The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	0	25609	2823088	portal,holin,tail,capsid,protease,terminase,head	Staphylococcus_phage(100.0%)	28	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154559.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268740.1|6484_7129_+|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_000504566.1|8039_12569_+|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	97.0	0.0e+00
WP_000567396.1|12565_14050_+|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	99.8	4.5e-297
WP_000582152.1|14065_17848_+	hypothetical protein	NA	A0A068A201	Staphylococcus_phage	99.6	0.0e+00
WP_001000058.1|17840_17993_+	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
WP_001262621.1|18038_18326_+	hypothetical protein	NA	A0A1X9H0N7	Staphylococcus_phage	100.0	7.6e-44
WP_000340977.1|18381_18756_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_000034846.1|19167_19950_+	staphylococcal enterotoxin type P	NA	A0A075M4C7	Staphylococcus_phage	99.6	1.6e-149
WP_011447039.1|20152_20329_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_031762631.1|20381_20489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|20540_20795_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861026.1|20806_21562_+	CHAP domain-containing protein	NA	A0A075LZV3	Staphylococcus_phage	100.0	1.2e-152
WP_000920042.1|21752_22244_+	staphylokinase	NA	A0A075LYD3	Staphylococcus_phage	100.0	8.0e-86
WP_000727645.1|23319_23769_-	chemotaxis-inhibiting protein CHIPS	NA	A0A075LZI2	Staphylococcus_phage	100.0	8.7e-79
WP_000702262.1|24451_24802_+	complement inhibitor SCIN-A	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|24854_25115_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|25429_25609_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
>prophage 2
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	31218	33665	2823088		Staphylococcus_phage(100.0%)	3	NA	NA
WP_160195515.1|31218_32115_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
WP_000645727.1|32115_32796_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_160195516.1|32792_33665_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.0e-27
>prophage 3
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	39428	39830	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|39428_39830_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 4
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	44026	46053	2823088		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|44026_44587_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275727.1|44955_46053_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	3.3e-47
>prophage 5
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	50083	52367	2823088		Bacillus_virus(100.0%)	2	NA	NA
WP_000284436.1|50083_51553_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	5.9e-108
WP_000040866.1|51545_52367_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 6
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	56068	62835	2823088		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|56068_57364_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|57472_57775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272056.1|57946_58639_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|58635_60828_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774556.1|60831_62835_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.2	1.2e-114
>prophage 7
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	70009	75038	2823088		Catovirus(33.33%)	5	NA	NA
WP_001231451.1|70009_70957_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
WP_001147865.1|71037_72399_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.6	1.4e-103
WP_000548781.1|72568_73099_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140172.1|73345_74416_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|74483_75038_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 8
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	78490	78904	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001557448.1|78490_78904_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.3	6.7e-17
>prophage 9
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	83958	84588	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|83958_84588_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 10
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	100068	101805	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|100068_101805_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 11
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	115042	223593	2823088	tRNA,protease,transposase	Staphylococcus_phage(92.73%)	101	NA	NA
WP_001557163.1|115042_116362_-|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
WP_000063582.1|116945_118007_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_000649908.1|118264_119722_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001144055.1|119708_120437_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
WP_001793998.1|120572_121715_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000181394.1|121719_122190_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_001251224.1|122348_122948_+	glucosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000031108.1|122972_123125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901023.1|123672_124068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116228.1|124263_125649_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000669376.1|126101_126923_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000437969.1|127085_128198_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_001045135.1|128219_128843_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000375864.1|129198_129663_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000992518.1|129841_130966_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000290301.1|131034_131379_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
WP_001802255.1|131917_132016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000238227.1|132306_133503_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_160195517.1|133492_136429_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001244175.1|136425_137367_+	3'-5' exoribonuclease YhaM	NA	NA	NA	NA	NA
WP_000782121.1|137487_138450_-	foldase	NA	NA	NA	NA	NA
WP_000477959.1|138654_139212_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000648118.1|139946_140312_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_000004981.1|140453_140876_-	HIT family protein	NA	NA	NA	NA	NA
WP_000216874.1|141009_141750_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
WP_000551836.1|141742_142966_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000737976.1|143089_143593_-	signal transduction protein TraP	NA	NA	NA	NA	NA
WP_001790154.1|143755_143866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233526.1|143855_144893_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_000162881.1|144950_145874_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000167542.1|145897_147298_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_000132890.1|147620_148175_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_010922839.1|149534_150317_+	staphylococcal enterotoxin type O	NA	A0A1X9H080	Staphylococcus_phage	36.7	1.1e-31
WP_000821658.1|150597_151317_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
WP_000713847.1|151351_152080_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
WP_001236362.1|153043_153799_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	41.4	6.0e-40
WP_000736709.1|154081_154858_+	staphylococcal enterotoxin type G	NA	NA	NA	NA	NA
WP_000848318.1|155409_156186_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000617704.1|156206_156443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253432.1|156520_157015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206343.1|157848_158637_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	98.5	3.6e-144
WP_000473596.1|159999_160935_+	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
WP_000782463.1|160936_161920_+	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.4	1.8e-185
WP_000543854.1|162289_163081_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000550252.1|163085_163559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000469591.1|163814_164033_+	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	80.6	2.0e-25
WP_001092780.1|164505_165087_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.8	9.6e-54
WP_001039427.1|166050_166758_+|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
WP_001039454.1|166882_167605_+|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
WP_001038872.1|167662_168382_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	98.7	1.3e-129
WP_001038704.1|168502_169222_+|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
WP_011447030.1|169170_169278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038752.1|169379_170099_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	99.6	1.9e-131
WP_001791797.1|170161_170296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001793440.1|170276_172016_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
WP_000072627.1|172008_173238_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	4.0e-134
WP_001792025.1|174313_174415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001801861.1|174537_174633_-	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_000414216.1|175987_176560_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
WP_000627540.1|176660_177002_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
WP_000669024.1|177042_177669_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.8	3.1e-74
WP_000070642.1|177743_178739_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.9	2.6e-67
WP_001795210.1|178819_179470_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	94.0	2.9e-51
WP_012840523.1|179772_180228_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
WP_000348364.1|180386_181865_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
WP_000778528.1|181869_182871_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.3	5.3e-185
WP_000718107.1|182867_183125_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672013.1|183190_183664_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
WP_001822900.1|183668_184415_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
WP_000109906.1|184792_186385_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933820.1|186756_187953_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366163.1|188074_188983_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000453306.1|189194_190028_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
WP_000623470.1|192024_192378_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
WP_001200542.1|192374_192740_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091442.1|192995_193298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|193557_194271_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168903.1|194710_195346_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001030469.1|195641_196085_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
WP_001153742.1|196071_196515_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671057.1|196627_197098_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
WP_000384171.1|197296_197521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|197796_198651_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989121.1|198737_200030_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_000221177.1|200029_200344_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_001261668.1|200866_202369_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
WP_000384185.1|202861_203893_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
WP_000493887.1|203899_204532_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
WP_001159037.1|204542_205724_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
WP_001008549.1|205736_206201_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
WP_001196362.1|206322_207324_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
WP_001790712.1|207434_207554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266096.1|207556_208384_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|208955_209357_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764419.1|209479_210043_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000526539.1|210039_210993_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025067.1|211102_212284_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
WP_001108730.1|212574_214989_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
WP_000836461.1|215010_215322_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
WP_160195518.1|215647_222208_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	98.2	2.3e-305
WP_000285020.1|222324_223593_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
>prophage 12
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	234998	240326	2823088		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|234998_235856_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048368.1|235884_236481_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118314.1|236501_240326_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 13
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	249066	250773	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862096.1|249066_250773_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.6	8.0e-274
>prophage 14
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	257377	260008	2823088	tRNA,protease	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|257377_258640_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279338.1|258733_260008_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 15
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	263777	267910	2823088		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808849.1|263777_265382_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291420.1|265368_266526_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553924.1|266640_267087_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174280.1|267166_267910_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.0	4.9e-18
>prophage 16
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	285502	288700	2823088		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226918.1|285502_288700_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.5	7.2e-135
>prophage 17
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	293633	295391	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232648.1|293633_295391_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 18
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	300275	308439	2823088		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080028.1|300275_300980_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_015445861.1|300979_302641_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849428.1|303139_304627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038317.1|304920_307551_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114454.1|307566_308439_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 19
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	312354	323507	2823088	tRNA,protease	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|312354_313275_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_001790562.1|313367_313490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|313687_315625_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049145.1|316050_317544_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|317772_318300_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|318328_318529_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|318575_318932_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|319073_319682_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_001280022.1|319700_320630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|320634_320745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127573.1|320792_322094_+	trigger factor	NA	NA	NA	NA	NA
WP_000472302.1|322244_323507_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 20
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	333074	339721	2823088	tRNA,transposase	Catovirus(50.0%)	5	NA	NA
WP_000425353.1|333074_335705_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	3.7e-153
WP_001108346.1|335717_336989_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000261115.1|337258_337966_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000692869.1|337962_338517_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000868132.1|338635_339721_+|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
>prophage 21
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	343052	343784	2823088		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|343052_343784_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 22
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	352351	387964	2823088	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005768.1|352351_353356_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|353357_354383_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|354405_355545_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|355563_355824_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749795.1|356098_358378_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000595011.1|358580_360854_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.1e-64
WP_000364542.1|360875_361394_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058587.1|361821_364011_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869983.1|364022_364475_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|364471_365347_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|365807_367070_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|367085_368852_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001790559.1|369184_369313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|369312_370086_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102726.1|370246_371521_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.5	3.1e-105
WP_000704122.1|371605_372028_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|372127_372310_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|372349_372496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985878.1|372732_373746_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409157.1|374057_375200_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.8	5.4e-32
WP_000066097.1|375200_376319_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567017.1|377013_377682_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283312.1|377683_380161_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000734075.1|380503_383134_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|383196_383457_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|383460_383889_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|383903_384212_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342258.1|384496_385135_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	3.2e-10
WP_000137772.1|385137_386061_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|386072_387341_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|387340_387964_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 23
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	394636	395857	2823088		Lactococcus_phage(100.0%)	1	NA	NA
WP_000542320.1|394636_395857_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.3	2.2e-52
>prophage 24
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	404643	410807	2823088		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|404643_405105_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953309.1|405163_407311_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.6e-32
WP_001282563.1|407367_408342_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|408386_408638_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|408983_410807_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 25
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	414302	417410	2823088		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|414302_416135_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119021.1|416270_417410_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 26
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	423880	424828	2823088		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|423880_424828_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 27
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	427881	441627	2823088	tRNA	Klosneuvirus(28.57%)	13	NA	NA
WP_001030080.1|427881_429273_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001797828.1|429607_430231_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|430241_431060_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217257.1|431120_432938_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.3	7.9e-54
WP_001283055.1|433161_434268_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624577.1|434398_435076_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683940.1|435078_436179_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_001062177.1|436292_437639_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924220.1|437648_438539_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
WP_001213908.1|438664_439450_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564315.1|439491_440355_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|440341_440752_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|441027_441627_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 28
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	447800	448424	2823088		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|447800_448424_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 29
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	453968	456780	2823088		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019691.1|453968_455315_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.2	1.7e-61
WP_000202188.1|455307_456780_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 30
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	464280	470851	2823088		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|464280_465618_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|465610_465841_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183383.1|465818_466700_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	2.0e-10
WP_001124985.1|467131_467584_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942210.1|467599_469279_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291533.1|469429_470851_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	5.1e-40
>prophage 31
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	477680	479087	2823088		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|477680_479087_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 32
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	485513	486998	2823088		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|485513_486998_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 33
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	490525	502135	2823088		Klosneuvirus(16.67%)	12	NA	NA
WP_001171335.1|490525_491434_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	32.0	4.4e-05
WP_000365240.1|491515_492058_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000392691.1|492162_492612_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000447733.1|492660_493548_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183429.1|493625_494132_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273371.1|494223_494955_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
WP_000368656.1|494947_495490_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|495482_496220_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|496352_497078_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987774.1|497058_498810_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.2	2.2e-21
WP_001557355.1|499053_499980_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001033761.1|499972_502135_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	100.0	2.7e-109
>prophage 34
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	506563	509242	2823088		Bacillus_phage(50.0%)	3	NA	NA
WP_001151997.1|506563_506812_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163801.1|506919_507873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902099.1|507862_509242_+	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	33.6	1.4e-55
>prophage 35
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	518666	524133	2823088		Bacillus_phage(25.0%)	7	NA	NA
WP_001043863.1|518666_518939_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|519369_519942_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774684.1|519944_520670_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001817755.1|520686_521631_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|521722_522172_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|522380_522581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269921.1|522966_524133_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	31.8	5.8e-34
>prophage 36
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	527795	528371	2823088		Bacillus_virus(100.0%)	1	NA	NA
WP_000005212.1|527795_528371_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
>prophage 37
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	531743	539249	2823088	tRNA	unidentified_phage(25.0%)	5	NA	NA
WP_000361540.1|531743_532946_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	4.2e-35
WP_000049921.1|532932_533904_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525078.1|533927_536621_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858779.1|536942_538235_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.3	8.7e-55
WP_000362218.1|538562_539249_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
>prophage 38
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	542989	543616	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_001108889.1|542989_543616_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 39
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	552941	553820	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|552941_553820_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 40
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	592771	602161	2823088		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|592771_593476_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|593720_593915_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000691942.1|593926_594178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404645.1|594215_595340_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995287.1|595355_595793_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934894.1|596216_597173_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|597372_597852_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166059.1|597866_598706_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
WP_000159903.1|598791_599325_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|599317_599746_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473653.1|599757_600258_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|600257_600479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342132.1|600670_602161_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	2.9e-22
>prophage 41
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	605571	607583	2823088		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|605571_606231_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166801.1|606227_607583_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 42
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	613748	614540	2823088		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|613748_614540_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 43
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	618080	623111	2823088	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|618080_619217_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001788788.1|619248_619878_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|619896_620166_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|620328_620637_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|620807_621008_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|621204_621606_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216946.1|621845_623111_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
>prophage 44
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	631158	632760	2823088		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|631158_632760_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 45
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	637849	641303	2823088		Indivirus(50.0%)	3	NA	NA
WP_000079447.1|637849_638701_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
WP_000974847.1|638707_639349_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077571.1|639488_641303_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.1	5.1e-154
>prophage 46
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	644717	645419	2823088		Tupanvirus(100.0%)	1	NA	NA
WP_000571259.1|644717_645419_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.0e-13
>prophage 47
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	653515	655870	2823088		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000153613.1|653515_654298_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.9	2.7e-27
WP_000173833.1|654299_655298_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	8.5e-34
WP_000604816.1|655303_655870_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 48
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	660188	661451	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|660188_661451_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 49
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	671110	675504	2823088		Bacillus_phage(50.0%)	2	NA	NA
WP_001289546.1|671110_673513_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.4	1.8e-93
WP_031771138.1|673512_675504_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 50
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	681495	683142	2823088		Vibrio_phage(100.0%)	1	NA	NA
WP_001088978.1|681495_683142_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 51
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	686811	687933	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691301.1|686811_687933_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 52
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	692083	697739	2823088		Phage_Wrath(25.0%)	7	NA	NA
WP_001208755.1|692083_692707_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	5.9e-17
WP_000380730.1|693086_693950_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	9.1e-16
WP_001791425.1|694023_694128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688122.1|694124_695102_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085655.1|695258_695528_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|695981_696131_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000082539.1|696221_697739_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 53
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	707877	712153	2823088		Bacillus_phage(50.0%)	6	NA	NA
WP_000841346.1|707877_708411_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|708549_708738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|708850_709453_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670307.1|709449_710541_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603970.1|710544_711276_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593436.1|711244_712153_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	3.1e-22
>prophage 54
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	716537	720841	2823088	head	Staphylococcus_phage(80.0%)	8	NA	NA
WP_000899334.1|716537_716774_-|head	phage head morphogenesis protein	head	Q4ZE35	Staphylococcus_virus	70.6	2.3e-22
WP_000956747.1|716819_717071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477492.1|717198_717303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|717813_717999_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_001788716.1|718422_718533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002340.1|719232_719439_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
WP_001795785.1|719732_719957_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	5.0e-19
WP_001791958.1|720643_720841_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.1e-09
>prophage 55
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	725910	726387	2823088		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|725910_726387_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 56
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	732329	738811	2823088		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103743.1|732329_733148_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|733622_734165_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516269.1|734170_736180_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.8e-60
WP_000073352.1|736192_738811_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
>prophage 57
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	748225	749269	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|748225_749269_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 58
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	753467	759008	2823088		Bacillus_virus(33.33%)	4	NA	NA
WP_160195521.1|753467_754754_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.4	7.9e-16
WP_000089941.1|754753_756019_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293306.1|756049_756763_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001811366.1|756767_759008_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 59
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	764148	775961	2823088	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864190.1|764148_765120_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282298.1|765134_766052_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|766220_766571_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043635.1|766956_769074_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020853.1|769078_769396_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|769392_769677_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097460.1|769697_770873_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036633.1|770893_771361_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001801936.1|771650_775961_-	DNA polymerase III subunit alpha	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 60
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	780234	781005	2823088		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473699.1|780234_781005_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 61
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	785784	799458	2823088	tRNA,protease	Erwinia_phage(16.67%)	10	NA	NA
WP_000379054.1|785784_787188_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	4.9e-27
WP_000072681.1|787253_787799_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015601.1|787795_788692_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	3.6e-31
WP_000195254.1|789109_790417_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|790572_792648_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000672869.1|793868_795113_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041666.1|795140_796259_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110253.1|796485_797394_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|797415_798582_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176393.1|798690_799458_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 62
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	812842	815092	2823088		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|812842_813574_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|813689_813923_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|814357_815092_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 63
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	825462	827457	2823088		Moumouvirus(100.0%)	1	NA	NA
WP_000579563.1|825462_827457_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 64
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	830604	831540	2823088	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|830604_831540_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 65
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	836552	838809	2823088		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|836552_837752_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|837967_838186_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368226.1|838185_838809_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	1.0e-21
>prophage 66
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	842123	842735	2823088		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|842123_842735_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 67
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	846702	851313	2823088		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|846702_847803_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_000767028.1|847804_849079_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|849096_849978_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|850005_851313_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 68
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	855777	858531	2823088	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384691.1|855777_858531_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 69
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	878114	878303	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245796.1|878114_878303_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	2.5e-19
>prophage 70
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	887319	889279	2823088		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001802045.1|887319_887544_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765708.1|887500_887647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857488.1|888319_889279_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
>prophage 71
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	904909	909467	2823088		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|904909_905224_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249272.1|905396_907745_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	3.2e-15
WP_000161938.1|907754_909467_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 72
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	914469	915528	2823088	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|914469_915528_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 73
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	927474	930382	2823088		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|927474_927957_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263796.1|927958_928501_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|928570_928960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|928962_929217_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757575.1|929455_930382_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	2.2e-12
>prophage 74
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	941899	943747	2823088		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182653.1|941899_943747_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 75
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	951879	960713	2823088		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|951879_952974_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020625.1|952987_953527_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455597.1|953670_953946_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|954113_955520_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863439.1|955523_956816_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|956906_957884_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|957887_959000_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668336.1|959170_959797_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957037.1|960161_960713_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.0	1.6e-13
>prophage 76
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	966725	971105	2823088		Bacillus_virus(50.0%)	5	NA	NA
WP_001289618.1|966725_966959_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_000040051.1|967195_968914_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|968916_969183_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505966.1|969336_969879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685067.1|969932_971105_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
>prophage 77
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	974536	989298	2823088		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921965.1|974536_975937_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273253.1|975929_976736_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101899.1|977002_978250_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709277.1|978271_979750_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_000238669.1|979764_980331_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
WP_000030811.1|980333_981362_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
WP_000483720.1|981354_982839_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
WP_000032740.1|982817_985007_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
WP_000666806.1|984999_985671_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848350.1|985672_985936_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174053.1|985935_986640_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_001010413.1|986643_987768_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861573.1|987754_988237_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225836.1|988437_989298_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	4.4e-39
>prophage 78
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	999752	1003499	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074534.1|999752_1003499_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 79
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1007165	1080365	2823088	portal,integrase,plate,holin,tail,protease,capsid,terminase,head,bacteriocin	Staphylococcus_phage(80.6%)	92	1032736:1032762	1077494:1077520
WP_000676537.1|1007165_1008176_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.2e-16
WP_001089094.1|1008257_1009439_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284458.1|1009476_1009806_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184945.1|1010043_1010865_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150197.1|1010857_1011661_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526694.1|1011647_1013321_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_001816819.1|1013307_1014519_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_001791731.1|1014595_1014700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000070966.1|1014850_1015789_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620949.1|1015840_1016392_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001788574.1|1016481_1016772_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
WP_001790177.1|1016835_1016967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081351.1|1017012_1017972_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766008.1|1018459_1018816_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001792054.1|1018904_1019042_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_001795266.1|1019182_1019473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571167.1|1019560_1020202_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-19
WP_000668627.1|1020198_1020519_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870829.1|1020521_1022486_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001797239.1|1022529_1022802_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001792055.1|1022811_1022913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033865.1|1023828_1024431_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000214898.1|1024445_1024622_-	YkvS family protein	NA	NA	NA	NA	NA
WP_000668818.1|1024820_1025807_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000876826.1|1025887_1026106_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000287265.1|1026315_1026885_+	competence protein ComK	NA	NA	NA	NA	NA
WP_000414165.1|1027371_1028883_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000021865.1|1029021_1030380_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_001795272.1|1030396_1032721_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
1032736:1032762	attL	TATCATTATGACACATTAACACCTAAT	NA	NA	NA	NA
WP_000930266.1|1033281_1034736_-	CHAP domain-containing protein	NA	I1W626	Staphylococcus_phage	98.8	1.2e-286
WP_000339144.1|1034746_1035049_-|holin	phage holin	holin	B7T0L0	Staphylococcus_virus	100.0	4.1e-48
WP_000466784.1|1035184_1035484_-	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000916020.1|1035529_1035694_-	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_001166599.1|1035686_1036076_-	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000067138.1|1036075_1037542_-|plate	BppU family phage baseplate upper protein	plate	A0A2I6PDE3	Staphylococcus_phage	98.2	9.3e-271
WP_000429552.1|1037541_1039452_-	hypothetical protein	NA	A0A2K9VBU3	Staphylococcus_phage	100.0	0.0e+00
WP_000179860.1|1039467_1039758_-	hypothetical protein	NA	A0A2I6PF46	Staphylococcus_phage	100.0	2.1e-49
WP_000384466.1|1039757_1041341_-	peptidase	NA	Q4ZD01	Staphylococcus_virus	98.7	1.3e-305
WP_001190533.1|1041349_1042174_-|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_001003432.1|1042173_1048374_-|tail	phage tail tape measure protein	tail	A0A2K9VBQ5	Staphylococcus_phage	99.7	0.0e+00
WP_000438833.1|1048387_1048546_-	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_000589167.1|1048587_1048938_-	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000169127.1|1048995_1049451_-	Ig domain-containing protein	NA	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
WP_000807536.1|1049542_1050184_-|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_001023806.1|1050218_1050614_-	DUF3168 domain-containing protein	NA	A0A2I6PEQ4	Staphylococcus_phage	100.0	8.8e-67
WP_000110023.1|1050614_1051016_-	hypothetical protein	NA	A0A2I6PF54	Staphylococcus_phage	100.0	8.1e-68
WP_000395498.1|1051012_1051345_-	hypothetical protein	NA	A0A2I6PES3	Staphylococcus_phage	100.0	4.1e-57
WP_000050973.1|1051356_1051635_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_001142734.1|1051703_1052867_-|capsid	phage major capsid protein	capsid	A0A2I6PEQ3	Staphylococcus_phage	100.0	1.2e-217
WP_000061866.1|1052878_1053652_-|protease	Clp protease ClpP	protease	A0A2I6PEQ7	Staphylococcus_phage	100.0	2.4e-137
WP_001100668.1|1053635_1054874_-|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	99.8	1.2e-234
WP_000152859.1|1054878_1056570_-|terminase	terminase large subunit	terminase	A0A2I6PE99	Staphylococcus_phage	99.6	0.0e+00
WP_000778935.1|1056559_1056865_-|terminase	P27 family phage terminase small subunit	terminase	U5U414	Staphylococcus_phage	100.0	2.9e-49
WP_000166257.1|1056990_1057311_-	HNH endonuclease	NA	A0A2K9VBV6	Staphylococcus_phage	86.8	4.6e-50
WP_000528515.1|1057471_1057909_-	transcriptional regulator	NA	Q4ZCF5	Staphylococcus_virus	99.3	3.6e-77
WP_078055707.1|1057921_1059298_-	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	99.3	7.4e-262
WP_000665205.1|1059278_1059569_-	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
WP_015978074.1|1059702_1059807_+	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	2.7e-12
WP_000884882.1|1059909_1062357_-	hypothetical protein	NA	A0A2I6PEP4	Staphylococcus_phage	99.0	0.0e+00
WP_000265252.1|1062644_1062845_-	DUF1514 domain-containing protein	NA	A0A2I6PEP5	Staphylococcus_phage	100.0	4.9e-26
WP_000595263.1|1062912_1063065_-	transcriptional activator RinB	NA	A0A2I6PEM5	Staphylococcus_phage	100.0	2.0e-19
WP_000664554.1|1063112_1063637_-	hypothetical protein	NA	A0A0K1LKF9	Staphylococcus_phage	88.5	4.7e-84
WP_000195773.1|1063636_1063831_-	DUF1381 domain-containing protein	NA	A1KX86	Staphylococcus_virus	84.4	7.9e-21
WP_001209217.1|1063847_1064021_-	hypothetical protein	NA	A0A2I6PEA8	Staphylococcus_phage	100.0	3.6e-25
WP_000185699.1|1064057_1064594_-	hypothetical protein	NA	A0A1P8L6E0	Staphylococcus_phage	99.4	1.4e-94
WP_001065025.1|1064586_1064835_-	DUF1024 family protein	NA	C8CH04	Staphylococcus_phage	96.3	5.9e-37
WP_000144705.1|1064827_1065136_-	hypothetical protein	NA	Q4ZBK6	Staphylococcus_phage	97.1	9.9e-50
WP_000979209.1|1065132_1065480_-	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
WP_000695756.1|1065476_1065881_-	hypothetical protein	NA	A0A0E3T8H9	Staphylococcus_phage	100.0	4.2e-72
WP_000693989.1|1065883_1066090_-	hypothetical protein	NA	A0A2K9VBT9	Staphylococcus_phage	100.0	3.0e-34
WP_078055706.1|1066103_1066352_-	hypothetical protein	NA	Q8SDR2	Staphylococcus_virus	93.9	1.8e-38
WP_000022732.1|1066351_1066606_-	DUF3310 domain-containing protein	NA	A0A059T7J9	Staphylococcus_phage	100.0	2.8e-42
WP_001164629.1|1067010_1067196_-	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_078055713.1|1067208_1069161_-	DNA polymerase	NA	B7T0G8	Staphylococcus_virus	98.9	0.0e+00
WP_000645049.1|1069229_1069787_-	DUF2815 family protein	NA	A0A2K9VBT2	Staphylococcus_phage	95.7	1.3e-92
WP_000762536.1|1069812_1070979_-	DUF2800 domain-containing protein	NA	A0A0K1LKE3	Staphylococcus_phage	99.5	4.5e-220
WP_000279447.1|1070975_1071338_-	hypothetical protein	NA	A0A0K1LKE9	Staphylococcus_phage	95.8	1.7e-53
WP_000291505.1|1071351_1071612_-	DUF1108 family protein	NA	A0EWW8	Staphylococcus_phage	94.2	8.4e-42
WP_001817285.1|1071651_1071912_-	DUF2482 family protein	NA	A0A0H3U2W4	Staphylococcus_phage	98.8	1.3e-39
WP_000072842.1|1072004_1072166_-	DUF1270 family protein	NA	A0A059T7J6	Staphylococcus_phage	94.3	3.6e-19
WP_001124198.1|1072177_1072441_-	helix-turn-helix domain-containing protein	NA	A0A2I6PEL8	Staphylococcus_phage	100.0	2.5e-46
WP_001036299.1|1072465_1072681_-	hypothetical protein	NA	A0A2I6PEK7	Staphylococcus_phage	100.0	1.0e-32
WP_001548903.1|1072727_1072967_+	hypothetical protein	NA	A0A2I6PE22	Staphylococcus_phage	100.0	6.7e-38
WP_001115060.1|1073223_1073415_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PEL6	Staphylococcus_phage	100.0	2.3e-28
WP_000429766.1|1073575_1073905_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PEN2	Staphylococcus_phage	100.0	3.2e-54
WP_000524996.1|1073917_1074379_+	hypothetical protein	NA	A0A2I6PEK4	Staphylococcus_phage	98.0	4.9e-85
WP_000755720.1|1074396_1074831_+	hypothetical protein	NA	A0A2I6PEM0	Staphylococcus_phage	93.1	7.5e-19
WP_000449605.1|1074859_1075255_+	hypothetical protein	NA	I1W601	Staphylococcus_phage	99.2	3.2e-69
WP_001166481.1|1075453_1076077_-	hypothetical protein	NA	B7T0F3	Staphylococcus_virus	99.5	1.3e-104
WP_000264194.1|1076203_1077409_+|integrase	site-specific integrase	integrase	B7T0F2	Staphylococcus_virus	100.0	4.2e-221
WP_000928413.1|1077697_1078501_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
1077494:1077520	attR	TATCATTATGACACATTAACACCTAAT	NA	NA	NA	NA
WP_001049950.1|1078802_1080365_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
>prophage 80
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1099297	1101106	2823088		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1099297_1101106_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 81
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1106918	1108888	2823088		Bacillus_virus(100.0%)	2	NA	NA
WP_000427767.1|1106918_1107899_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.3e-15
WP_001067052.1|1107901_1108888_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	1.4e-15
>prophage 82
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1112539	1114553	2823088		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786734.1|1112539_1113481_-	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
WP_000140050.1|1113470_1114553_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 83
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1123144	1129954	2823088		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1123144_1124290_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047069.1|1124399_1125269_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353954.1|1125327_1127937_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044230.1|1128139_1129954_-	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	6.7e-37
>prophage 84
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1135073	1138727	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_000154921.1|1135073_1138727_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.5	2.0e-24
>prophage 85
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1148881	1156062	2823088		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185319.1|1148881_1149811_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
WP_000138487.1|1150337_1151582_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167309.1|1151690_1152881_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.0e-33
WP_000838029.1|1153188_1154316_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1154676_1155054_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035063.1|1155468_1156062_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 86
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1165982	1169610	2823088		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009692.1|1165982_1167458_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	4.5e-47
WP_000046076.1|1167588_1168797_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143495.1|1169250_1169610_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.7e-14
>prophage 87
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1173653	1176322	2823088		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1173653_1174868_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129659.1|1174864_1176322_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.5	2.6e-39
>prophage 88
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1191097	1194620	2823088		environmental_halophage(50.0%)	3	NA	NA
WP_000807663.1|1191097_1192339_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
WP_000205567.1|1192453_1193761_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1193858_1194620_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 89
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1198107	1199133	2823088		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571213.1|1198107_1199133_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
>prophage 90
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1202449	1207627	2823088		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1202449_1202806_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147952.1|1202949_1203270_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1203420_1203960_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150011.1|1204042_1204759_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.1	1.5e-16
WP_000974460.1|1204906_1205329_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1205727_1206222_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255551.1|1206376_1206994_+	amino acid transporter	NA	NA	NA	NA	NA
WP_001802951.1|1207066_1207627_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.4	3.8e-31
>prophage 91
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1211027	1212271	2823088		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1211027_1211228_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_000141557.1|1211584_1212271_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	1.7e-33
>prophage 92
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1221351	1230228	2823088		Staphylococcus_phage(50.0%)	9	NA	NA
WP_000757397.1|1221351_1222080_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	37.5	1.3e-18
WP_001057759.1|1222271_1222418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058299.1|1222433_1222757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001085183.1|1224078_1224543_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	98.7	1.6e-80
WP_001050048.1|1224564_1226937_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	4.3e-92
WP_001165959.1|1226970_1227711_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_000556760.1|1227826_1228060_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1228126_1228585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1228923_1230228_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 93
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1239455	1245386	2823088		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1239455_1240043_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1240606_1241551_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1241661_1242657_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369722.1|1242653_1243565_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1244450_1245386_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 94
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1249833	1252680	2823088		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662677.1|1249833_1252680_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 95
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1255998	1256838	2823088		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000753319.1|1255998_1256838_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 96
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1262916	1268622	2823088		Streptococcus_phage(66.67%)	5	NA	NA
WP_001557172.1|1262916_1263999_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	9.9e-44
WP_000686344.1|1264362_1265229_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192949.1|1265372_1266014_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
WP_000258150.1|1266178_1267234_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1267551_1268622_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 97
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1279421	1302838	2823088		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616840.1|1279421_1280183_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
WP_001245577.1|1280179_1281136_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|1281122_1282094_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|1282132_1282288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1282468_1283440_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855514.1|1283557_1285663_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1285625_1286024_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068501.1|1286824_1287691_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1287710_1288211_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1288551_1290057_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031760357.1|1290134_1290236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429006.1|1290326_1291244_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.1e-07
WP_000197262.1|1292066_1292609_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663030.1|1292947_1294006_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
WP_000180991.1|1294245_1295760_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589248.1|1295752_1296730_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	7.1e-25
WP_000983677.1|1296951_1298733_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525106.1|1298744_1300628_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
WP_000098285.1|1300897_1302838_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 98
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1305977	1315824	2823088		Pandoravirus(12.5%)	12	NA	NA
WP_001217796.1|1305977_1307129_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.7	6.0e-23
WP_000604514.1|1307112_1307706_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_000446724.1|1308056_1308725_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1308726_1309146_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|1309149_1309863_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000604990.1|1309961_1310546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093562.1|1310825_1311266_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1311608_1312082_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1312056_1312743_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244415.1|1312742_1313798_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702781.1|1313869_1314853_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	1.5e-62
WP_000931238.1|1314984_1315824_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.5	9.6e-55
>prophage 99
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1327436	1328810	2823088		Megavirus(100.0%)	1	NA	NA
WP_000952041.1|1327436_1328810_-	deoxyribodipyrimidine photo-lyase	NA	K7Y8W8	Megavirus	31.6	2.8e-43
>prophage 100
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1333787	1340067	2823088		Bacillus_phage(33.33%)	6	NA	NA
WP_000857598.1|1333787_1335461_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.2	3.4e-11
WP_000737160.1|1335457_1337089_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	6.7e-12
WP_000469894.1|1337307_1338183_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1338354_1339038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148826.1|1339040_1339499_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820897.1|1339500_1340067_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	4.7e-21
>prophage 101
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1346857	1347331	2823088		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|1346857_1347331_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 102
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1352593	1353391	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|1352593_1353391_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 103
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1358215	1358977	2823088		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1358215_1358977_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 104
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1363351	1364395	2823088		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001030772.1|1363351_1364395_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 105
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1370918	1371716	2823088		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1370918_1371716_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 106
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1374941	1378900	2823088		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1374941_1376669_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793067.1|1377089_1378385_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1378501_1378900_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 107
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1385834	1386578	2823088		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1385834_1386578_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 108
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1399116	1399677	2823088	integrase	Streptococcus_phage(100.0%)	1	1393270:1393284	1403267:1403281
1393270:1393284	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|1399116_1399677_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|1399116_1399677_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
1403267:1403281	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 109
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1412505	1415859	2823088		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1412505_1413516_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001792725.1|1414014_1414536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180234.1|1414563_1415859_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 110
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1423431	1424754	2823088		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860592.1|1423431_1424754_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	2.6e-107
>prophage 111
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1436058	1436715	2823088		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1436058_1436715_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 112
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1440356	1443677	2823088		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100835.1|1440356_1441733_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
WP_000347061.1|1442276_1443677_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 113
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1466965	1467628	2823088		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1466965_1467628_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 114
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1474211	1475399	2823088		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|1474211_1475399_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 115
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1478427	1489381	2823088		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1478427_1480509_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1480631_1481102_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1481167_1481581_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1481678_1481933_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|1482069_1485666_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1485829_1489381_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 116
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1493064	1497847	2823088	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1493064_1493613_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1493625_1493808_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1493863_1494007_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872882.1|1494121_1494691_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664737.1|1494771_1495296_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1495295_1496042_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1496049_1496454_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631969.1|1496446_1497847_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.8	1.2e-54
>prophage 117
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1503858	1506315	2823088	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1503858_1506315_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 118
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1525120	1535391	2823088	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1525120_1526608_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1526660_1526753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613722.1|1527146_1527623_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1527619_1527985_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_160195529.1|1527962_1528766_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	3.0e-21
WP_000057594.1|1528981_1529914_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148598.1|1530092_1530974_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1531201_1533295_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1533551_1534091_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176709.1|1534095_1535391_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	4.8e-13
>prophage 119
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1544647	1547112	2823088		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1544647_1545613_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252543.1|1545759_1547112_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 120
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1553017	1556115	2823088	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051136.1|1553017_1554991_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.0	3.2e-93
WP_000279926.1|1555275_1556115_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 121
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1560021	1560639	2823088		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1560021_1560639_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 122
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1569778	1571476	2823088		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109040.1|1569778_1571476_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 123
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1588124	1594363	2823088		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170264.1|1588124_1589129_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.2	1.6e-24
WP_000825530.1|1589460_1590303_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467994.1|1590339_1590999_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569281.1|1591002_1592028_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	3.7e-32
WP_001036648.1|1592322_1593465_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634098.1|1593457_1594363_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	3.8e-49
>prophage 124
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1620309	1623069	2823088		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072584.1|1620309_1621521_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.2	2.2e-44
WP_031770049.1|1621524_1623069_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	97.9	1.8e-285
>prophage 125
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1635606	1641055	2823088	transposase	Paenibacillus_phage(25.0%)	5	NA	NA
WP_000159787.1|1635606_1635879_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	50.6	1.3e-13
WP_000041880.1|1636277_1636982_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	37.1	5.8e-29
WP_000551643.1|1637373_1637910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424963.1|1638022_1639564_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1639588_1641055_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 126
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1650015	1651539	2823088		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930514.1|1650015_1651539_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.4e-40
>prophage 127
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1659853	1666182	2823088		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000934799.1|1659853_1660357_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1660377_1660674_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052484.1|1660917_1661109_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	1.1e-22
WP_001218732.1|1661194_1662292_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1662303_1662507_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373073.1|1662536_1663418_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001557587.1|1663571_1664417_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655692.1|1665078_1666182_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 128
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1676120	1676963	2823088		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209551.1|1676120_1676963_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	3.8e-11
>prophage 129
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1698272	1701007	2823088		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280799.1|1698272_1699295_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_001191954.1|1699272_1700217_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_160195530.1|1700206_1701007_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.4	5.8e-41
>prophage 130
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1719246	1719924	2823088		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911017.1|1719246_1719924_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 131
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1735594	1740034	2823088		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549287.1|1735594_1740034_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	25.6	6.3e-28
>prophage 132
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1750639	1752301	2823088		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570070.1|1750639_1751299_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736784.1|1751350_1752301_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 133
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1761099	1762536	2823088		Pandoravirus(100.0%)	1	NA	NA
WP_000164003.1|1761099_1762536_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.1e-29
>prophage 134
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1766296	1770835	2823088		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1766296_1768036_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_000608818.1|1768295_1768970_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975351.1|1769113_1770835_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 135
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1780162	1781206	2823088		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645608.1|1780162_1781206_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	3.5e-14
>prophage 136
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1788420	1789950	2823088		Vibrio_phage(100.0%)	1	NA	NA
WP_000838205.1|1788420_1789950_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	4.5e-10
>prophage 137
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1798825	1800331	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008400.1|1798825_1800331_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 138
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1811357	1816716	2823088		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1811357_1813607_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837116.1|1814194_1815163_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127990.1|1815159_1816716_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 139
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1826926	1828986	2823088		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818915.1|1826926_1828024_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166920.1|1828407_1828986_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	39.1	9.7e-14
>prophage 140
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1837535	1840723	2823088		Planktothrix_phage(33.33%)	3	NA	NA
WP_000067352.1|1837535_1839128_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	4.1e-22
WP_000794565.1|1839637_1839835_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	43.3	2.1e-05
WP_000960712.1|1840000_1840723_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	4.1e-22
>prophage 141
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1844594	1845275	2823088		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571407.1|1844594_1845275_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	2.9e-33
>prophage 142
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1862080	1863265	2823088		Klosneuvirus(100.0%)	1	NA	NA
WP_001084442.1|1862080_1863265_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	2.0e-34
>prophage 143
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1868101	1878385	2823088		Tupanvirus(50.0%)	3	NA	NA
WP_000605281.1|1868101_1875277_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.7	4.5e-68
WP_000826861.1|1875723_1876974_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706135.1|1877359_1878385_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.5	8.5e-29
>prophage 144
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1881920	1885150	2823088		Bacillus_virus(50.0%)	4	NA	NA
WP_000590855.1|1881920_1882661_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	2.5e-38
WP_000171919.1|1883002_1883515_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1883693_1883897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013485.1|1884190_1885150_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 145
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1888491	1890976	2823088		Catovirus(50.0%)	2	NA	NA
WP_000723436.1|1888491_1889637_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	25.9	4.6e-23
WP_000779504.1|1889713_1890976_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	4.3e-22
>prophage 146
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1897811	1904376	2823088		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|1897811_1898936_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028283.1|1898939_1900049_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1900061_1901090_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940790.1|1901079_1902903_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	5.2e-29
WP_000565304.1|1902922_1903687_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037332.1|1903689_1904376_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 147
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1908396	1909572	2823088		Clostridium_phage(100.0%)	1	NA	NA
WP_000469833.1|1908396_1909572_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.6	2.0e-29
>prophage 148
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1915011	1915785	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1915011_1915785_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 149
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1923816	1924416	2823088		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1923816_1924416_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 150
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1929353	1934450	2823088		Catovirus(50.0%)	6	NA	NA
WP_001793242.1|1929353_1930334_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
WP_001789407.1|1930403_1930526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183771.1|1930669_1931446_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414629.1|1931657_1932284_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|1932479_1933244_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223713.1|1933247_1934450_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	3.9e-09
>prophage 151
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1942716	1946926	2823088		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1942716_1943697_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1943927_1944920_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000924990.1|1944935_1945931_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136633.1|1945927_1946926_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.8	5.2e-15
>prophage 152
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1980009	1981074	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816133.1|1980009_1981074_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.8	7.7e-09
>prophage 153
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	1991762	1998416	2823088		Streptococcus_phage(50.0%)	4	NA	NA
WP_000852430.1|1991762_1993784_-	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	29.0	6.6e-41
WP_000029431.1|1993802_1995479_-	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
WP_000631574.1|1995499_1995580_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000446429.1|1995746_1998416_+	sensor histidine kinase KdpD	NA	A0A2K9L0Z8	Tupanvirus	21.5	6.0e-10
>prophage 154
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2006198	2012530	2823088	transposase	Bacillus_phage(66.67%)	7	NA	NA
WP_000815646.1|2006198_2007548_+	recombinase family protein	NA	Q9T200	Bacillus_phage	25.1	1.4e-18
WP_001186602.1|2007569_2009198_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	31.4	2.4e-46
WP_000859155.1|2009715_2010066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700853.1|2010152_2010464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092169.1|2010481_2010988_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_000659050.1|2011008_2011326_+	RadC family protein	NA	NA	NA	NA	NA
WP_000868132.1|2011444_2012530_+|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
>prophage 155
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2015861	2016593	2823088		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|2015861_2016593_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 156
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2029142	2029817	2823088	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001106057.1|2029142_2029817_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
>prophage 157
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2035472	2045482	2823088		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2035472_2036273_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104165.1|2036661_2037450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060140.1|2037450_2038785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|2038777_2040604_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|2040616_2041318_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2042520_2043804_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2044081_2045482_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 158
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2052172	2061218	2823088	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884332.1|2052172_2053459_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	4.5e-88
WP_000177465.1|2053837_2055352_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.2e-90
WP_000449218.1|2055677_2056490_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819067.1|2056577_2059247_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	4.6e-119
WP_000255578.1|2059283_2061218_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
>prophage 159
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2071318	2077875	2823088		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_000742837.1|2071318_2072158_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491382.1|2072608_2072962_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2073029_2073425_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054128.1|2073684_2074254_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|2074371_2074572_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_000672033.1|2074963_2075155_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_000143647.1|2075246_2077127_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|2077116_2077875_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 160
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2092128	2093841	2823088		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138654.1|2092128_2093841_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 161
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2099469	2100483	2823088		Faustovirus(100.0%)	1	NA	NA
WP_000639184.1|2099469_2100483_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.9	9.6e-09
>prophage 162
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2112823	2113516	2823088		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|2112823_2113516_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 163
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2139614	2141474	2823088		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125628.1|2139614_2141474_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 164
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2167157	2168908	2823088		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143425.1|2167157_2168045_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	2.5e-05
WP_000923760.1|2168152_2168908_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 165
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2172328	2172826	2823088		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2172328_2172826_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 166
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2177820	2180204	2823088		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071729.1|2177820_2179671_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	9.3e-236
WP_000173331.1|2179667_2180204_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.0	3.9e-41
>prophage 167
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2185082	2195196	2823088	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2185082_2186792_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2187069_2187282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028775.1|2187561_2188005_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172341.1|2188198_2189797_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_001791980.1|2189856_2190186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2190481_2191978_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031409.1|2192171_2193062_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237629.1|2193184_2193601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030072.1|2193858_2195196_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.0e-18
>prophage 168
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2225529	2229318	2823088		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751263.1|2225529_2226231_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	5.2e-38
WP_000379821.1|2227506_2229318_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 169
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2237752	2241867	2823088		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161369.1|2237752_2238751_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	1.0e-34
WP_000076661.1|2238841_2239048_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024139.1|2239458_2241867_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	3.2e-127
>prophage 170
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2251108	2254144	2823088	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058993.1|2251108_2253214_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
WP_000455988.1|2253622_2254144_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
>prophage 171
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2260570	2266954	2823088		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062663.1|2260570_2262310_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473679.1|2262610_2264677_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206031.1|2265056_2265467_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2265508_2265865_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228167.1|2265985_2266954_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	4.0e-12
>prophage 172
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2276243	2277236	2823088		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161545.1|2276243_2277236_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	3.7e-37
>prophage 173
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2286514	2287210	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000538625.1|2286514_2287210_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	3.0e-38
>prophage 174
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2305960	2306827	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_000721336.1|2305960_2306827_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	1.3e-78
>prophage 175
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2315012	2320208	2823088		Streptococcus_phage(50.0%)	3	NA	NA
WP_075339662.1|2315012_2316821_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.3	6.6e-93
WP_000755946.1|2316952_2317345_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000088733.1|2317346_2320208_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	3.1e-28
>prophage 176
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2328050	2328746	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_000217456.1|2328050_2328746_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	35.6	4.3e-08
>prophage 177
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2333300	2334119	2823088		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824948.1|2333300_2334119_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	27.2	1.3e-08
>prophage 178
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2342171	2343729	2823088		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173871.1|2342171_2342987_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	8.8e-13
WP_000598772.1|2342979_2343729_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	9.0e-20
>prophage 179
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2351000	2355429	2823088		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000923526.1|2351000_2351663_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.8	5.5e-21
WP_000072149.1|2351655_2352432_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026189.1|2352827_2354015_+	DHA family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000700925.1|2354076_2355429_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 180
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2358823	2360682	2823088		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948974.1|2358823_2360050_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|2360046_2360682_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 181
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2378409	2384671	2823088		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2378409_2379552_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779360.1|2379819_2380206_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482652.1|2380339_2380447_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_160195536.1|2381149_2382913_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	1.1e-31
WP_000486487.1|2382937_2384671_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 182
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2388132	2393903	2823088		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971550.1|2388132_2389248_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	1.6e-20
WP_000286875.1|2389258_2389951_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200956.1|2389961_2390429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783428.1|2390480_2391458_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916704.1|2391459_2392407_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	3.2e-139
WP_000594519.1|2392973_2393903_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 183
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2401960	2402692	2823088		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|2401960_2402692_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 184
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2419341	2420901	2823088		Escherichia_phage(100.0%)	1	NA	NA
WP_000692648.1|2419341_2420901_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 185
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2442229	2443264	2823088		Bacillus_virus(100.0%)	1	NA	NA
WP_000655971.1|2442229_2443264_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 186
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2454629	2458526	2823088		Hokovirus(33.33%)	4	NA	NA
WP_000477338.1|2454629_2456003_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	2.3e-13
WP_000249497.1|2455995_2456670_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761395.1|2456805_2457861_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229920.1|2457860_2458526_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
>prophage 187
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2462262	2463471	2823088		Salmonella_phage(100.0%)	1	NA	NA
WP_000999131.1|2462262_2463471_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	3.9e-33
>prophage 188
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2475561	2476461	2823088		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524830.1|2475561_2476461_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 189
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2483833	2484253	2823088		Bacillus_phage(100.0%)	1	NA	NA
WP_000920239.1|2483833_2484253_-	FosB1/FosB3 family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	2.6e-37
>prophage 190
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2489945	2490827	2823088		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000235289.1|2489945_2490827_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	3.8e-62
>prophage 191
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2498705	2499341	2823088		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2498705_2499341_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 192
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2512284	2516264	2823088		Staphylococcus_phage(50.0%)	4	NA	NA
WP_011447058.1|2512284_2512923_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_000684147.1|2513233_2514358_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	9.3e-13
WP_000417018.1|2514449_2515403_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	6.4e-31
WP_000737705.1|2515763_2516264_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 193
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2520181	2520985	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717381.1|2520181_2520985_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.3e-07
>prophage 194
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2539965	2540571	2823088		Pithovirus(100.0%)	1	NA	NA
WP_000913024.1|2539965_2540571_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.1	4.3e-12
>prophage 195
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2552541	2555709	2823088		Leptospira_phage(100.0%)	1	NA	NA
WP_000592307.1|2552541_2555709_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	1.1e-61
>prophage 196
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2579392	2581059	2823088		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389658.1|2579392_2580202_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.7e-19
WP_000155387.1|2580198_2581059_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	9.7e-10
>prophage 197
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2589840	2597496	2823088		Enterobacteria_phage(33.33%)	8	NA	NA
WP_000411031.1|2589840_2590857_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.7	1.0e-18
WP_000655241.1|2591430_2591613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001835417.1|2591584_2591809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130149.1|2592106_2593771_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	8.0e-45
WP_000186134.1|2593807_2594512_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769705.1|2594895_2595321_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044362.1|2595615_2596431_+	hydrolase	NA	NA	NA	NA	NA
WP_001044441.1|2596641_2597496_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	37.9	4.9e-06
>prophage 198
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2600878	2603188	2823088		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001015500.1|2600878_2601727_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
WP_000875476.1|2601959_2602163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791678.1|2602249_2602411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557494.1|2602447_2603188_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 199
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2616404	2617967	2823088		Vibrio_phage(100.0%)	1	NA	NA
WP_000792342.1|2616404_2617967_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 200
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2628169	2629138	2823088		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2628169_2629138_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 201
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2646590	2647499	2823088		Klosneuvirus(100.0%)	1	NA	NA
WP_000167867.1|2646590_2647499_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 202
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2651090	2658536	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001048259.1|2651090_2658536_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	31.5	3.9e-22
>prophage 203
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2664792	2667612	2823088		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334463.1|2664792_2666598_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
WP_000908182.1|2666829_2667612_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.3e-09
>prophage 204
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2678792	2682623	2823088		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2678792_2679236_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2679356_2680067_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083318.1|2680380_2681043_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242311.1|2681321_2682623_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	3.6e-133
>prophage 205
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2690563	2692174	2823088		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2690563_2692174_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 206
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2699977	2707727	2823088		Bacillus_virus(25.0%)	9	NA	NA
WP_000273358.1|2699977_2700577_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2700577_2701654_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248732.1|2701640_2702477_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_015445903.1|2702509_2703607_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.3	2.3e-40
WP_000697334.1|2703603_2704023_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654184.1|2704129_2704654_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2704680_2705919_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2705946_2706576_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723418.1|2706599_2707727_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 207
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2718131	2718527	2823088		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|2718131_2718527_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 208
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2724798	2725446	2823088		Moumouvirus(100.0%)	1	NA	NA
WP_001187630.1|2724798_2725446_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 209
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2732646	2734167	2823088		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2732646_2734167_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 210
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2741357	2743385	2823088		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546611.1|2741357_2743385_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	2.3e-25
>prophage 211
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2748534	2751918	2823088		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_160195537.1|2748534_2748897_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	2.5e-07
WP_000390827.1|2749245_2750247_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2750365_2750692_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190829.1|2750693_2751173_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041111.1|2751147_2751918_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	2.2e-21
>prophage 212
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2766036	2770760	2823088		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094583.1|2766036_2767566_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_072399972.1|2767595_2768615_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2768736_2768991_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_160195538.1|2768990_2770760_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.6	7.0e-63
>prophage 213
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2774520	2788580	2823088	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159042.1|2774520_2775546_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.6	3.4e-62
WP_000106332.1|2775860_2777471_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	28.1	1.9e-19
WP_001792272.1|2777559_2777688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602057.1|2777831_2779760_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	30.2	9.3e-53
WP_001283612.1|2780012_2780648_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_072414299.1|2781002_2782031_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581076.1|2782090_2782315_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052270.1|2782522_2783773_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
WP_000790331.1|2783955_2784906_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141432.1|2785054_2786539_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	26.5	2.3e-19
WP_001253312.1|2786535_2787495_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|2787863_2788580_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 214
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2795761	2797738	2823088		uncultured_virus(100.0%)	2	NA	NA
WP_000917289.1|2795761_2796046_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240655.1|2796121_2797738_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
>prophage 215
NZ_CP047867	Staphylococcus aureus strain UP_419 chromosome, complete genome	2823088	2801687	2822618	2823088	integrase	Staphylococcus_phage(97.22%)	38	2804530:2804544	2814233:2814247
WP_000791411.1|2801687_2802743_+	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
WP_000595392.1|2802764_2803781_+	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.2	6.7e-26
2804530:2804544	attL	CTATCATTATCGAAT	NA	NA	NA	NA
WP_000857180.1|2804899_2805937_-|integrase	site-specific integrase	integrase	Q38086	Staphylococcus_phage	98.6	1.4e-175
WP_000427213.1|2805999_2806242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001558608.1|2806252_2807236_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000694772.1|2807335_2807518_-	hypothetical protein	NA	A0A2I6PDF8	Staphylococcus_phage	100.0	6.9e-27
WP_000591749.1|2807721_2808063_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000759682.1|2808068_2809001_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|2809016_2809730_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_000854072.1|2809863_2810127_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
WP_001025404.1|2810142_2810358_+	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
WP_000128909.1|2810346_2810676_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	98.2	5.1e-52
WP_001148605.1|2810726_2811479_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_001148856.1|2811494_2811692_+	hypothetical protein	NA	O80075	Staphylococcus_phage	100.0	2.5e-30
WP_000762521.1|2811678_2812059_-	DUF2513 domain-containing protein	NA	Q9T1Z5	Staphylococcus_phage	100.0	1.2e-68
WP_001120201.1|2812113_2812437_+	DUF771 domain-containing protein	NA	A0A075LYF5	Staphylococcus_phage	100.0	3.0e-57
WP_000048129.1|2812433_2812595_+	DUF1270 family protein	NA	A0A1P8L6G0	Staphylococcus_phage	100.0	1.9e-20
WP_000165371.1|2812689_2812992_+	DUF2482 family protein	NA	A0A1P8L6F8	Staphylococcus_phage	100.0	7.0e-48
WP_000291510.1|2812996_2813257_+	DUF1108 family protein	NA	A0A1P8L6F5	Staphylococcus_phage	100.0	5.2e-44
WP_001205732.1|2813265_2813529_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_160195539.1|2813537_2815481_+	AAA family ATPase	NA	A0A1P8L6F1	Staphylococcus_phage	99.8	0.0e+00
2814233:2814247	attR	ATTCGATAATGATAG	NA	NA	NA	NA
WP_000180600.1|2815482_2816403_+	recombinase RecT	NA	A0A1P8L6F6	Staphylococcus_phage	100.0	5.1e-166
WP_064135358.1|2816483_2817101_+	MBL fold metallo-hydrolase	NA	A0A1P8L6F7	Staphylococcus_phage	100.0	1.2e-86
WP_000934759.1|2817101_2817572_+	single-stranded DNA-binding protein	NA	A0A1P8L6D9	Staphylococcus_phage	100.0	5.7e-81
WP_000148333.1|2817601_2818495_+	DnaD domain-containing protein	NA	A0A1P8L6F0	Staphylococcus_phage	100.0	3.2e-141
WP_000338528.1|2818501_2818720_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401969.1|2818728_2819133_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A075M042	Staphylococcus_phage	100.0	8.4e-73
WP_000101279.1|2819145_2819517_+	hypothetical protein	NA	A0A2I6PDG3	Staphylococcus_phage	91.1	1.4e-50
WP_000111491.1|2819516_2819774_+	DUF3310 domain-containing protein	NA	A0A1X9H067	Staphylococcus_phage	98.8	6.3e-42
WP_000178987.1|2819770_2820019_+	hypothetical protein	NA	A0A0K1LL46	Staphylococcus_phage	96.3	7.5e-40
WP_001065108.1|2820033_2820279_+	DUF1024 family protein	NA	Q8SDV5	Staphylococcus_phage	95.1	1.7e-36
WP_000185693.1|2820275_2820812_+	hypothetical protein	NA	Q9MBR0	Staphylococcus_prophage	100.0	1.6e-95
WP_001282077.1|2820848_2821094_+	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	98.8	2.5e-35
WP_000195784.1|2821090_2821297_+	DUF1381 domain-containing protein	NA	A0A2I6PEA2	Staphylococcus_phage	94.1	1.1e-17
WP_000595265.1|2821293_2821443_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_001557462.1|2821442_2821643_+	DUF1514 domain-containing protein	NA	D2JLD9	Staphylococcus_phage	98.5	5.3e-28
WP_000590122.1|2821670_2822087_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988332.1|2822318_2822618_+	HNH endonuclease	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
