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2479228	2479864	2798472		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285452.1|2479228_2479864_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.6	7.1e-10
>prophage 187
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2492868	2497144	2798472		Staphylococcus_phage(50.0%)	4	NA	NA
WP_072460394.1|2492868_2493507_+	autolysin	NA	A0A1W6JQU5	Staphylococcus_phage	47.4	4.5e-36
WP_000684154.1|2494115_2495240_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.6e-12
WP_000417008.1|2495331_2496285_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	29.2	5.8e-32
WP_000737699.1|2496643_2497144_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 188
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2501064	2501874	2798472		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717395.1|2501064_2501874_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 189
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2520847	2521453	2798472		Pithovirus(100.0%)	1	NA	NA
WP_000913006.1|2520847_2521453_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 190
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2533535	2536703	2798472		Leptospira_phage(100.0%)	1	NA	NA
WP_000592291.1|2533535_2536703_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.0	7.3e-63
>prophage 191
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2560162	2561829	2798472		Planktothrix_phage(50.0%)	2	NA	NA
WP_000389651.1|2560162_2560972_+	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
WP_000586768.1|2560968_2561829_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	7.4e-10
>prophage 192
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2564870	2573433	2798472		Mycobacterium_phage(33.33%)	8	NA	NA
WP_000204276.1|2564870_2566307_+	MarR family transcriptional regulator	NA	A0A088F7M4	Mycobacterium_phage	31.0	4.6e-57
WP_000136272.1|2566555_2566735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791584.1|2567384_2567567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130145.1|2568036_2569701_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	4.7e-45
WP_000179061.1|2569737_2570442_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769709.1|2570832_2571258_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044369.1|2571552_2572368_+	hydrolase	NA	NA	NA	NA	NA
WP_001044451.1|2572578_2573433_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	34.8	1.3e-06
>prophage 193
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2576811	2579874	2798472		Staphylococcus_phage(50.0%)	5	NA	NA
WP_001015495.1|2576811_2577660_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.3e-43
WP_001573519.1|2577880_2578006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001293423.1|2577960_2578254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333457.1|2578267_2578876_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_001573518.1|2579133_2579874_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	30.3	7.3e-14
>prophage 194
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2586194	2587607	2798472		Pandoravirus(100.0%)	1	NA	NA
WP_000169223.1|2586194_2587607_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	5.0e-48
>prophage 195
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2591575	2593138	2798472		Vibrio_phage(100.0%)	1	NA	NA
WP_000792332.1|2591575_2593138_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	3.5e-18
>prophage 196
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2603342	2604311	2798472		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2603342_2604311_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 197
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2620110	2621019	2798472		Klosneuvirus(100.0%)	1	NA	NA
WP_000162591.1|2620110_2621019_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.7	1.2e-26
>prophage 198
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2638267	2641087	2798472		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334466.1|2638267_2640073_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.6	2.6e-97
WP_000908186.1|2640304_2641087_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	5.7e-09
>prophage 199
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2652273	2656106	2798472		Clostridium_phage(50.0%)	4	NA	NA
WP_033845136.1|2652273_2652717_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	52.9	2.8e-37
WP_000160304.1|2652837_2653548_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083335.1|2653862_2654525_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242307.1|2654804_2656106_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	4.7e-133
>prophage 200
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2664039	2665650	2798472		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_160176112.1|2664039_2665650_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	3.5e-146
>prophage 201
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2673453	2681206	2798472		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2673453_2674053_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460244.1|2674053_2675130_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_160176113.1|2675116_2675953_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_001801520.1|2675985_2677083_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697334.1|2677079_2677499_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654191.1|2677605_2678130_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2678156_2679395_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2679422_2680052_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723407.1|2680075_2681206_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.1	1.0e-27
>prophage 202
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2691922	2692318	2798472		Bacillus_phage(100.0%)	1	NA	NA
WP_000932696.1|2691922_2692318_+	single-stranded DNA-binding protein	NA	A0A1B1PAE7	Bacillus_phage	36.8	3.0e-14
>prophage 203
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2698427	2699075	2798472		Moumouvirus(100.0%)	1	NA	NA
WP_001187612.1|2698427_2699075_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	4.7e-09
>prophage 204
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2707267	2708788	2798472		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_160176115.1|2707267_2708788_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 205
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2714462	2716490	2798472		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546609.1|2714462_2716490_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	3.9e-25
>prophage 206
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2721640	2725025	2798472		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621176.1|2721640_2722003_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2722352_2723354_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2723472_2723799_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190825.1|2723800_2724280_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041107.1|2724254_2725025_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 207
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2739138	2743862	2798472		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094575.1|2739138_2740668_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_072399972.1|2740697_2741717_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2741838_2742093_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047828.1|2742092_2743862_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	4.1e-63
>prophage 208
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2747622	2761696	2798472	tRNA	Moraxella_phage(20.0%)	11	NA	NA
WP_000159047.1|2747622_2748648_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	3.1e-63
WP_001791590.1|2750665_2750794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602046.1|2750938_2752867_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.1	3.2e-53
WP_001283612.1|2753119_2753755_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_073392939.1|2754111_2755140_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581078.1|2755199_2755424_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052261.1|2755632_2756883_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	9.0e-41
WP_000790325.1|2757066_2758017_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_001791588.1|2758165_2759650_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.8	5.2e-19
WP_001253292.1|2759646_2760606_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|2760979_2761696_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 209
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2768834	2772156	2798472		uncultured_virus(50.0%)	5	NA	NA
WP_000917289.1|2768834_2769119_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240651.1|2769194_2770811_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
WP_000201397.1|2771352_2771532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573769.1|2771528_2771825_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
WP_001573771.1|2771814_2772156_+	hypothetical protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
>prophage 210
NZ_CP047839	Staphylococcus aureus strain UP_678 chromosome, complete genome	2798472	2776134	2798001	2798472	integrase	Staphylococcus_phage(78.95%)	38	2774161:2774176	2783831:2783846
2774161:2774176	attL	TTTCAAAAAGAAATTC	NA	NA	NA	NA
WP_000791398.1|2776134_2777190_+	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
WP_000595617.1|2777211_2778231_+	beta-channel forming cytolysin	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
WP_160176118.1|2779368_2780406_-|integrase	site-specific integrase	integrase	A0A1X9H022	Staphylococcus_phage	99.7	7.7e-179
WP_000391618.1|2780578_2781118_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	33.1	9.0e-14
WP_000705238.1|2781257_2781425_-	hypothetical protein	NA	Q4ZDJ4	Staphylococcus_virus	100.0	1.7e-24
WP_160176119.1|2782832_2783459_-	helix-turn-helix domain-containing protein	NA	A0A2H4J3T7	uncultured_Caudovirales_phage	87.5	4.7e-99
WP_000916582.1|2783656_2783872_+	hypothetical protein	NA	A0A2H4J3T8	uncultured_Caudovirales_phage	91.5	3.0e-29
2783831:2783846	attR	GAATTTCTTTTTGAAA	NA	NA	NA	NA
WP_001025405.1|2783887_2784103_+	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	98.6	1.1e-34
WP_000128907.1|2784091_2784421_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	100.0	2.7e-53
WP_160176120.1|2784471_2785212_+	oxidoreductase	NA	O80074	Staphylococcus_phage	99.2	7.0e-134
WP_031768726.1|2785328_2785532_-	hypothetical protein	NA	A0A2H4JBA9	uncultured_Caudovirales_phage	67.7	7.3e-17
WP_001294156.1|2785590_2785830_+	hypothetical protein	NA	A0ZS12	Staphylococcus_virus	100.0	2.9e-33
WP_160176121.1|2786156_2786483_+	hypothetical protein	NA	G4KNN2	Staphylococcus_phage	99.1	5.9e-53
WP_025176250.1|2786479_2786698_+	hypothetical protein	NA	A0A068A2A3	Staphylococcus_phage	98.6	4.3e-31
WP_001120936.1|2786727_2787048_+	DUF771 domain-containing protein	NA	A0A1W6JPI1	Staphylococcus_phage	100.0	7.4e-56
WP_001619936.1|2787044_2787206_+	DUF1270 family protein	NA	Q4ZDA3	Staphylococcus_virus	100.0	5.0e-21
WP_160176122.1|2787298_2787580_+	DUF2482 family protein	NA	A7YGP8	Staphylococcus_virus	95.7	2.8e-43
WP_106889224.1|2787604_2787865_+	DUF1108 family protein	NA	A0A1P8L6F5	Staphylococcus_phage	95.3	8.4e-42
WP_001205732.1|2787873_2788137_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_160176131.1|2788145_2790089_+	AAA family ATPase	NA	S4V9K6	Staphylococcus_phage	98.1	0.0e+00
WP_000138475.1|2790090_2791011_+	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
WP_071621397.1|2791091_2791709_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	9.1e-87
WP_160176123.1|2791709_2792180_+	single-stranded DNA-binding protein	NA	A0EWX3	Staphylococcus_phage	98.7	2.2e-80
WP_000338528.1|2793089_2793308_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401969.1|2793316_2793721_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A075M042	Staphylococcus_phage	100.0	8.4e-73
WP_106884743.1|2793733_2794102_+	hypothetical protein	NA	I1W656	Staphylococcus_phage	99.2	2.4e-50
WP_000131385.1|2794105_2794348_+	hypothetical protein	NA	A0A1P8L6E3	Staphylococcus_phage	98.8	1.1e-40
WP_015978309.1|2794362_2794767_+	hypothetical protein	NA	A0A0H4IPW3	Staphylococcus_phage	100.0	1.6e-71
WP_000399886.1|2794766_2795042_+	hypothetical protein	NA	Q4ZCN9	Staphylococcus_virus	96.7	8.0e-43
WP_047213620.1|2795034_2795283_+	DUF1024 family protein	NA	A0A2K9VBU0	Staphylococcus_phage	98.8	2.0e-37
WP_000185669.1|2795275_2795812_+	hypothetical protein	NA	R4IG63	Staphylococcus_phage	100.0	9.4e-96
WP_001282074.1|2795848_2796094_+	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	100.0	5.0e-36
WP_000195803.1|2796090_2796297_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000592207.1|2796293_2796680_+	hypothetical protein	NA	W5R986	Staphylococcus_phage	100.0	3.0e-64
WP_000595265.1|2796676_2796826_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_000265043.1|2796825_2797026_+	DUF1514 domain-containing protein	NA	A0A2I6PDV9	Staphylococcus_phage	100.0	1.4e-28
WP_000590122.1|2797053_2797470_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988332.1|2797701_2798001_+	HNH endonuclease	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
