The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	0	45554	2781568	holin,portal,terminase,protease,capsid,integrase,tail,head	Staphylococcus_phage(93.55%)	46	39689:39705	47124:47140
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154555.1|3609_4755_+|capsid	phage major capsid protein	capsid	A0A1X9H072	Staphylococcus_phage	100.0	5.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114225.1|5675_6080_+	hypothetical protein	NA	A0A2I6PDJ6	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268741.1|6484_7129_+|tail	phage tail protein	tail	W5R9H4	Staphylococcus_phage	100.0	6.5e-120
WP_072050172.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	98.6	8.8e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_047928553.1|8039_12569_+|tail	phage tail tape measure protein	tail	A0A1X9H084	Staphylococcus_phage	99.9	0.0e+00
WP_000567408.1|12565_14050_+|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	100.0	1.2e-297
WP_000582177.1|14065_17848_+	hypothetical protein	NA	A0A068A201	Staphylococcus_phage	99.8	0.0e+00
WP_001000058.1|17840_17993_+	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
WP_001262620.1|18038_18326_+	hypothetical protein	NA	C5I682	Staphylococcus_phage	100.0	9.9e-44
WP_000340977.1|18381_18756_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_072357969.1|18898_19075_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	96.6	6.5e-22
WP_031762631.1|19127_19235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|19286_19541_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|19552_20308_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000920041.1|20498_20990_+	staphylokinase	NA	A7TWR8	Staphylococcus_phage	100.0	8.0e-86
WP_000727643.1|22067_22517_-	chemotaxis-inhibiting protein CHIPS	NA	A7TWR9	Staphylococcus_phage	100.0	1.5e-78
WP_000702262.1|23199_23550_+	complement inhibitor SCIN-A	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|23602_23863_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|24173_24353_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
WP_053040876.1|25310_27359_+	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_001068542.1|27682_28969_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000990056.1|29168_29267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000681968.1|29509_29686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000691584.1|29944_30325_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000991302.1|30321_31218_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
WP_000645728.1|31218_31899_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763048.1|31895_32768_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
WP_047928552.1|32767_33508_+	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
WP_000182842.1|33573_34137_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000966288.1|34257_34782_+	membrane protein	NA	NA	NA	NA	NA
WP_001033971.1|34841_35399_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_000713072.1|35395_36238_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_001188077.1|36294_37335_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_000267034.1|37785_37959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106905733.1|38981_40133_+|integrase	tyrosine-type recombinase/integrase	integrase	P97010	Streptococcus_pyogenes_phage	32.2	8.1e-12
39689:39705	attL	AATAGTTTTGAAAAATA	NA	NA	NA	NA
WP_106905822.1|40171_42199_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_106905731.1|43989_44409_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	50.4	1.5e-27
WP_020977410.1|44708_45554_-	penicillin-hydrolyzing class A beta-lactamase BlaZ	NA	A0A1B0VBP7	Salmonella_phage	33.9	1.3e-30
47124:47140	attR	AATAGTTTTGAAAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	52173	54203	2781568		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|52173_52734_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275707.1|53105_54203_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.9	2.5e-47
>prophage 3
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	58232	60516	2781568		Bacillus_virus(100.0%)	2	NA	NA
WP_000284433.1|58232_59702_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	3.5e-108
WP_000040866.1|59694_60516_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 4
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	64177	70944	2781568		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|64177_65473_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|65581_65884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272071.1|66055_66748_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992921.1|66744_68937_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_047928545.1|68940_70944_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	35.9	3.7e-113
>prophage 5
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	78059	83088	2781568		Catovirus(33.33%)	5	NA	NA
WP_001231451.1|78059_79007_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
WP_001147869.1|79087_80449_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.8	1.1e-103
WP_000548775.1|80618_81149_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140172.1|81395_82466_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|82533_83088_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 6
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	86540	86954	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001670387.1|86540_86954_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	39.1	5.1e-17
>prophage 7
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	91947	92577	2781568		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|91947_92577_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 8
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	98605	171864	2781568	holin,portal,terminase,plate,capsid,integrase,tRNA,tail,head	Staphylococcus_phage(70.42%)	91	90448:90465	117753:117770
90448:90465	attL	ATCATCATCTTGTTCGTC	NA	NA	NA	NA
WP_001145722.1|98605_99652_-|integrase	site-specific integrase	integrase	Q4ZB10	Staphylococcus_virus	100.0	5.5e-201
WP_000337827.1|99764_99944_+	hypothetical protein	NA	Q4ZBP0	Staphylococcus_phage	100.0	3.7e-25
WP_000392183.1|99923_100856_-	hypothetical protein	NA	A0EX19	Staphylococcus_virus	100.0	6.7e-174
WP_000705238.1|100995_101163_-	hypothetical protein	NA	Q4ZDJ4	Staphylococcus_virus	100.0	1.7e-24
WP_000358224.1|101232_101952_-	helix-turn-helix transcriptional regulator	NA	A0A2H4PQQ2	Staphylococcus_phage	100.0	1.3e-132
WP_001198673.1|102093_102312_+	helix-turn-helix transcriptional regulator	NA	Q8SDX1	Staphylococcus_phage	100.0	2.9e-35
WP_025920887.1|102327_103107_+	prophage antirepressor	NA	M1RZB2	Staphylococcus_phage	96.1	2.7e-136
WP_000187184.1|103107_103332_+	hypothetical protein	NA	A0A0F6N4M2	Staphylococcus_phage	100.0	3.2e-34
WP_001094943.1|103371_103821_+	hypothetical protein	NA	A1KWZ2	Staphylococcus_virus	100.0	3.0e-79
WP_000977381.1|103834_104056_+	hypothetical protein	NA	A0A0F6N3I2	Staphylococcus_phage	100.0	1.5e-31
WP_000066011.1|104048_104210_+	DUF1270 domain-containing protein	NA	Q4ZAZ7	Staphylococcus_virus	100.0	2.5e-20
WP_029625653.1|104302_104563_+	DUF1108 family protein	NA	A0A0H4IP62	Staphylococcus_phage	98.8	4.4e-43
WP_000815403.1|104572_104794_+	DUF2483 domain-containing protein	NA	A0A1X9H047	Staphylococcus_phage	100.0	1.2e-33
WP_000139720.1|104786_105410_+	DUF1071 domain-containing protein	NA	A0A2H4PQQ6	Staphylococcus_phage	100.0	1.4e-114
WP_031927925.1|105409_105829_+	single-stranded DNA-binding protein	NA	Q4ZA54	Staphylococcus_virus	91.4	7.4e-56
WP_031927924.1|105839_106391_+	HNH endonuclease	NA	A0A2H4PQR4	Staphylococcus_phage	99.5	4.6e-106
WP_160199363.1|106391_107066_+	hypothetical protein	NA	Q4ZD97	Staphylococcus_virus	98.2	4.4e-127
WP_000414755.1|107204_107486_-	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	100.0	2.6e-49
WP_160199364.1|107550_108282_+	helix-turn-helix domain-containing protein	NA	A0A1J0MGB2	Staphylococcus_phage	76.9	2.0e-80
WP_024273306.1|108294_109080_+	ATP-binding protein	NA	A0A2I6PDV5	Staphylococcus_phage	99.6	1.6e-144
WP_000628833.1|109076_109235_+	hypothetical protein	NA	A0A2I6PDX0	Staphylococcus_phage	100.0	3.4e-22
WP_001123695.1|109247_109469_+	DUF3269 family protein	NA	A0A0H3U2V4	Staphylococcus_phage	100.0	2.2e-35
WP_000049798.1|109478_109883_+	DUF1064 domain-containing protein	NA	G4KNP2	Staphylococcus_phage	100.0	1.6e-68
WP_031873777.1|109887_110073_+	DUF3113 family protein	NA	Q4ZA46	Staphylococcus_virus	98.4	2.1e-26
WP_160199399.1|110073_110436_+	hypothetical protein	NA	R4II61	Staphylococcus_phage	96.7	2.3e-45
WP_101291451.1|110436_110685_+	hypothetical protein	NA	A7TWA8	Staphylococcus_phage	96.3	4.4e-40
WP_000693987.1|110698_110905_+	hypothetical protein	NA	A0A0N9BAW9	Staphylococcus_phage	100.0	3.0e-34
WP_000695759.1|110907_111309_+	hypothetical protein	NA	A0A0N7E0T5	Staphylococcus_phage	100.0	7.0e-72
WP_031867166.1|111305_111653_+	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	91.3	2.7e-51
WP_072529179.1|111649_111958_+	hypothetical protein	NA	Q4ZBK6	Staphylococcus_phage	98.0	2.6e-50
WP_160199365.1|111950_112199_+	DUF1024 family protein	NA	A0A0E3T8I2	Staphylococcus_phage	95.1	1.7e-36
WP_031927912.1|112191_112719_+	dUTP pyrophosphatase	NA	A0A2I6PE85	Staphylococcus_phage	99.4	3.0e-94
WP_000195831.1|112755_112992_+	DUF1381 domain-containing protein	NA	C8CH06	Staphylococcus_phage	100.0	1.1e-35
WP_031769004.1|113016_113253_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	98.7	2.1e-36
WP_000595257.1|113245_113419_+	transcriptional activator RinB	NA	Q4ZBK0	Staphylococcus_phage	100.0	6.4e-22
WP_000383791.1|113419_113782_+	hypothetical protein	NA	Q4ZDW4	Staphylococcus_virus	94.1	5.2e-58
WP_000989961.1|113782_113929_+	hypothetical protein	NA	E0Y3R6	Staphylococcus_virus	100.0	1.7e-15
WP_000058634.1|113943_114363_+	transcriptional regulator	NA	B7T0C4	Staphylococcus_virus	100.0	1.1e-70
WP_001003272.1|114549_114990_+|terminase	terminase small subunit	terminase	Q8SDV0	Staphylococcus_phage	100.0	2.8e-74
WP_031769002.1|114976_116254_+|terminase	PBSX family phage terminase large subunit	terminase	Q8SDU9	Staphylococcus_phage	99.8	1.1e-248
WP_031769000.1|116264_117800_+|portal	phage portal protein	portal	Q4ZDN2	Staphylococcus_virus	98.8	7.1e-290
117753:117770	attR	GACGAACAAGATGATGAT	NA	NA	NA	NA
WP_001556698.1|117806_118802_+|head	phage head morphogenesis protein	head	E0Y3K7	Staphylococcus_virus	99.7	1.7e-183
WP_000072207.1|118874_119045_+	hypothetical protein	NA	Q4ZDF2	Staphylococcus_virus	100.0	3.3e-23
WP_000354309.1|119179_119794_+	DUF4355 domain-containing protein	NA	I1W646	Staphylococcus_phage	100.0	2.9e-40
WP_031768999.1|119807_120782_+|capsid	phage major capsid protein	capsid	S4V686	Staphylococcus_phage	99.7	2.8e-183
WP_001114085.1|120803_121091_+	hypothetical protein	NA	S4V6D9	Staphylococcus_phage	100.0	4.7e-46
WP_000208960.1|121099_121432_+|head,tail	phage head-tail connector protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
WP_001268312.1|121428_121731_+	hypothetical protein	NA	A4ZFB6	Staphylococcus_virus	100.0	1.1e-50
WP_001017815.1|121730_122078_+	HK97 gp10 family phage protein	NA	A0A0F6N3F5	Staphylococcus_phage	100.0	4.1e-60
WP_000188649.1|122089_122473_+	hypothetical protein	NA	A0A0F6N3L1	Staphylococcus_phage	100.0	1.5e-68
WP_000002577.1|122491_123073_+|tail	phage major tail protein, TP901-1 family	tail	A0A0F6N3L8	Staphylococcus_phage	100.0	4.9e-106
WP_001100163.1|123134_123500_+	hypothetical protein	NA	Q8SDT9	Staphylococcus_phage	100.0	2.8e-59
WP_000105584.1|123529_123874_+	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
WP_031862957.1|123890_127358_+	membrane protein	NA	Q4ZDU6	Staphylococcus_virus	95.3	4.0e-248
WP_000350683.1|127370_128318_+|tail	phage tail family protein	tail	B2ZYZ5	Staphylococcus_phage	100.0	3.6e-183
WP_031768995.1|128326_130228_+	peptidase	NA	I1W634	Staphylococcus_phage	99.7	0.0e+00
WP_031768993.1|130242_132153_+	hypothetical protein	NA	I1W633	Staphylococcus_phage	98.9	0.0e+00
WP_031768991.1|132152_133976_+|plate	phage baseplate upper protein	plate	Q4ZDD5	Staphylococcus_virus	97.0	1.2e-288
WP_000705919.1|133975_134353_+	DUF2977 domain-containing protein	NA	A0A2H4PQW4	Staphylococcus_phage	100.0	5.3e-61
WP_072492067.1|134362_134536_+	XkdX family protein	NA	Q4ZDD2	Staphylococcus_virus	98.2	1.7e-27
WP_000466785.1|134576_134876_+	DUF2951 family protein	NA	A0EWU6	Staphylococcus_virus	91.9	1.9e-42
WP_029549410.1|135012_136911_+	CHAP domain-containing protein	NA	Q8SDT1	Staphylococcus_phage	99.7	0.0e+00
WP_160199366.1|136923_138096_+|plate	BppU family phage baseplate upper protein	plate	B2ZZ03	Staphylococcus_phage	98.7	2.7e-196
WP_000398878.1|138101_138497_+	hypothetical protein	NA	Q4ZBP5	Staphylococcus_phage	100.0	2.7e-68
WP_031910540.1|138552_138990_+|holin	phage holin	holin	A0A2H4PQP0	Staphylococcus_phage	98.6	1.2e-72
WP_031910539.1|138970_140416_+	CHAP domain-containing protein	NA	Q08JW9	Staphylococcus_phage	99.6	1.5e-294
WP_001788502.1|140658_140811_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
WP_000139423.1|140881_140992_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
WP_000382163.1|140978_141179_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
WP_100250272.1|141504_141585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005407.1|141931_142093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000163283.1|142223_142739_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000830380.1|143079_143889_+	monofunctional peptidoglycan glycosyltransferase SgtB	NA	NA	NA	NA	NA
WP_001124422.1|144149_144968_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000435806.1|144945_145260_+	YfhH family protein	NA	NA	NA	NA	NA
WP_000535828.1|145274_146792_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000886465.1|146800_147637_+	membrane protein	NA	NA	NA	NA	NA
WP_031889753.1|147897_148875_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000284752.1|149026_150064_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000251253.1|150365_150908_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_000597239.1|151198_152935_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
WP_001791878.1|152943_153036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236371.1|153125_154220_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_001011598.1|154512_155802_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000939521.1|155882_156338_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_000110011.1|157391_157838_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_000063582.1|166619_167681_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_000649908.1|167938_169396_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_078104172.1|169382_170111_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	1.3e-36
WP_076692539.1|170246_171389_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000181394.1|171393_171864_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	180994	181339	2781568		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|180994_181339_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 10
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	190928	191669	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|190928_191669_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 11
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	199442	202912	2781568		Staphylococcus_phage(75.0%)	4	NA	NA
WP_129409671.1|199442_200225_+	staphylococcal enterotoxin type O	NA	A0A1X9H080	Staphylococcus_phage	36.7	1.4e-31
WP_047928530.1|200505_201225_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
WP_000713847.1|201259_201988_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
WP_000764689.1|202141_202912_+	staphylococcal enterotoxin type C1/U	NA	A0A097PAT7	Streptococcus_pyogenes_phage	43.2	1.4e-44
>prophage 12
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	207446	207575	2781568	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001792814.1|207446_207575_-|transposase	IS3 family transposase	transposase	A0A2H4PQU1	Staphylococcus_phage	66.7	6.6e-08
>prophage 13
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	211893	215685	2781568		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001092773.1|211893_212475_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	63.2	4.6e-56
WP_047928525.1|212870_214427_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	97.7	6.3e-286
WP_000072555.1|214419_215685_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	34.3	5.2e-44
>prophage 14
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	220762	267866	2781568	protease,tRNA	Staphylococcus_phage(91.89%)	44	NA	NA
WP_000764922.1|220762_221515_-	hypothetical protein	NA	A0A097PAT7	Streptococcus_pyogenes_phage	47.2	4.4e-51
WP_031775015.1|221541_222267_-	enterotoxin	NA	A0EX09	Staphylococcus_phage	33.5	4.0e-25
WP_000669028.1|222311_222938_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	93.8	3.9e-93
WP_000070649.1|223011_224007_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	4.2e-73
WP_078104171.1|224087_224738_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	83.8	1.6e-41
WP_076692541.1|225040_225496_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	98.6	1.2e-78
WP_000348379.1|225654_227133_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	100.0	1.5e-289
WP_000778516.1|227137_228139_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	98.2	9.7e-187
WP_000718110.1|228135_228393_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	98.8	3.6e-45
WP_078098768.1|228458_228932_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	97.5	1.4e-82
WP_016169057.1|228936_229683_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	99.2	2.2e-143
WP_000109906.1|230060_231653_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933822.1|232024_233218_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.7	1.9e-218
WP_000366163.1|233342_234251_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000453298.1|234462_235296_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
WP_000623478.1|235679_236033_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	100.0	2.6e-22
WP_001200542.1|236029_236395_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_047928516.1|236650_236953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|237212_237926_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168907.1|238365_239001_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_047928515.1|239296_239740_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.0	9.2e-57
WP_001153742.1|239726_240170_-	competence protein ComK	NA	NA	NA	NA	NA
WP_047928513.1|240282_240753_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	98.7	3.0e-82
WP_000384171.1|240951_241176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|241451_242306_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000163235.1|242600_242996_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	100.0	6.3e-73
WP_000989121.1|243013_244306_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_000221177.1|244305_244620_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_001261669.1|245142_246645_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	100.0	2.3e-30
WP_025174259.1|247137_248169_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	2.0e-195
WP_000493888.1|248175_248808_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	100.0	3.4e-113
WP_001159035.1|248818_250000_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	100.0	1.7e-227
WP_001008549.1|250012_250477_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
WP_001196345.1|250598_251600_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	100.0	3.1e-185
WP_001790712.1|251711_251831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266096.1|251833_252661_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|253231_253633_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764419.1|253752_254316_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000526539.1|254312_255266_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025061.1|255375_256557_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	100.0	5.6e-218
WP_001108728.1|256847_259262_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.3	0.0e+00
WP_000836465.1|259283_259595_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	100.0	1.6e-52
WP_047928507.1|259920_266481_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	96.2	2.1e-298
WP_000285020.1|266597_267866_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
>prophage 15
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	279299	284627	2781568		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|279299_280157_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048368.1|280185_280782_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_031775255.1|280802_284627_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.0e-83
>prophage 16
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	291378	295080	2781568		Tupanvirus(50.0%)	3	NA	NA
WP_047928504.1|291378_292548_-	acetoin utilization protein AcuC	NA	A0A2K9L0I3	Tupanvirus	37.0	7.4e-21
WP_001015996.1|292572_293205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000862083.1|293373_295080_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	100.0	1.2e-274
>prophage 17
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	301697	304328	2781568	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|301697_302960_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279338.1|303053_304328_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 18
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	308096	312231	2781568		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808837.1|308096_309701_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291419.1|309687_310848_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553927.1|310961_311408_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174285.1|311487_312231_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.0	4.9e-18
>prophage 19
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	329963	333161	2781568		Streptomyces_phage(100.0%)	1	NA	NA
WP_031586435.1|329963_333161_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.7	1.3e-136
>prophage 20
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	338094	339852	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232648.1|338094_339852_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 21
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	346713	354877	2781568		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080028.1|346713_347418_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_072361851.1|347417_349079_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849439.1|349577_351065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038305.1|351358_353989_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114466.1|354004_354877_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	38.2	2.6e-42
>prophage 22
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	358792	369945	2781568	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|358792_359713_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_001790562.1|359805_359928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|360125_362063_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049154.1|362488_363982_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|364210_364738_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|364766_364967_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|365013_365370_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|365511_366120_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_047928497.1|366138_367068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|367072_367183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127573.1|367230_368532_+	trigger factor	NA	NA	NA	NA	NA
WP_000472302.1|368682_369945_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 23
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	379512	382143	2781568	tRNA	Catovirus(100.0%)	1	NA	NA
WP_000425353.1|379512_382143_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	3.7e-153
>prophage 24
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	392076	427573	2781568	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005767.1|392076_393081_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|393082_394108_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|394130_395270_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|395288_395549_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749795.1|395823_398103_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000594985.1|398305_400579_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	1.1e-63
WP_000364542.1|400600_401119_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058587.1|401546_403736_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869983.1|403747_404200_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|404196_405072_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_061743889.1|405532_406795_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|406810_408577_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001808039.1|408909_409038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|409037_409811_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102731.1|409971_411246_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.7	1.4e-105
WP_000704122.1|411330_411753_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|411852_412035_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|412074_412221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985895.1|412457_413471_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409167.1|413782_414925_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.3	8.3e-33
WP_000066097.1|414925_416044_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567018.1|416622_417291_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_047928487.1|417292_419770_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	28.4	1.1e-66
WP_047928486.1|420112_422743_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|422805_423066_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|423069_423498_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|423512_423821_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342266.1|424105_424744_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	1.6e-09
WP_000137779.1|424746_425670_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|425681_426950_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|426949_427573_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 25
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	442422	448586	2781568		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|442422_442884_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953299.1|442942_445090_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.6e-32
WP_001282563.1|445146_446121_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|446165_446417_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368345.1|446762_448586_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	8.0e-22
>prophage 26
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	452018	455126	2781568		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|452018_453851_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_047928473.1|453986_455126_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 27
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	461596	462544	2781568		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|461596_462544_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 28
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	465597	479343	2781568	tRNA	Klosneuvirus(25.0%)	13	NA	NA
WP_001030080.1|465597_466989_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001797828.1|467323_467947_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411301.1|467957_468776_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217244.1|468836_470654_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.6e-54
WP_001283055.1|470877_471984_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_023914705.1|472114_472792_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683936.1|472794_473895_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	29.6	5.2e-08
WP_001062177.1|474008_475355_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924220.1|475364_476255_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
WP_031775221.1|476380_477166_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	1.0e-18
WP_000564316.1|477207_478071_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|478057_478468_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|478743_479343_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 29
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	485516	486140	2781568		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|485516_486140_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 30
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	491684	494496	2781568		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019690.1|491684_493031_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.9	5.7e-65
WP_000202188.1|493023_494496_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 31
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	501995	508564	2781568		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|501995_503333_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|503325_503556_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183375.1|503533_504415_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	26.1	8.9e-11
WP_001124985.1|504846_505299_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942210.1|505314_506994_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_047928467.1|507142_508564_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	3.9e-40
>prophage 32
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	515393	516800	2781568		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|515393_516800_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 33
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	523227	524712	2781568		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|523227_524712_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 34
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	528239	536524	2781568		Klosneuvirus(20.0%)	10	NA	NA
WP_001171351.1|528239_529148_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	31.5	3.4e-05
WP_000365246.1|529229_529772_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_047928465.1|529876_530326_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000447733.1|530374_531262_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183436.1|531339_531846_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273371.1|531937_532669_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
WP_000368656.1|532661_533204_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|533196_533934_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|534066_534792_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987774.1|534772_536524_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.2	2.2e-21
>prophage 35
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	540151	542830	2781568		Bacillus_phage(50.0%)	3	NA	NA
WP_001151997.1|540151_540400_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_047928464.1|540507_541461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902099.1|541450_542830_+	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	33.6	1.4e-55
>prophage 36
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	552254	557721	2781568		Bacillus_phage(25.0%)	7	NA	NA
WP_001043863.1|552254_552527_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|552957_553530_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_047928462.1|553532_554258_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001817755.1|554274_555219_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|555310_555760_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|555968_556169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269921.1|556554_557721_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	31.8	5.8e-34
>prophage 37
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	561383	561959	2781568		Bacillus_virus(100.0%)	1	NA	NA
WP_000005212.1|561383_561959_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
>prophage 38
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	565329	572835	2781568	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361552.1|565329_566532_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	1.9e-35
WP_000049923.1|566518_567490_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525078.1|567513_570207_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858789.1|570528_571821_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.0	1.9e-54
WP_000362220.1|572148_572835_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	5.5e-08
>prophage 39
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	576575	577202	2781568		Bacillus_phage(100.0%)	1	NA	NA
WP_001108889.1|576575_577202_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 40
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	586527	587406	2781568		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|586527_587406_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 41
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	613387	622774	2781568		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|613387_614092_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|614336_614531_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000691942.1|614542_614794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404645.1|614831_615956_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995287.1|615971_616409_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934887.1|616832_617789_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.3e-167
WP_000175746.1|617988_618468_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_047928450.1|618482_619322_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
WP_000159900.1|619407_619941_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|619933_620362_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473653.1|620373_620874_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|620873_621095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342144.1|621283_622774_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.8	5.9e-23
>prophage 42
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	626176	628188	2781568		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|626176_626836_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166801.1|626832_628188_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 43
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	634353	635145	2781568		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|634353_635145_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 44
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	638685	643716	2781568	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|638685_639822_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001788788.1|639853_640483_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|640501_640771_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|640933_641242_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|641412_641613_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|641809_642211_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216946.1|642450_643716_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
>prophage 45
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	651763	653365	2781568		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|651763_653365_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 46
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	658453	661907	2781568		Indivirus(50.0%)	3	NA	NA
WP_000079447.1|658453_659305_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
WP_000974847.1|659311_659953_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077571.1|660092_661907_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.1	5.1e-154
>prophage 47
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	665321	666023	2781568		Tupanvirus(100.0%)	1	NA	NA
WP_000571259.1|665321_666023_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.0e-13
>prophage 48
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	674121	676476	2781568		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000153613.1|674121_674904_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.9	2.7e-27
WP_047928445.1|674905_675904_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	8.5e-34
WP_000604816.1|675909_676476_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 49
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	680794	682057	2781568		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|680794_682057_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 50
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	691716	696110	2781568		Bacillus_phage(50.0%)	2	NA	NA
WP_001289579.1|691716_694119_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.7	4.2e-95
WP_001548666.1|694118_696110_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 51
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	701930	703577	2781568		Vibrio_phage(100.0%)	1	NA	NA
WP_001088978.1|701930_703577_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 52
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	707246	708368	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691284.1|707246_708368_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 53
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	712517	718173	2781568		Phage_Wrath(25.0%)	7	NA	NA
WP_001208760.1|712517_713141_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	3.5e-17
WP_000380719.1|713520_714384_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	4.1e-16
WP_001791425.1|714457_714562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688122.1|714558_715536_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085655.1|715692_715962_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|716415_716565_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000082539.1|716655_718173_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 54
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	728311	732588	2781568		Bacillus_phage(50.0%)	6	NA	NA
WP_061743908.1|728311_728845_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_047928441.1|728983_729172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|729285_729888_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670303.1|729884_730976_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_160199371.1|730979_731711_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_072384901.1|731679_732588_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.6	3.4e-21
>prophage 55
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	736552	772503	2781568	holin,portal,plate,terminase,integrase,tail,head	Staphylococcus_phage(56.82%)	49	737922:737959	772658:772695
WP_001065797.1|736552_737893_-	hypothetical protein	NA	A0A1J0MF61	Staphylococcus_phage	58.9	1.1e-140
737922:737959	attL	GTACTGATCTCTTTCCCATTCAGATACTTGAGTTCTGT	NA	NA	NA	NA
WP_076692498.1|738135_738360_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	75.4	1.6e-20
WP_000477485.1|738786_739203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001808025.1|739650_740586_-	Abi family protein	NA	A0A059NT88	Lactococcus_phage	44.0	5.3e-70
WP_001808024.1|740806_741004_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	3.7e-10
WP_001140244.1|741472_742393_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQL2	Staphylococcus_phage	50.8	1.0e-65
WP_000438657.1|742457_742847_-|holin	phage holin family protein	holin	A0A1S6L1J2	Staphylococcus_phage	38.2	5.3e-16
WP_006190235.1|742859_744257_-|plate	phage baseplate upper protein	plate	A0A1J0MFK8	Staphylococcus_phage	44.7	2.6e-105
WP_000700623.1|744275_745289_-	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	52.6	6.5e-98
WP_047928440.1|745306_746992_-	hypothetical protein	NA	Q4ZE19	Staphylococcus_virus	46.5	1.4e-108
WP_000350618.1|747000_747936_-|tail	phage tail protein	tail	A0A1J0MF79	Staphylococcus_phage	55.9	2.1e-98
WP_047928439.1|747950_751121_-	membrane protein	NA	Q4ZE24	Staphylococcus_virus	54.5	1.6e-94
WP_001808026.1|751132_751486_-	hypothetical protein	NA	Q4ZE25	Staphylococcus_virus	72.3	1.7e-37
WP_000256347.1|751536_751881_-	hypothetical protein	NA	A0A1J0MFH0	Staphylococcus_phage	58.9	7.7e-35
WP_000276225.1|751942_752542_-|tail	phage major tail protein, TP901-1 family	tail	H9A0N8	Staphylococcus_phage	47.5	7.4e-17
WP_000680037.1|752553_752949_-	hypothetical protein	NA	H9A0N7	Staphylococcus_phage	42.3	1.9e-21
WP_001198140.1|752958_753309_-	hypothetical protein	NA	H9A0N6	Staphylococcus_phage	60.0	9.3e-36
WP_001106897.1|753309_753615_-	hypothetical protein	NA	Q4ZE30	Staphylococcus_virus	40.6	6.4e-17
WP_001010139.1|753614_753941_-|head,tail	phage head-tail connector protein	head,tail	Q4ZE31	Staphylococcus_virus	56.4	2.1e-26
WP_000104116.1|753956_754430_-	hypothetical protein	NA	A0A2H4J9T3	uncultured_Caudovirales_phage	31.6	9.7e-12
WP_000200243.1|754507_755419_-	hypothetical protein	NA	Q4ZE33	Staphylococcus_virus	59.7	6.5e-97
WP_000429653.1|755437_756016_-	DUF4355 domain-containing protein	NA	Q4ZE34	Staphylococcus_virus	50.8	1.9e-09
WP_031811279.1|755982_756111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078064796.1|756310_757300_-|head	head morphogenesis protein	head	Q4ZE35	Staphylococcus_virus	68.9	3.8e-50
WP_000158570.1|757829_759278_-|portal	phage portal protein	portal	Q4ZE36	Staphylococcus_virus	69.4	3.7e-195
WP_000207538.1|759290_760565_-|terminase	PBSX family phage terminase large subunit	terminase	Q4ZE37	Staphylococcus_virus	76.2	3.2e-195
WP_000090969.1|760551_760980_-	helix-turn-helix domain-containing protein	NA	A1EAE0	Streptococcus_phage	45.1	1.1e-25
WP_000653931.1|761132_761621_-	hypothetical protein	NA	R9TMH4	Paenibacillus_phage	28.3	8.7e-08
WP_000835355.1|761897_762362_-	hypothetical protein	NA	C9E2P0	Enterococcus_phage	43.0	3.2e-20
WP_106905708.1|762358_762466_-	DUF1381 domain-containing protein	NA	C8CH06	Staphylococcus_phage	87.5	1.2e-07
WP_031587073.1|762596_763127_-	nucleotide pyrophosphohydrolase	NA	A0A1P8VVP1	Streptococcus_phage	39.1	2.3e-22
WP_000860978.1|763119_763431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714411.1|763436_763595_-	hypothetical protein	NA	A0A0E3T9L7	Staphylococcus_phage	90.4	6.7e-18
WP_000946005.1|763609_763900_-	hypothetical protein	NA	A0A223LIA9	Staphylococcus_phage	58.1	7.2e-18
WP_000929466.1|763900_764803_-	DnaD domain protein	NA	A0A1P8L6F0	Staphylococcus_phage	52.0	2.9e-49
WP_072433566.1|764815_765310_-	single-stranded DNA-binding protein	NA	A7TWM8	Staphylococcus_phage	94.0	6.4e-83
WP_000907597.1|765390_766170_-	ATP-binding protein	NA	A0A1W6JPW0	Staphylococcus_phage	88.0	2.3e-127
WP_001004327.1|766170_766707_-	hypothetical protein	NA	A0A0H3U480	Staphylococcus_phage	82.5	1.7e-76
WP_000786634.1|766711_766978_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	53.6	3.0e-18
WP_000786993.1|766967_767285_-	DUF2482 family protein	NA	W5RAK4	Staphylococcus_phage	80.6	1.6e-39
WP_047928438.1|767371_767533_-	DUF1270 family protein	NA	R4IH12	Staphylococcus_phage	69.8	1.1e-12
WP_001157025.1|767631_768315_-	phage repressor protein	NA	A9CR56	Staphylococcus_phage	85.6	5.2e-107
WP_000800341.1|768375_768582_+	hypothetical protein	NA	A1BTY8	Staphylococcus_virus	75.0	3.3e-25
WP_000932238.1|769005_769281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001209962.1|769307_769526_-	DUF739 family protein	NA	A0A2I6PE94	Staphylococcus_phage	62.5	4.9e-19
WP_000664917.1|769693_770086_+	helix-turn-helix domain-containing protein	NA	A0A2I6PE55	Staphylococcus_phage	53.6	1.6e-28
WP_000554410.1|770232_770616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031587096.1|770627_771323_+	hypothetical protein	NA	A0A2H4J5B8	uncultured_Caudovirales_phage	50.3	1.4e-06
WP_001836882.1|771375_772503_+|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	31.4	6.2e-33
772658:772695	attR	GTACTGATCTCTTTCCCATTCAGATACTTGAGTTCTGT	NA	NA	NA	NA
>prophage 56
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	777219	777696	2781568		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|777219_777696_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 57
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	783638	790120	2781568		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103743.1|783638_784457_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|784931_785474_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516264.1|785479_787489_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.7	2.8e-60
WP_000073352.1|787501_790120_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
>prophage 58
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	799534	800578	2781568		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|799534_800578_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 59
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	804777	810321	2781568		Bacillus_virus(33.33%)	4	NA	NA
WP_000664766.1|804777_806064_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	27.9	6.7e-15
WP_000089946.1|806063_807329_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.6e-40
WP_001293307.1|807359_808073_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001806691.1|808077_810321_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 60
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	815461	827275	2781568	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864185.1|815461_816433_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282302.1|816447_817365_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|817534_817885_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_031587224.1|818270_820388_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	1.8e-25
WP_000020853.1|820392_820710_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|820706_820991_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097461.1|821011_822187_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036633.1|822207_822675_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_160199400.1|822964_827275_-	PolC-type DNA polymerase III	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 61
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	831523	832294	2781568		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473705.1|831523_832294_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 62
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	837072	848277	2781568	protease,tRNA	Erwinia_phage(20.0%)	9	NA	NA
WP_000379049.1|837072_838476_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.8	1.3e-27
WP_000072681.1|838541_839087_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015597.1|839083_839980_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.5	3.6e-31
WP_047928434.1|840396_841704_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_078170908.1|841859_843935_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.1	6.6e-105
WP_000931872.1|844108_844981_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000110253.1|845304_846213_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|846234_847401_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176406.1|847509_848277_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	1.9e-25
>prophage 63
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	861830	863951	2781568		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|861830_862562_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|862677_862911_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|863216_863951_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 64
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	874321	876316	2781568		Moumouvirus(100.0%)	1	NA	NA
WP_124421622.1|874321_876316_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 65
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	879463	880399	2781568	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161281.1|879463_880399_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.9	3.6e-10
>prophage 66
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	885412	887669	2781568		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|885412_886612_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|886827_887046_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368227.1|887045_887669_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.7	3.6e-22
>prophage 67
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	890983	891595	2781568		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|890983_891595_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 68
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	895562	900173	2781568		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|895562_896663_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_000767028.1|896664_897939_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|897956_898838_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|898865_900173_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 69
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	904637	907391	2781568	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384691.1|904637_907391_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 70
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	926974	927163	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245802.1|926974_927163_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	86.9	3.8e-20
>prophage 71
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	936246	938217	2781568		Staphylococcus_phage(100.0%)	3	NA	NA
WP_076692497.1|936246_936471_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765709.1|936427_936574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857488.1|937257_938217_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
>prophage 72
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	944956	945544	2781568		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000659313.1|944956_945544_-	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	28.9	1.3e-10
>prophage 73
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	952267	956825	2781568		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|952267_952582_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_047928316.1|952754_955103_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	7.2e-15
WP_000161940.1|955112_956825_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	8.9e-15
>prophage 74
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	961832	962891	2781568	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003563.1|961832_962891_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 75
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	974826	977734	2781568		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|974826_975309_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263796.1|975310_975853_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_047928303.1|975922_976312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|976314_976569_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757570.1|976807_977734_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	1.7e-12
>prophage 76
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	989251	991099	2781568		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182654.1|989251_991099_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 77
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	999231	1008063	2781568		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|999231_1000326_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020625.1|1000338_1000878_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455596.1|1001021_1001297_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|1001463_1002870_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863440.1|1002873_1004166_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|1004256_1005234_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|1005237_1006350_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668339.1|1006520_1007147_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957036.1|1007511_1008063_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.2	1.6e-13
>prophage 78
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1014075	1018455	2781568		Bacillus_virus(50.0%)	5	NA	NA
WP_001289618.1|1014075_1014309_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_000040052.1|1014545_1016264_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1016266_1016533_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505966.1|1016686_1017229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685067.1|1017282_1018455_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
>prophage 79
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1021570	1036332	2781568		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921965.1|1021570_1022971_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273253.1|1022963_1023770_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101899.1|1024036_1025284_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_047928251.1|1025305_1026784_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_047928249.1|1026798_1027365_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.7	5.5e-30
WP_000030811.1|1027367_1028396_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
WP_000483713.1|1028388_1029873_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	3.2e-45
WP_000032740.1|1029851_1032041_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
WP_000666806.1|1032033_1032705_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848350.1|1032706_1032970_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174053.1|1032969_1033674_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_001010413.1|1033677_1034802_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861572.1|1034788_1035271_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	6.2e-22
WP_000225837.1|1035471_1036332_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.2	5.3e-40
>prophage 80
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1046784	1050555	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047928230.1|1046784_1050555_+	mannosyl-glycoprotein endo-beta-N-acetylglucosamidase	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 81
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1054221	1097183	2781568	protease,transposase,bacteriocin	Staphylococcus_phage(22.22%)	46	NA	NA
WP_031775067.1|1054221_1055232_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.2e-16
WP_001089097.1|1055313_1056495_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284457.1|1056532_1056862_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184947.1|1057099_1057921_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150199.1|1057913_1058717_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526680.1|1058703_1060377_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_072353880.1|1060363_1061575_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_001791731.1|1061651_1061756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070966.1|1061906_1062845_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620949.1|1062896_1063448_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001788574.1|1063537_1063828_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
WP_001790177.1|1063891_1064023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000766009.1|1065516_1065873_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001792054.1|1065961_1066099_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_001795266.1|1066239_1066530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571167.1|1066617_1067259_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-19
WP_000668627.1|1067255_1067576_-	YxeA family protein	NA	NA	NA	NA	NA
WP_078056058.1|1068541_1069078_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	43.6	9.9e-29
WP_160199374.1|1069058_1069562_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001255379.1|1069670_1070027_-	cystatin-like fold lipoprotein	NA	NA	NA	NA	NA
WP_000810443.1|1070082_1070673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160199375.1|1070679_1071726_-	CHAP domain-containing protein	NA	A0A1X9I9L1	Staphylococcus_phage	36.9	8.1e-19
WP_000681154.1|1071715_1073563_-	membrane protein	NA	NA	NA	NA	NA
WP_001251190.1|1073567_1074926_-	cell division protein FtsK	NA	A0A1S5SFB5	Streptococcus_phage	29.7	2.0e-41
WP_000453449.1|1074988_1075255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031902.1|1075492_1075969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049261.1|1076141_1078637_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000358144.1|1078671_1079055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015639.1|1079066_1079327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000692002.1|1079331_1080387_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_000173102.1|1080447_1081539_-	replication initiation factor domain-containing protein	NA	NA	NA	NA	NA
WP_000386891.1|1081713_1082016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805734.1|1082029_1082350_-	DUF961 domain-containing protein	NA	NA	NA	NA	NA
WP_000134542.1|1082500_1082785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001797239.1|1084105_1084378_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_031763719.1|1084387_1084489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033865.1|1085404_1086007_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000214898.1|1086021_1086198_-	YkvS family protein	NA	NA	NA	NA	NA
WP_000668818.1|1086396_1087383_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000876826.1|1087463_1087682_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000287265.1|1087891_1088461_+	competence protein ComK	NA	NA	NA	NA	NA
WP_000414165.1|1088947_1090459_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000021865.1|1090597_1091956_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_001795272.1|1091972_1094297_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000928413.1|1094515_1095319_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049951.1|1095620_1097183_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
>prophage 82
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1116113	1117922	2781568		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1116113_1117922_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 83
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1124718	1125705	2781568		Bacillus_virus(100.0%)	1	NA	NA
WP_160199376.1|1124718_1125705_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.2	1.8e-15
>prophage 84
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1129356	1131370	2781568		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786736.1|1129356_1130298_-	ABC transporter ATP-binding protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
WP_000140050.1|1130287_1131370_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 85
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1139966	1146776	2781568		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1139966_1141112_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047069.1|1141221_1142091_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353954.1|1142149_1144759_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044219.1|1144961_1146776_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	34.2	3.0e-37
>prophage 86
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1152386	1156040	2781568		Bacillus_phage(100.0%)	1	NA	NA
WP_000154923.1|1152386_1156040_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.3	7.7e-24
>prophage 87
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1166194	1173272	2781568		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185319.1|1166194_1167124_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
WP_000138487.1|1167546_1168791_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047928208.1|1168899_1170090_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.3e-33
WP_000838039.1|1170398_1171526_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1171886_1172264_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1172678_1173272_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 88
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1183194	1186822	2781568		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009687.1|1183194_1184670_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	6.9e-48
WP_000046076.1|1184800_1186009_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143497.1|1186462_1186822_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.1e-14
>prophage 89
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1190865	1193534	2781568		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1190865_1192080_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129653.1|1192076_1193534_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.3	4.4e-39
>prophage 90
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1206739	1210265	2781568		environmental_halophage(50.0%)	3	NA	NA
WP_160199377.1|1206739_1207984_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
WP_000205582.1|1208098_1209406_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_160199378.1|1209503_1210265_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 91
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1213752	1222890	2781568		Streptococcus_phage(40.0%)	14	NA	NA
WP_047928199.1|1213752_1214778_-	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	3.9e-26
WP_001065801.1|1215027_1215324_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001018962.1|1215316_1215703_-	topiosmerase	NA	NA	NA	NA	NA
WP_000932211.1|1216117_1216996_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000662306.1|1216997_1217111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000290489.1|1217174_1217555_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000589549.1|1217712_1218069_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001190695.1|1218212_1218533_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1218682_1219222_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150016.1|1219304_1220021_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.6	1.0e-17
WP_000974460.1|1220168_1220591_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_160199379.1|1220989_1221484_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255553.1|1221639_1222257_+	amino acid transporter	NA	NA	NA	NA	NA
WP_072353886.1|1222329_1222890_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	2.2e-31
>prophage 92
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1226294	1227538	2781568		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1226294_1226495_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_001641381.1|1226851_1227538_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	3.8e-33
>prophage 93
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1236722	1244465	2781568		Staphylococcus_phage(50.0%)	7	NA	NA
WP_000757401.1|1236722_1237451_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	36.8	1.4e-17
WP_001085185.1|1238315_1238780_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	100.0	1.5e-81
WP_047928197.1|1238801_1241174_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	39.0	2.3e-93
WP_001165964.1|1241207_1241948_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000556760.1|1242063_1242297_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1242363_1242822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1243160_1244465_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 94
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1253583	1259345	2781568		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1253583_1254171_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1254744_1255689_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1255799_1256795_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369722.1|1256791_1257703_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1258409_1259345_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 95
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1263854	1266701	2781568		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662681.1|1263854_1266701_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
>prophage 96
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1270019	1270859	2781568		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000753320.1|1270019_1270859_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 97
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1276937	1282650	2781568		Streptococcus_phage(66.67%)	5	NA	NA
WP_001793589.1|1276937_1278020_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.5	2.0e-44
WP_000686342.1|1278383_1279250_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192949.1|1279393_1280035_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
WP_000258151.1|1280206_1281262_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1281579_1282650_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 98
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1291930	1315438	2781568		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616842.1|1291930_1292692_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	8.5e-18
WP_001245577.1|1292688_1293645_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|1293631_1294603_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|1294641_1294797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1295310_1296282_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855505.1|1296399_1298505_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1298467_1298866_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068494.1|1299666_1300533_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1300552_1301053_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1301393_1302899_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_001790641.1|1302976_1303078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429014.1|1303168_1304086_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	3.7e-07
WP_000197271.1|1304709_1305252_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_061743932.1|1305546_1306605_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	1.4e-21
WP_000180991.1|1306844_1308359_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589260.1|1308351_1309329_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
WP_000983677.1|1309550_1311332_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_076692510.1|1311343_1313227_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
WP_000098285.1|1313497_1315438_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 99
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1318577	1328423	2781568		Pandoravirus(12.5%)	12	NA	NA
WP_001217802.1|1318577_1319729_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	1.2e-23
WP_000604514.1|1319712_1320306_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_000446724.1|1320656_1321325_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1321326_1321746_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|1321749_1322463_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000604990.1|1322561_1323146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093562.1|1323425_1323866_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1324207_1324681_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1324655_1325342_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244417.1|1325341_1326397_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.5	1.6e-14
WP_000702781.1|1326468_1327452_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	1.5e-62
WP_000931237.1|1327583_1328423_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.3	5.1e-56
>prophage 100
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1340035	1341409	2781568		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000952026.1|1340035_1341409_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	33.6	5.1e-45
>prophage 101
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1346386	1352666	2781568		Bacillus_phage(33.33%)	6	NA	NA
WP_000857624.1|1346386_1348060_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.4	4.5e-11
WP_000737150.1|1348056_1349688_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	6.7e-12
WP_000469890.1|1349906_1350782_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1350953_1351637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148828.1|1351639_1352098_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820892.1|1352099_1352666_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	6.1e-21
>prophage 102
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1359588	1360062	2781568		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|1359588_1360062_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 103
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1365324	1366122	2781568		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|1365324_1366122_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 104
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1370952	1371714	2781568		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1370952_1371714_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 105
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1376088	1377132	2781568		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001030771.1|1376088_1377132_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 106
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1383653	1384451	2781568		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1383653_1384451_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 107
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1387676	1391635	2781568		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1387676_1389404_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793067.1|1389824_1391120_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1391236_1391635_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 108
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1398569	1399313	2781568		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1398569_1399313_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 109
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1410463	1411024	2781568	integrase	Streptococcus_phage(100.0%)	1	1404617:1404631	1414612:1414626
1404617:1404631	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|1410463_1411024_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|1410463_1411024_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
1414612:1414626	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 110
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1423914	1427268	2781568		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1423914_1424925_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001788287.1|1425423_1425945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180145.1|1425972_1427268_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	2.1e-24
>prophage 111
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1434576	1435899	2781568		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860587.1|1434576_1435899_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.1	2.4e-108
>prophage 112
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1447203	1447860	2781568		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1447203_1447860_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 113
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1451501	1454822	2781568		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100835.1|1451501_1452878_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
WP_031588860.1|1453421_1454822_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 114
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1473826	1474489	2781568		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067255.1|1473826_1474489_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.1e-24
>prophage 115
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1481068	1482256	2781568		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|1481068_1482256_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 116
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1485284	1496238	2781568		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1485284_1487366_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1487488_1487959_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1488024_1488438_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1488535_1488790_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|1488926_1492523_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1492686_1496238_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 117
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1499921	1504704	2781568	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1499921_1500470_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1500482_1500665_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1500720_1500864_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872876.1|1500978_1501548_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664738.1|1501628_1502153_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1502152_1502899_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1502906_1503311_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631973.1|1503303_1504704_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	32.0	2.5e-55
>prophage 118
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1510714	1513171	2781568	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1510714_1513171_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 119
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1532371	1542643	2781568	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1532371_1533859_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1533911_1534004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613716.1|1534397_1534874_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1534870_1535236_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167924.1|1535213_1536017_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.3	1.3e-21
WP_000057594.1|1536232_1537165_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148594.1|1537343_1538225_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_047928175.1|1538453_1540547_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1540803_1541343_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176728.1|1541347_1542643_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	8.2e-13
>prophage 120
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1551899	1554364	2781568		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1551899_1552865_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_047928174.1|1553011_1554364_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 121
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1560248	1563346	2781568	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051129.1|1560248_1562222_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	1.5e-93
WP_000279926.1|1562506_1563346_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 122
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1567252	1567870	2781568		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1567252_1567870_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 123
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1577043	1578741	2781568		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109047.1|1577043_1578741_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 124
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1595393	1601634	2781568		Lactobacillus_phage(33.33%)	6	NA	NA
WP_047928170.1|1595393_1596398_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	42.2	3.3e-25
WP_031589187.1|1596729_1597572_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467991.1|1597608_1598268_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569289.1|1598271_1599297_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	3.1e-31
WP_001036648.1|1599593_1600736_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634098.1|1600728_1601634_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	3.8e-49
>prophage 125
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1625414	1628190	2781568		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072580.1|1625414_1626641_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.1	4.8e-47
WP_000028670.1|1626633_1628190_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.3	1.4e-288
>prophage 126
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1641415	1644435	2781568		Staphylococcus_phage(33.33%)	3	NA	NA
WP_000212549.1|1641415_1641748_-	hypothetical protein	NA	A0A0N9SJ02	Staphylococcus_phage	54.8	1.7e-10
WP_047928163.1|1642248_1643094_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	40.1	7.7e-52
WP_000800379.1|1643682_1644435_+	S8 family serine peptidase	NA	A0A1W6JND5	Lactococcus_phage	32.2	9.6e-14
>prophage 127
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1649351	1652384	2781568		Hokovirus(50.0%)	2	NA	NA
WP_000424964.1|1649351_1650893_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1650917_1652384_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 128
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1661343	1662867	2781568		Enterococcus_phage(100.0%)	1	NA	NA
WP_047928162.1|1661343_1662867_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	4.2e-40
>prophage 129
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1670336	1678753	2781568	integrase	Staphylococcus_phage(66.67%)	12	1668375:1668389	1674790:1674804
1668375:1668389	attL	TTTAATGCAATAACA	NA	NA	NA	NA
WP_001808003.1|1670336_1670474_+	hypothetical protein	NA	Q4ZE80	Staphylococcus_phage	75.6	2.8e-12
WP_115304765.1|1670572_1670800_+|integrase	tyrosine-type recombinase/integrase	integrase	Q4ZE80	Staphylococcus_phage	66.0	5.1e-11
WP_001817700.1|1670921_1671860_+	Abi family protein	NA	NA	NA	NA	NA
WP_000897044.1|1672125_1672368_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_047928160.1|1672419_1672923_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.1	3.5e-60
WP_001261460.1|1672943_1673240_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052483.1|1673483_1673675_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	4.9e-23
WP_001218732.1|1673760_1674858_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
1674790:1674804	attR	TGTTATTGCATTAAA	NA	NA	NA	NA
WP_000157345.1|1674869_1675073_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_001077602.1|1675102_1675984_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001566903.1|1676140_1676986_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655707.1|1677649_1678753_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	29.0	4.6e-12
>prophage 130
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1688689	1689532	2781568		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209566.1|1688689_1689532_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	7.7e-12
>prophage 131
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1710802	1713537	2781568		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280799.1|1710802_1711825_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_001191945.1|1711802_1712747_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449066.1|1712736_1713537_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.9	1.2e-41
>prophage 132
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1731773	1732451	2781568		Planktothrix_phage(100.0%)	1	NA	NA
WP_086097340.1|1731773_1732451_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 133
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1748121	1752561	2781568		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549287.1|1748121_1752561_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	25.6	6.3e-28
>prophage 134
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1763166	1764828	2781568		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_141060963.1|1763166_1763826_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736783.1|1763877_1764828_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 135
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1774065	1775502	2781568		Pandoravirus(100.0%)	1	NA	NA
WP_000164009.1|1774065_1775502_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.8	2.8e-30
>prophage 136
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1779262	1783801	2781568		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1779262_1781002_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_047928141.1|1781261_1781936_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975345.1|1782079_1783801_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 137
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1793751	1794795	2781568		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645615.1|1793751_1794795_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	25.0	1.2e-14
>prophage 138
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1802009	1803539	2781568		Vibrio_phage(100.0%)	1	NA	NA
WP_000838204.1|1802009_1803539_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	52.0	5.3e-11
>prophage 139
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1812415	1813921	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047928108.1|1812415_1813921_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	2.3e-38
>prophage 140
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1825065	1830424	2781568		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1825065_1827315_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837103.1|1827902_1828871_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127982.1|1828867_1830424_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 141
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1840634	1842694	2781568		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818915.1|1840634_1841732_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166921.1|1842115_1842694_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	40.1	4.3e-14
>prophage 142
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1851228	1854370	2781568		Planktothrix_phage(50.0%)	2	NA	NA
WP_047928087.1|1851228_1852821_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.5e-16
WP_001558793.1|1853692_1854370_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.4	1.6e-20
>prophage 143
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1858285	1858966	2781568		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571406.1|1858285_1858966_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	3.8e-33
>prophage 144
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1875755	1876940	2781568		Klosneuvirus(100.0%)	1	NA	NA
WP_160199387.1|1875755_1876940_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.3	5.9e-34
>prophage 145
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1881774	1892058	2781568		Tupanvirus(50.0%)	3	NA	NA
WP_031590254.1|1881774_1888950_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.2	5.9e-68
WP_047928060.1|1889396_1890647_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706137.1|1891032_1892058_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.9	2.9e-29
>prophage 146
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1895597	1898828	2781568		Bacillus_virus(50.0%)	4	NA	NA
WP_000590844.1|1895597_1896338_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	41.1	2.2e-39
WP_000171919.1|1896679_1897192_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1897370_1897574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013481.1|1897868_1898828_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 147
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1902168	1904653	2781568		Catovirus(50.0%)	2	NA	NA
WP_000723449.1|1902168_1903314_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	26.1	3.2e-24
WP_000779492.1|1903390_1904653_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	3.3e-22
>prophage 148
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1911488	1918053	2781568		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|1911488_1912613_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028286.1|1912616_1913726_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1913738_1914767_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_047928039.1|1914756_1916580_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.1	1.2e-28
WP_000565293.1|1916599_1917364_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037328.1|1917366_1918053_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 149
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1922078	1923254	2781568		Clostridium_phage(100.0%)	1	NA	NA
WP_047928035.1|1922078_1923254_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.1	2.3e-30
>prophage 150
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1928712	1929486	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1928712_1929486_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 151
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1937524	1938124	2781568		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1937524_1938124_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 152
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1943060	1948156	2781568		Catovirus(50.0%)	6	NA	NA
WP_001789408.1|1943060_1944041_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
WP_001789407.1|1944110_1944233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183771.1|1944376_1945153_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414624.1|1945363_1945990_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|1946185_1946950_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_047928032.1|1946953_1948156_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	5.1e-09
>prophage 153
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1956422	1960632	2781568		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1956422_1957403_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1957633_1958626_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000925005.1|1958641_1959637_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136636.1|1959633_1960632_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.5	1.2e-14
>prophage 154
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1991307	1992375	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816127.1|1991307_1992375_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.5	3.5e-09
>prophage 155
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	1999966	2009977	2781568		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|1999966_2000767_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104166.1|2001162_2001951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047928008.1|2001951_2003286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|2003278_2005105_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|2005117_2005819_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_047928004.1|2007015_2008299_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	2.3e-68
WP_000375647.1|2008576_2009977_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 156
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2016667	2025707	2781568	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884326.1|2016667_2017954_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	2.7e-88
WP_000177462.1|2018332_2019847_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.5e-90
WP_000449218.1|2020172_2020985_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_047927991.1|2021072_2023736_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	2.1e-119
WP_031588484.1|2023772_2025707_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	7.4e-143
>prophage 157
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2035789	2042214	2781568		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_000742837.1|2035789_2036629_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491382.1|2036946_2037300_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2037367_2037763_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054118.1|2038022_2038592_+	helix-turn-helix domain-containing protein	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|2038709_2038910_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_000672041.1|2039302_2039494_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_000143651.1|2039585_2041466_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|2041455_2042214_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 158
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2057896	2058910	2781568		Faustovirus(100.0%)	1	NA	NA
WP_000639185.1|2057896_2058910_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.9	9.6e-09
>prophage 159
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2071134	2071827	2781568		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|2071134_2071827_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 160
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2097939	2099799	2781568		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125611.1|2097939_2099799_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 161
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2125496	2127248	2781568		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143426.1|2125496_2126384_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	3.3e-05
WP_000923760.1|2126492_2127248_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 162
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2130668	2131166	2781568		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2130668_2131166_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 163
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2136214	2138598	2781568		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071717.1|2136214_2138065_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.2e-235
WP_000173329.1|2138061_2138598_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.6	1.3e-41
>prophage 164
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2143475	2153588	2781568	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2143475_2145185_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2145462_2145675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708241.1|2145954_2146398_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172340.1|2146591_2148190_+	acetyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_031775001.1|2148249_2148579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2148874_2150371_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031402.1|2150563_2151454_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.6e-07
WP_001807954.1|2151576_2151993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030070.1|2152250_2153588_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	3.0e-18
>prophage 165
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2182387	2186306	2781568		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751276.1|2182387_2183089_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	45.9	4.4e-37
WP_031588406.1|2184494_2186306_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 166
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2194730	2198989	2781568		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001807953.1|2194730_2195729_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	9.1e-36
WP_000076661.1|2195818_2196025_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024129.1|2196580_2198989_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	41.0	2.9e-128
>prophage 167
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2208223	2211259	2781568	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058990.1|2208223_2210329_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.3	1.2e-117
WP_000455986.1|2210737_2211259_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.7	1.2e-26
>prophage 168
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2218606	2224976	2781568		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062652.1|2218606_2220346_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	1.3e-34
WP_000473680.1|2220646_2222713_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206033.1|2223078_2223489_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_047928640.1|2223530_2223875_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228169.1|2224007_2224976_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	5.2e-12
>prophage 169
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2234689	2235682	2781568		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161536.1|2234689_2235682_-	D-lactate dehydrogenase	NA	M1HYB0	Acanthocystis_turfacea_Chlorella_virus	31.5	1.1e-36
>prophage 170
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2244966	2245662	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000382893.1|2244966_2245662_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	38.4	2.3e-38
>prophage 171
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2266534	2274827	2781568		Streptococcus_phage(66.67%)	8	NA	NA
WP_000721335.1|2266534_2267401_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	7.5e-79
WP_000966095.1|2267576_2268770_+	MFS transporter	NA	NA	NA	NA	NA
WP_160199402.1|2268780_2268984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000217714.1|2269091_2269400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678764.1|2269543_2269810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078104177.1|2270093_2271902_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	38.1	1.9e-95
WP_000446878.1|2272019_2273489_+	DNA mismatch repair protein MutH	NA	NA	NA	NA	NA
WP_001033636.1|2273588_2274827_+	DNA cytosine methyltransferase	NA	A0A141E0F9	Streptococcus_phage	29.5	8.4e-31
>prophage 172
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2283525	2284221	2781568		Bacillus_phage(100.0%)	1	NA	NA
WP_031586057.1|2283525_2284221_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	36.5	8.6e-09
>prophage 173
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2289144	2289963	2781568		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824946.1|2289144_2289963_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	28.7	1.0e-08
>prophage 174
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2297892	2299450	2781568		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173866.1|2297892_2298708_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.3	1.8e-13
WP_000590515.1|2298700_2299450_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	8.1e-21
>prophage 175
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2306599	2311028	2781568		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000923524.1|2306599_2307262_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.3	5.5e-21
WP_000072147.1|2307254_2308031_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_047928624.1|2308426_2309614_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700923.1|2309675_2311028_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 176
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2314836	2316063	2781568		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000948981.1|2314836_2316063_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
>prophage 177
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2334420	2340597	2781568		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2334420_2335563_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779360.1|2335820_2336207_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482647.1|2336340_2336448_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064816.1|2337075_2338839_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.9	8.5e-37
WP_000486494.1|2338863_2340597_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 178
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2344058	2349830	2781568		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971547.1|2344058_2345174_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	7.1e-21
WP_160199391.1|2345184_2345877_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200945.1|2345887_2346355_+	QueT transporter family protein	NA	NA	NA	NA	NA
WP_047928619.1|2346406_2347384_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	75.9	9.2e-142
WP_000916704.1|2347385_2348333_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	3.2e-139
WP_000594519.1|2348900_2349830_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 179
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2357654	2358386	2781568		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|2357654_2358386_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 180
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2375033	2376593	2781568		Escherichia_phage(100.0%)	1	NA	NA
WP_000692645.1|2375033_2376593_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 181
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2398127	2399162	2781568		Bacillus_virus(100.0%)	1	NA	NA
WP_000655972.1|2398127_2399162_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 182
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2410727	2414624	2781568		Hokovirus(33.33%)	4	NA	NA
WP_000477332.1|2410727_2412101_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	1.3e-13
WP_000249497.1|2412093_2412768_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761395.1|2412903_2413959_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229920.1|2413958_2414624_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
>prophage 183
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2418363	2419572	2781568		Salmonella_phage(100.0%)	1	NA	NA
WP_031775239.1|2418363_2419572_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	7.9e-34
>prophage 184
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2431662	2432562	2781568		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524830.1|2431662_2432562_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 185
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2439929	2440349	2781568		Bacillus_phage(100.0%)	1	NA	NA
WP_000920238.1|2439929_2440349_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.1	1.0e-36
>prophage 186
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2445982	2446864	2781568		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000730034.1|2445982_2446864_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	45.9	3.8e-62
>prophage 187
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2454742	2455378	2781568		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2454742_2455378_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 188
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2468943	2472912	2781568		Staphylococcus_phage(50.0%)	4	NA	NA
WP_011447058.1|2468943_2469582_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_000684145.1|2469892_2471017_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	1.2e-12
WP_000417015.1|2471096_2472050_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	2.9e-31
WP_000737705.1|2472411_2472912_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 189
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2476829	2477639	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717388.1|2476829_2477639_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.4e-07
>prophage 190
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2496621	2497227	2781568		Pithovirus(100.0%)	1	NA	NA
WP_000913019.1|2496621_2497227_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.6	3.8e-13
>prophage 191
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2509310	2512478	2781568		Leptospira_phage(100.0%)	1	NA	NA
WP_000592305.1|2509310_2512478_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	1.1e-61
>prophage 192
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2536162	2537829	2781568		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389660.1|2536162_2536972_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.7e-19
WP_047928595.1|2536968_2537829_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	1.3e-09
>prophage 193
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2541475	2543140	2781568		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_047928593.1|2541475_2543140_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.8	1.8e-44
>prophage 194
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2548224	2551322	2781568		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001015492.1|2548224_2549073_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.4	1.7e-43
WP_001808034.1|2549292_2549418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000333461.1|2549679_2550288_+	DUF3885 domain-containing protein	NA	NA	NA	NA	NA
WP_025174343.1|2550581_2551322_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 195
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2557643	2559056	2781568		Pandoravirus(100.0%)	1	NA	NA
WP_000169224.1|2557643_2559056_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 196
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2563023	2564586	2781568		Vibrio_phage(100.0%)	1	NA	NA
WP_000792342.1|2563023_2564586_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 197
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2574787	2575756	2781568		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989083.1|2574787_2575756_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.3e-15
>prophage 198
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2591643	2592552	2781568		Klosneuvirus(100.0%)	1	NA	NA
WP_000167871.1|2591643_2592552_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.3	1.4e-27
>prophage 199
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2596142	2603639	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_047928587.1|2596142_2603639_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	24.9	3.1e-19
>prophage 200
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2609895	2612715	2781568		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334463.1|2609895_2611701_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
WP_000908180.1|2611932_2612715_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.7	2.6e-09
>prophage 201
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2623906	2627738	2781568		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2623906_2624350_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2624470_2625181_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083325.1|2625495_2626158_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242319.1|2626436_2627738_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.7	6.1e-133
>prophage 202
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2635678	2637289	2781568		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2635678_2637289_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 203
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2645091	2652841	2781568		Bacillus_virus(25.0%)	9	NA	NA
WP_000273356.1|2645091_2645691_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2645691_2646768_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248735.1|2646754_2647591_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_072362259.1|2647623_2648721_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.6	3.6e-41
WP_000697335.1|2648717_2649140_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654185.1|2649243_2649768_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2649794_2651033_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2651060_2651690_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_047928577.1|2651713_2652841_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.6	1.8e-27
>prophage 204
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2663245	2663641	2781568		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|2663245_2663641_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 205
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2669749	2670397	2781568		Moumouvirus(100.0%)	1	NA	NA
WP_031590210.1|2669749_2670397_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 206
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2677596	2679117	2781568		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2677596_2679117_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 207
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2684788	2686816	2781568		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546584.1|2684788_2686816_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.1	5.6e-24
>prophage 208
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2691966	2695351	2781568		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2691966_2692329_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390829.1|2692678_2693680_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2693798_2694125_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190829.1|2694126_2694606_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041102.1|2694580_2695351_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	1.3e-21
>prophage 209
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2709405	2714129	2781568		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_031588337.1|2709405_2710935_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_020978284.1|2710964_2711984_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2712105_2712360_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047810.1|2712359_2714129_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.1	5.3e-63
>prophage 210
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2717889	2730617	2781568	tRNA	Moraxella_phage(20.0%)	9	NA	NA
WP_000159040.1|2717889_2718915_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.9	5.3e-63
WP_000106313.1|2719343_2720954_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	25.2	6.2e-18
WP_160199403.1|2721908_2723837_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.4	2.4e-53
WP_001283612.1|2724089_2724725_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_072414299.1|2725079_2726108_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581077.1|2726167_2726392_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052270.1|2726600_2727851_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
WP_000790330.1|2728033_2728984_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141414.1|2729132_2730617_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.6	4.0e-19
>prophage 211
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2739845	2755047	2781568	capsid,integrase	Staphylococcus_phage(46.15%)	17	2741805:2741824	2756134:2756153
WP_000917289.1|2739845_2740130_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240642.1|2740205_2741822_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
2741805:2741824	attL	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
WP_031912621.1|2741890_2743063_-|integrase	site-specific integrase	integrase	A0A1W6JQD3	Staphylococcus_phage	94.6	2.0e-212
WP_049949256.1|2743072_2743696_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049949255.1|2743828_2744086_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031912618.1|2744066_2744708_+	Bro-N domain-containing protein	NA	A0A2H4JB17	uncultured_Caudovirales_phage	83.6	1.0e-96
WP_031912617.1|2744721_2745039_+	helix-turn-helix domain-containing protein	NA	A0A1W6JQE0	Staphylococcus_phage	96.2	2.3e-49
WP_031912616.1|2745174_2745399_+	hypothetical protein	NA	A0A1W6JPA6	Staphylococcus_phage	61.8	6.8e-16
WP_001103961.1|2745399_2745699_+	DUF1474 family protein	NA	Q4ZE75	Staphylococcus_phage	66.7	5.9e-31
WP_141060971.1|2745790_2748154_+	DNA primase	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	41.2	2.3e-146
WP_001081424.1|2748574_2748919_+	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	65.2	9.4e-41
WP_047928558.1|2749143_2749350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047928557.1|2749336_2750395_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
WP_049949340.1|2750577_2751066_+	pathogenicity island protein	NA	A0A2H4JB26	uncultured_Caudovirales_phage	41.8	9.3e-26
WP_000801979.1|2751486_2752455_+	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	27.3	5.9e-24
WP_031792985.1|2753611_2754412_+	staphylococcal enterotoxin type B	NA	A0A097PAT7	Streptococcus_pyogenes_phage	45.9	2.3e-53
WP_001035619.1|2754489_2755047_-	DUF4888 domain-containing protein	NA	A0A1W6JQE5	Staphylococcus_phage	74.3	8.6e-68
2756134:2756153	attR	ATGCCAGGAATGATGTAAAA	NA	NA	NA	NA
>prophage 212
NZ_CP047847	Staphylococcus aureus strain UP_522 chromosome, complete genome	2781568	2762003	2781097	2781568	integrase	Staphylococcus_phage(100.0%)	32	2764846:2764860	2773236:2773250
WP_031588767.1|2762003_2763059_+	bi-component leukocidin LukGH subunit H	NA	A0A2I6PDF3	Staphylococcus_phage	32.1	1.3e-35
WP_000595394.1|2763080_2764097_+	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.6	8.7e-26
2764846:2764860	attL	CTATCATTATCGAAT	NA	NA	NA	NA
WP_000857176.1|2765215_2766253_-|integrase	site-specific integrase	integrase	A7TWL3	Staphylococcus_phage	100.0	3.4e-179
WP_000191460.1|2766360_2766975_+	hypothetical protein	NA	A0A2I6PDE9	Staphylococcus_phage	100.0	1.3e-106
WP_001013104.1|2766971_2767118_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	89.6	1.1e-14
WP_000694772.1|2767153_2767336_-	hypothetical protein	NA	A0A2I6PDF8	Staphylococcus_phage	100.0	6.9e-27
WP_001208482.1|2767535_2768306_-	helix-turn-helix domain-containing protein	NA	A0A1P8L6G7	Staphylococcus_phage	100.0	6.2e-141
WP_000338186.1|2768464_2768689_+	DUF739 family protein	NA	A7TW90	Staphylococcus_phage	100.0	4.5e-36
WP_000435341.1|2768706_2768967_+	transcriptional regulator	NA	A7TW91	Staphylococcus_phage	100.0	2.7e-40
WP_000351243.1|2768990_2769530_-	hypothetical protein	NA	A7TW92	Staphylococcus_phage	100.0	1.7e-97
WP_024928163.1|2769586_2770339_+	oxidoreductase	NA	G4KNN1	Staphylococcus_phage	99.2	3.3e-139
WP_000939496.1|2770582_2770723_+	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	100.0	1.9e-16
WP_000275058.1|2770737_2771370_-	hypothetical protein	NA	A7TW95	Staphylococcus_phage	100.0	1.5e-113
WP_001120197.1|2771428_2771749_+	DUF771 domain-containing protein	NA	A0A2I6PDH6	Staphylococcus_phage	100.0	1.5e-56
WP_000066020.1|2771745_2771907_+	DUF1270 domain-containing protein	NA	A0A2I6PDF7	Staphylococcus_phage	100.0	1.9e-20
WP_047928555.1|2771999_2772260_+	DUF1108 family protein	NA	A0A2I6PDH1	Staphylococcus_phage	98.8	2.9e-42
WP_001205732.1|2772268_2772532_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700557.1|2772540_2774484_+	AAA family ATPase	NA	A0A2I6PDH3	Staphylococcus_phage	98.0	0.0e+00
2773236:2773250	attR	ATTCGATAATGATAG	NA	NA	NA	NA
WP_000138475.1|2774485_2775406_+	recombinase	NA	A0A2I6PDH5	Staphylococcus_phage	100.0	2.3e-166
WP_072399433.1|2775534_2776104_+	MBL fold metallo-hydrolase	NA	S4SWA4	Staphylococcus_phage	100.0	8.4e-87
WP_000934770.1|2776104_2776575_+	single-stranded DNA-binding protein	NA	A0A0E3T9H6	Staphylococcus_phage	99.4	4.8e-80
WP_000148301.1|2776604_2777489_+	DnaD domain protein	NA	S4V6D4	Staphylococcus_phage	95.9	3.1e-136
WP_000338528.1|2777495_2777714_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401964.1|2777722_2778127_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0E3XBN4	Staphylococcus_phage	100.0	1.4e-72
WP_031929144.1|2778139_2778511_+	phage protein	NA	A0A2I6PDG3	Staphylococcus_phage	92.7	9.8e-52
WP_001126836.1|2778511_2778760_+	hypothetical protein	NA	A0A2I6PDI0	Staphylococcus_phage	100.0	3.2e-43
WP_000982708.1|2778824_2779274_+	hypothetical protein	NA	A0A2I6PDH2	Staphylococcus_phage	100.0	9.3e-81
WP_001105620.1|2779270_2779555_+	hypothetical protein	NA	A0A2I6PDI3	Staphylococcus_phage	100.0	9.4e-47
WP_000370292.1|2779547_2779802_+	DUF1024 family protein	NA	A0A2I6PDI5	Staphylococcus_phage	100.0	6.5e-39
WP_000265042.1|2779921_2780122_+	DUF1514 domain-containing protein	NA	A0A2I6PDJ9	Staphylococcus_phage	100.0	1.4e-28
WP_000590124.1|2780149_2780566_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	99.3	3.7e-76
WP_000988332.1|2780797_2781097_+	HNH endonuclease	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
