The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	0	25608	2870548	head,protease,tail,holin,capsid,terminase,portal	Staphylococcus_phage(100.0%)	28	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154559.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268740.1|6484_7129_+|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_000504566.1|8039_12569_+|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	97.0	0.0e+00
WP_000567396.1|12565_14050_+|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	99.8	4.5e-297
WP_000582152.1|14065_17848_+	hypothetical protein	NA	A0A068A201	Staphylococcus_phage	99.6	0.0e+00
WP_001000058.1|17840_17993_+	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
WP_001262621.1|18038_18326_+	hypothetical protein	NA	A0A1X9H0N7	Staphylococcus_phage	100.0	7.6e-44
WP_000340977.1|18381_18756_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_029729062.1|19193_19949_+	staphylococcal enterotoxin type P	NA	A0A075M4C7	Staphylococcus_phage	99.6	6.9e-145
WP_011447039.1|20151_20328_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_031762631.1|20380_20488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|20539_20794_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861026.1|20805_21561_+	CHAP domain-containing protein	NA	A0A075LZV3	Staphylococcus_phage	100.0	1.2e-152
WP_000920042.1|21751_22243_+	staphylokinase	NA	A0A075LYD3	Staphylococcus_phage	100.0	8.0e-86
WP_000727645.1|23318_23768_-	chemotaxis-inhibiting protein CHIPS	NA	A0A075LZI2	Staphylococcus_phage	100.0	8.7e-79
WP_000702262.1|24450_24801_+	complement inhibitor SCIN-A	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|24853_25114_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|25428_25608_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
>prophage 2
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	31217	33664	2870548		Staphylococcus_phage(100.0%)	3	NA	NA
WP_000991306.1|31217_32114_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
WP_000645727.1|32114_32795_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763043.1|32791_33664_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.0e-27
>prophage 3
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	39427	39829	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|39427_39829_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 4
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	44025	46052	2870548		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|44025_44586_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275727.1|44954_46052_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	3.3e-47
>prophage 5
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	50082	52366	2870548		Bacillus_virus(100.0%)	2	NA	NA
WP_000284436.1|50082_51552_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	5.9e-108
WP_000040866.1|51544_52366_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 6
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	56067	62834	2870548		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|56067_57363_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|57471_57774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272056.1|57945_58638_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|58634_60827_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774556.1|60830_62834_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.2	1.2e-114
>prophage 7
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	70008	75037	2870548		Catovirus(33.33%)	5	NA	NA
WP_001231451.1|70008_70956_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
WP_001147865.1|71036_72398_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.6	1.4e-103
WP_000548781.1|72567_73098_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140172.1|73344_74415_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|74482_75037_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 8
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	78489	78903	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001557448.1|78489_78903_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.3	6.7e-17
>prophage 9
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	83957	84587	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|83957_84587_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 10
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	100067	101804	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|100067_101804_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 11
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	115041	223591	2870548	protease,transposase,tRNA	Staphylococcus_phage(92.73%)	101	NA	NA
WP_001557163.1|115041_116361_-|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
WP_000063582.1|116944_118006_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_000649908.1|118263_119721_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001144055.1|119707_120436_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
WP_001793998.1|120571_121714_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000181394.1|121718_122189_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_001251224.1|122347_122947_+	glucosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000031108.1|122971_123124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901023.1|123671_124067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116228.1|124262_125648_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000669376.1|126100_126922_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000437969.1|127084_128197_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_001045135.1|128218_128842_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000375864.1|129197_129662_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000992518.1|129840_130965_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000290301.1|131033_131378_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
WP_001802255.1|131916_132015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000238227.1|132305_133502_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_000584630.1|133491_136428_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001244175.1|136424_137366_+	3'-5' exoribonuclease YhaM	NA	NA	NA	NA	NA
WP_000782121.1|137486_138449_-	foldase	NA	NA	NA	NA	NA
WP_000477959.1|138653_139211_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000648118.1|139945_140311_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_000004981.1|140452_140875_-	HIT family protein	NA	NA	NA	NA	NA
WP_000216874.1|141008_141749_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
WP_000551836.1|141741_142965_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000737976.1|143088_143592_-	signal transduction protein TraP	NA	NA	NA	NA	NA
WP_001790154.1|143754_143865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233526.1|143854_144892_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_000162881.1|144949_145873_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000167542.1|145896_147297_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_000132890.1|147619_148174_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_010922839.1|149533_150316_+	staphylococcal enterotoxin type O	NA	A0A1X9H080	Staphylococcus_phage	36.7	1.1e-31
WP_000821658.1|150596_151316_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
WP_000713847.1|151350_152079_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
WP_001236362.1|153042_153798_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	41.4	6.0e-40
WP_000736709.1|154080_154857_+	staphylococcal enterotoxin type G	NA	NA	NA	NA	NA
WP_000848318.1|155408_156185_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000617704.1|156205_156442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253432.1|156519_157014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206343.1|157847_158636_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	98.5	3.6e-144
WP_000878802.1|160012_160933_+	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	2.3e-174
WP_000782463.1|160934_161918_+	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.4	1.8e-185
WP_000543854.1|162287_163079_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000550252.1|163083_163557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000469591.1|163812_164031_+	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	80.6	2.0e-25
WP_001092780.1|164503_165085_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.8	9.6e-54
WP_001039427.1|166048_166756_+|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
WP_001039454.1|166880_167603_+|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
WP_001038872.1|167660_168380_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	98.7	1.3e-129
WP_001038704.1|168500_169220_+|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
WP_011447030.1|169168_169276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038752.1|169377_170097_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	99.6	1.9e-131
WP_001791797.1|170159_170294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001793440.1|170274_172014_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
WP_000072627.1|172006_173236_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	4.0e-134
WP_001792025.1|174311_174413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001801861.1|174535_174631_-	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_000414216.1|175985_176558_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
WP_000627540.1|176658_177000_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
WP_000669024.1|177040_177667_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.8	3.1e-74
WP_000070642.1|177741_178737_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.9	2.6e-67
WP_001795210.1|178817_179468_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	94.0	2.9e-51
WP_012840523.1|179770_180226_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
WP_000348364.1|180384_181863_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
WP_000778528.1|181867_182869_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.3	5.3e-185
WP_000718107.1|182865_183123_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672013.1|183188_183662_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
WP_001822900.1|183666_184413_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
WP_000109906.1|184790_186383_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933820.1|186754_187951_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366163.1|188072_188981_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000453306.1|189192_190026_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
WP_000623470.1|192022_192376_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
WP_001200542.1|192372_192738_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091442.1|192993_193296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|193555_194269_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168903.1|194708_195344_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001030469.1|195639_196083_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
WP_001153742.1|196069_196513_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671057.1|196625_197096_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
WP_000384171.1|197294_197519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|197794_198649_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989121.1|198735_200028_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_000221177.1|200027_200342_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_001261668.1|200864_202367_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
WP_000384185.1|202859_203891_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
WP_000493887.1|203897_204530_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
WP_001159037.1|204540_205722_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
WP_001008549.1|205734_206199_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
WP_001196362.1|206320_207322_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
WP_001790712.1|207432_207552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266096.1|207554_208382_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|208953_209355_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764419.1|209477_210041_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000526539.1|210037_210991_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025067.1|211100_212282_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
WP_001108730.1|212572_214987_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
WP_000836461.1|215008_215320_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
WP_001050574.1|215645_222206_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	98.2	2.3e-305
WP_000285020.1|222322_223591_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
>prophage 12
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	234996	240324	2870548		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|234996_235854_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048368.1|235882_236479_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118314.1|236499_240324_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 13
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	249064	250771	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862096.1|249064_250771_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.6	8.0e-274
>prophage 14
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	257375	260006	2870548	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|257375_258638_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279338.1|258731_260006_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 15
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	263775	267908	2870548		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808849.1|263775_265380_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291420.1|265366_266524_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553924.1|266638_267085_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174280.1|267164_267908_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.0	4.9e-18
>prophage 16
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	285500	288698	2870548		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226918.1|285500_288698_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.5	7.2e-135
>prophage 17
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	293631	295389	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232648.1|293631_295389_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 18
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	300273	308437	2870548		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080028.1|300273_300978_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_015445861.1|300977_302639_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849428.1|303137_304625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038317.1|304918_307549_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114454.1|307564_308437_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 19
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	312352	323505	2870548	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|312352_313273_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_001790562.1|313365_313488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|313685_315623_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049145.1|316048_317542_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|317770_318298_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|318326_318527_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|318573_318930_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|319071_319680_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_001280022.1|319698_320628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|320632_320743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127573.1|320790_322092_+	trigger factor	NA	NA	NA	NA	NA
WP_000472302.1|322242_323505_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 20
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	333072	339719	2870548	transposase,tRNA	Catovirus(50.0%)	5	NA	NA
WP_000425353.1|333072_335703_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	3.7e-153
WP_001108346.1|335715_336987_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000261115.1|337256_337964_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000692869.1|337960_338515_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000868132.1|338633_339719_+|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
>prophage 21
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	343050	343782	2870548		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|343050_343782_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 22
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	352349	387962	2870548	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005768.1|352349_353354_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|353355_354381_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|354403_355543_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|355561_355822_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749795.1|356096_358376_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000595011.1|358578_360852_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.1e-64
WP_000364542.1|360873_361392_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058587.1|361819_364009_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869983.1|364020_364473_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|364469_365345_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|365805_367068_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|367083_368850_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001790559.1|369182_369311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|369310_370084_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102726.1|370244_371519_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.5	3.1e-105
WP_000704122.1|371603_372026_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|372125_372308_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|372347_372494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985878.1|372730_373744_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409157.1|374055_375198_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.8	5.4e-32
WP_000066097.1|375198_376317_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567017.1|377011_377680_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283312.1|377681_380159_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000734075.1|380501_383132_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|383194_383455_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|383458_383887_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|383901_384210_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342258.1|384494_385133_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	3.2e-10
WP_000137772.1|385135_386059_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|386070_387339_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|387338_387962_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 23
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	394634	395855	2870548		Lactococcus_phage(100.0%)	1	NA	NA
WP_000542320.1|394634_395855_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.3	2.2e-52
>prophage 24
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	404641	410805	2870548		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|404641_405103_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953309.1|405161_407309_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.6e-32
WP_001282563.1|407365_408340_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|408384_408636_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|408981_410805_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 25
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	414299	417407	2870548		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|414299_416132_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119021.1|416267_417407_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 26
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	423877	424825	2870548		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|423877_424825_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 27
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	427878	441624	2870548	tRNA	Klosneuvirus(28.57%)	13	NA	NA
WP_001030080.1|427878_429270_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001797828.1|429604_430228_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|430238_431057_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217257.1|431117_432935_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.3	7.9e-54
WP_001283055.1|433158_434265_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624577.1|434395_435073_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683940.1|435075_436176_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_001062177.1|436289_437636_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924220.1|437645_438536_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
WP_001213908.1|438661_439447_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564315.1|439488_440352_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|440338_440749_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|441024_441624_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 28
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	447797	448421	2870548		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|447797_448421_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 29
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	453965	456777	2870548		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019691.1|453965_455312_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.2	1.7e-61
WP_000202188.1|455304_456777_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 30
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	464277	470848	2870548		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|464277_465615_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|465607_465838_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183383.1|465815_466697_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	2.0e-10
WP_001124985.1|467128_467581_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942210.1|467596_469276_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291533.1|469426_470848_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	5.1e-40
>prophage 31
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	477677	479084	2870548		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|477677_479084_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 32
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	485510	486995	2870548		Cyanophage(100.0%)	1	NA	NA
WP_160195254.1|485510_486995_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	1.8e-80
>prophage 33
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	490522	585080	2870548	head,protease,integrase,tail,holin,tRNA,plate,capsid,terminase,portal	Staphylococcus_phage(70.89%)	113	501928:501956	547762:547790
WP_001171335.1|490522_491431_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	32.0	4.4e-05
WP_000365240.1|491512_492055_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000392691.1|492159_492609_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000447733.1|492657_493545_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183429.1|493622_494129_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273371.1|494220_494952_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
WP_000368656.1|494944_495487_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|495479_496217_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|496349_497075_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987774.1|497055_498807_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.2	2.2e-21
WP_001557355.1|499050_499977_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001558502.1|499969_501997_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	100.0	1.6e-116
501928:501956	attL	ACCATCACATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_000264751.1|502039_503245_-|integrase	site-specific integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	100.0	7.7e-223
WP_000191466.1|503370_503985_+	hypothetical protein	NA	A0A2I6PEZ0	Staphylococcus_phage	100.0	6.7e-106
WP_001795334.1|503981_504128_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	100.0	1.2e-16
WP_000449655.1|504217_504613_-	hypothetical protein	NA	A0A2I6PEJ7	Staphylococcus_phage	100.0	3.8e-70
WP_031773169.1|504641_505076_-	hypothetical protein	NA	B7T0F5	Staphylococcus_virus	98.6	3.1e-25
WP_000524999.1|505093_505555_-	hypothetical protein	NA	A0A2I6PEK4	Staphylococcus_phage	98.7	3.7e-85
WP_000429766.1|505567_505897_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PEN2	Staphylococcus_phage	100.0	3.2e-54
WP_001115060.1|506057_506249_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PEL6	Staphylococcus_phage	100.0	2.3e-28
WP_107364917.1|506336_506552_+	hypothetical protein	NA	A0A2I6PEK7	Staphylococcus_phage	90.1	1.7e-27
WP_001124160.1|506576_506840_+	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	100.0	5.7e-46
WP_001285954.1|506852_507014_+	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
WP_000174998.1|507092_507416_+	hypothetical protein	NA	A0A2I6PE70	Staphylococcus_phage	100.0	6.5e-52
WP_031901863.1|507430_507793_+	hypothetical protein	NA	A7TWG3	Staphylococcus_phage	99.2	1.9e-55
WP_000762545.1|507789_508956_+	DUF2800 domain-containing protein	NA	A7TWG4	Staphylococcus_phage	99.7	7.0e-221
WP_000645042.1|508981_509539_+	DUF2815 family protein	NA	A0A2I6PF05	Staphylococcus_phage	100.0	1.8e-97
WP_078341700.1|509606_511559_+	DNA polymerase	NA	A0A2I6PE86	Staphylococcus_phage	99.2	0.0e+00
WP_001164629.1|511571_511757_+	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_000113974.1|511756_512158_+	PVL family protein	NA	A0A2I6PEL5	Staphylococcus_phage	100.0	1.2e-68
WP_000022735.1|512157_512412_+	DUF3310 domain-containing protein	NA	D2JGL1	Staphylococcus_phage	100.0	1.3e-42
WP_012068339.1|512411_512660_+	hypothetical protein	NA	Q4ZBK9	Staphylococcus_phage	100.0	1.2e-42
WP_000695762.1|512672_513074_+	hypothetical protein	NA	Q4ZAC1	Staphylococcus_virus	100.0	1.1e-69
WP_000979209.1|513070_513418_+	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
WP_000144710.1|513414_513723_+	hypothetical protein	NA	Q4ZD83	Staphylococcus_virus	100.0	6.2e-52
WP_001065023.1|513715_513952_+	DUF1024 family protein	NA	C8CH04	Staphylococcus_phage	100.0	1.1e-35
WP_000185654.1|513956_514499_+	dUTP pyrophosphatase	NA	Q4ZD81	Staphylococcus_virus	100.0	1.5e-96
WP_000195761.1|514535_514772_+	DUF1381 domain-containing protein	NA	M1T303	Staphylococcus_phage	100.0	9.6e-37
WP_000483477.1|514796_515033_+	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
WP_000592202.1|515025_515412_+	hypothetical protein	NA	A0A1X9IGZ2	Staphylococcus_phage	100.0	3.0e-64
WP_000595269.1|515408_515561_+	transcriptional activator RinB	NA	A7TWI2	Staphylococcus_phage	98.0	1.3e-18
WP_000265258.1|515628_515829_+	DUF1514 domain-containing protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
WP_000884879.1|515881_518329_+	hypothetical protein	NA	B5WZN5	Staphylococcus_phage	99.9	0.0e+00
WP_015978074.1|518431_518536_-	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	2.7e-12
WP_000665205.1|518669_518960_+	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
WP_115276660.1|518940_520308_+	DEAD/DEAH box helicase	NA	A0A0K1LKG3	Staphylococcus_phage	99.1	8.7e-263
WP_160195255.1|520320_520758_+	transcriptional regulator	NA	Q4ZCF5	Staphylococcus_virus	98.6	1.8e-76
WP_000166884.1|520914_521235_+	HNH endonuclease	NA	A0A2K9VBV6	Staphylococcus_phage	99.1	1.1e-56
WP_160195256.1|521360_521666_+|terminase	P27 family phage terminase small subunit	terminase	U5U414	Staphylococcus_phage	99.0	6.4e-49
WP_160195257.1|521655_523347_+|terminase	terminase large subunit	terminase	A0A2I6PE44	Staphylococcus_phage	99.3	0.0e+00
WP_001100659.1|523351_524590_+|portal	phage portal protein	portal	A0A0K1LL94	Staphylococcus_phage	96.6	1.9e-229
WP_000061862.1|524573_525347_+|protease	Clp protease ClpP	protease	M1TAZ4	Staphylococcus_phage	98.4	3.0e-135
WP_001142738.1|525358_526522_+|capsid	phage major capsid protein	capsid	M9QQM0	Staphylococcus_phage	100.0	4.2e-218
WP_000050973.1|526590_526869_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_000395501.1|526880_527213_+	hypothetical protein	NA	A0A2I6PDD6	Staphylococcus_phage	100.0	6.2e-58
WP_000110020.1|527209_527611_+	hypothetical protein	NA	A0A2I6PDD3	Staphylococcus_phage	100.0	6.2e-68
WP_001023802.1|527611_528007_+	DUF3168 domain-containing protein	NA	A0A2I6PDD8	Staphylococcus_phage	100.0	2.6e-66
WP_000807536.1|528041_528683_+|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_000169127.1|528774_529230_+	Ig domain-containing protein	NA	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
WP_000589167.1|529287_529638_+	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000438833.1|529679_529838_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_160195258.1|529851_536052_+|tail	phage tail tape measure protein	tail	U5U762	Staphylococcus_phage	99.7	0.0e+00
WP_001190533.1|536051_536876_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_000384474.1|536884_538468_+	peptidase	NA	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
WP_000179858.1|538467_538758_+	hypothetical protein	NA	U5U457	Staphylococcus_phage	100.0	2.1e-49
WP_000429558.1|538773_540684_+	minor structural protein	NA	A0A2I6PEQ9	Staphylococcus_phage	100.0	0.0e+00
WP_160195259.1|540683_542150_+|plate	BppU family phage baseplate upper protein	plate	A0A2I6PE72	Staphylococcus_phage	94.3	1.3e-256
WP_001166599.1|542149_542539_+	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000916020.1|542531_542696_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_000466784.1|542741_543041_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000339141.1|543176_543479_+|holin	phage holin	holin	A0A2I6PF56	Staphylococcus_phage	100.0	3.1e-48
WP_000909205.1|543489_544944_+	CHAP domain-containing protein	NA	A0A2I6PF47	Staphylococcus_phage	99.6	2.8e-288
WP_000990948.1|546709_546892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160195260.1|546888_547572_+	hypothetical protein	NA	A0A0A7S0U2	Clostridium_phage	28.3	1.5e-13
WP_000209712.1|547750_547966_+	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	2.0e-25
547762:547790	attR	ACCATCACATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_000476865.1|548055_548961_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000476354.1|549018_549915_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001557351.1|549990_550245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000913227.1|550385_551342_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001186912.1|551743_552289_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001151997.1|552394_552643_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163801.1|552750_553704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902099.1|553693_555073_+	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	33.6	1.4e-55
WP_000069291.1|555225_556686_+	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_001792205.1|556810_556927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001174258.1|557087_558074_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_000681757.1|558188_559157_-	asparaginase	NA	NA	NA	NA	NA
WP_000644391.1|559233_559893_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001795818.1|559923_560076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001792202.1|560156_560348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133961.1|560604_561780_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000165530.1|562001_563312_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000161745.1|563328_564327_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001043863.1|564497_564770_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|565200_565773_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774684.1|565775_566501_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001817755.1|566517_567462_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|567553_568003_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|568211_568412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269921.1|568797_569964_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	31.8	5.8e-34
WP_000776307.1|569989_571054_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_000253231.1|571063_572362_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000389524.1|572368_573613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005212.1|573626_574202_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
WP_000154683.1|574191_574779_+	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_001827022.1|574850_575531_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000839926.1|575866_576184_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000690025.1|576427_577570_+	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000361540.1|577574_578777_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	4.2e-35
WP_000049921.1|578763_579735_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525078.1|579758_582452_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858779.1|582773_584066_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.3	8.7e-55
WP_000362218.1|584393_585080_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
>prophage 34
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	588820	589447	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_001108889.1|588820_589447_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 35
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	598772	599651	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|598772_599651_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 36
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	638602	647992	2870548		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|638602_639307_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|639551_639746_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000691942.1|639757_640009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404645.1|640046_641171_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995287.1|641186_641624_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934894.1|642047_643004_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|643203_643683_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166059.1|643697_644537_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
WP_000159903.1|644622_645156_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|645148_645577_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473653.1|645588_646089_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|646088_646310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342132.1|646501_647992_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	2.9e-22
>prophage 37
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	651402	653414	2870548		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|651402_652062_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166801.1|652058_653414_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 38
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	659579	660371	2870548		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|659579_660371_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 39
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	663911	668942	2870548	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|663911_665048_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001788788.1|665079_665709_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|665727_665997_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|666159_666468_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|666638_666839_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|667035_667437_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216946.1|667676_668942_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
>prophage 40
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	676989	678591	2870548		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|676989_678591_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 41
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	683680	687134	2870548		Indivirus(50.0%)	3	NA	NA
WP_000079447.1|683680_684532_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
WP_000974847.1|684538_685180_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077571.1|685319_687134_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.1	5.1e-154
>prophage 42
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	690548	691250	2870548		Tupanvirus(100.0%)	1	NA	NA
WP_000571259.1|690548_691250_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.0e-13
>prophage 43
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	699346	701701	2870548		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000153613.1|699346_700129_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.9	2.7e-27
WP_000173833.1|700130_701129_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	8.5e-34
WP_000604816.1|701134_701701_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 44
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	706019	707282	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|706019_707282_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 45
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	716941	721335	2870548		Bacillus_phage(50.0%)	2	NA	NA
WP_001289546.1|716941_719344_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.4	1.8e-93
WP_031771138.1|719343_721335_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 46
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	727326	728973	2870548		Vibrio_phage(100.0%)	1	NA	NA
WP_001088978.1|727326_728973_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 47
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	732642	733764	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691301.1|732642_733764_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 48
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	737914	743570	2870548		Phage_Wrath(25.0%)	7	NA	NA
WP_001208755.1|737914_738538_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	5.9e-17
WP_000380730.1|738917_739781_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	9.1e-16
WP_001791425.1|739854_739959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688122.1|739955_740933_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085655.1|741089_741359_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|741812_741962_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000082539.1|742052_743570_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 49
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	753708	757984	2870548		Bacillus_phage(50.0%)	6	NA	NA
WP_000841346.1|753708_754242_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|754380_754569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|754681_755284_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670307.1|755280_756372_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603970.1|756375_757107_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593436.1|757075_757984_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	3.1e-22
>prophage 50
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	762367	766671	2870548	head	Staphylococcus_phage(80.0%)	8	NA	NA
WP_000899334.1|762367_762604_-|head	phage head morphogenesis protein	head	Q4ZE35	Staphylococcus_virus	70.6	2.3e-22
WP_000956747.1|762649_762901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477492.1|763028_763133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|763643_763829_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_001788716.1|764252_764363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002340.1|765062_765269_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
WP_001795785.1|765562_765787_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	5.0e-19
WP_001791958.1|766473_766671_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.1e-09
>prophage 51
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	771740	772217	2870548		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|771740_772217_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 52
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	778159	784641	2870548		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103743.1|778159_778978_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|779452_779995_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516269.1|780000_782010_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.8e-60
WP_000073352.1|782022_784641_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
>prophage 53
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	794055	795099	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|794055_795099_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 54
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	799297	804838	2870548		Bacillus_virus(33.33%)	4	NA	NA
WP_000664775.1|799297_800584_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.4	7.9e-16
WP_000089941.1|800583_801849_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293306.1|801879_802593_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001811366.1|802597_804838_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 55
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	809978	821791	2870548	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864190.1|809978_810950_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282298.1|810964_811882_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|812050_812401_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043635.1|812786_814904_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020853.1|814908_815226_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|815222_815507_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097460.1|815527_816703_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036633.1|816723_817191_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001801936.1|817480_821791_-	DNA polymerase III subunit alpha	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 56
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	826064	826835	2870548		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473699.1|826064_826835_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 57
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	831614	845288	2870548	protease,tRNA	Erwinia_phage(16.67%)	10	NA	NA
WP_000379054.1|831614_833018_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	4.9e-27
WP_000072681.1|833083_833629_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015601.1|833625_834522_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	3.6e-31
WP_000195254.1|834939_836247_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|836402_838478_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000672869.1|839698_840943_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041666.1|840970_842089_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110253.1|842315_843224_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|843245_844412_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176393.1|844520_845288_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 58
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	858672	860922	2870548		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|858672_859404_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|859519_859753_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|860187_860922_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 59
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	871292	873287	2870548		Moumouvirus(100.0%)	1	NA	NA
WP_000579563.1|871292_873287_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 60
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	876434	877370	2870548	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|876434_877370_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 61
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	882382	884639	2870548		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|882382_883582_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|883797_884016_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368226.1|884015_884639_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	1.0e-21
>prophage 62
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	887953	888565	2870548		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|887953_888565_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 63
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	892532	897143	2870548		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|892532_893633_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_000767028.1|893634_894909_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|894926_895808_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|895835_897143_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 64
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	901607	904361	2870548	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384691.1|901607_904361_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 65
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	923944	924133	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245796.1|923944_924133_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	2.5e-19
>prophage 66
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	933149	935109	2870548		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001802045.1|933149_933374_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765708.1|933330_933477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857488.1|934149_935109_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
>prophage 67
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	950739	955297	2870548		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|950739_951054_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249272.1|951226_953575_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	3.2e-15
WP_000161938.1|953584_955297_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 68
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	960165	961224	2870548	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|960165_961224_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 69
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	973170	976078	2870548		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|973170_973653_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263796.1|973654_974197_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|974266_974656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|974658_974913_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757575.1|975151_976078_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	2.2e-12
>prophage 70
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	987595	989443	2870548		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182653.1|987595_989443_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 71
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	997575	1006408	2870548		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|997575_998670_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020625.1|998682_999222_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455597.1|999365_999641_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|999808_1001215_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863439.1|1001218_1002511_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|1002601_1003579_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|1003582_1004695_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668336.1|1004865_1005492_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957037.1|1005856_1006408_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.0	1.6e-13
>prophage 72
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1012420	1016800	2870548		Bacillus_virus(50.0%)	5	NA	NA
WP_001289618.1|1012420_1012654_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_000040051.1|1012890_1014609_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1014611_1014878_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505966.1|1015031_1015574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685067.1|1015627_1016800_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
>prophage 73
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1020231	1034993	2870548		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921965.1|1020231_1021632_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273253.1|1021624_1022431_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101899.1|1022697_1023945_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709277.1|1023966_1025445_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_000238669.1|1025459_1026026_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
WP_000030811.1|1026028_1027057_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
WP_000483720.1|1027049_1028534_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
WP_000032740.1|1028512_1030702_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
WP_000666806.1|1030694_1031366_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848350.1|1031367_1031631_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174053.1|1031630_1032335_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_001010413.1|1032338_1033463_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861573.1|1033449_1033932_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225836.1|1034132_1034993_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	4.4e-39
>prophage 74
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1045446	1049193	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074534.1|1045446_1049193_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 75
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1052859	1053870	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000676537.1|1052859_1053870_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.2e-16
>prophage 76
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1062175	1065896	2870548		Enterococcus_phage(50.0%)	7	NA	NA
WP_001788574.1|1062175_1062466_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
WP_001790177.1|1062529_1062661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081351.1|1062706_1063666_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766008.1|1064153_1064510_+	DoxX family protein	NA	NA	NA	NA	NA
WP_001792054.1|1064598_1064736_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_001795266.1|1064876_1065167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571167.1|1065254_1065896_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-19
>prophage 77
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1076090	1081301	2870548	protease	Pithovirus(33.33%)	3	NA	NA
WP_001795272.1|1076090_1078415_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000928413.1|1078633_1079437_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049950.1|1079738_1081301_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
>prophage 78
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1100233	1102042	2870548		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1100233_1102042_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 79
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1107854	1109824	2870548		Bacillus_virus(100.0%)	2	NA	NA
WP_000427767.1|1107854_1108835_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.3e-15
WP_001067052.1|1108837_1109824_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	1.4e-15
>prophage 80
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1113475	1115489	2870548		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786734.1|1113475_1114417_-	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
WP_000140050.1|1114406_1115489_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 81
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1124080	1130890	2870548		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1124080_1125226_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047069.1|1125335_1126205_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353954.1|1126263_1128873_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044230.1|1129075_1130890_-	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	6.7e-37
>prophage 82
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1136009	1139663	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_000154921.1|1136009_1139663_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.5	2.0e-24
>prophage 83
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1149817	1156998	2870548		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185319.1|1149817_1150747_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
WP_000138487.1|1151273_1152518_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167309.1|1152626_1153817_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.0e-33
WP_000838029.1|1154124_1155252_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1155612_1155990_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035063.1|1156404_1156998_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 84
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1166918	1170546	2870548		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009692.1|1166918_1168394_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	4.5e-47
WP_000046076.1|1168524_1169733_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143495.1|1170186_1170546_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.7e-14
>prophage 85
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1174589	1177258	2870548		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1174589_1175804_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129659.1|1175800_1177258_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.5	2.6e-39
>prophage 86
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1180484	1239645	2870548	head,integrase,tail,holin,plate,capsid,terminase,transposase,portal	Staphylococcus_phage(73.61%)	85	1204606:1204622	1239261:1239277
WP_001557163.1|1180484_1181804_-|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
WP_000598444.1|1182009_1182393_-	YutD family protein	NA	NA	NA	NA	NA
WP_000201875.1|1182522_1183440_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_001241246.1|1183523_1184843_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000927632.1|1184869_1185697_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000608129.1|1185709_1186558_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_016170465.1|1186605_1186689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000267236.1|1186899_1187967_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_000582326.1|1187980_1189021_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000274029.1|1189385_1189700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000382163.1|1190529_1190730_-	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
WP_000139423.1|1190716_1190827_-	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
WP_001788502.1|1190897_1191050_-	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
WP_001035620.1|1191424_1191982_+	DUF4888 domain-containing protein	NA	A0A0F6N4L1	Staphylococcus_phage	100.0	7.4e-96
WP_001141517.1|1192041_1193454_-	CHAP domain-containing protein	NA	A0A0F6N3N1	Staphylococcus_phage	100.0	5.8e-286
WP_000351119.1|1193440_1193716_-|holin	phage holin	holin	A0A0F6N3M0	Staphylococcus_phage	100.0	8.6e-45
WP_000398868.1|1193771_1194167_-	hypothetical protein	NA	A1KXB6	Staphylococcus_virus	100.0	1.6e-68
WP_000276662.1|1194172_1195411_-|plate	BppU family phage baseplate upper protein	plate	A0A0F6N3G7	Staphylococcus_phage	100.0	1.6e-210
WP_000524022.1|1195423_1197322_-	CHAP domain-containing protein	NA	A0EX80	Staphylococcus_virus	99.7	0.0e+00
WP_000466778.1|1197458_1197758_-	DUF2951 domain-containing protein	NA	A0A0H4ITZ0	Staphylococcus_phage	100.0	7.6e-47
WP_000782200.1|1197797_1197971_-	XkdX family protein	NA	A0A0F6N3L7	Staphylococcus_phage	100.0	6.6e-27
WP_000705896.1|1197974_1198352_-	DUF2977 domain-containing protein	NA	A0A0F6N3G4	Staphylococcus_phage	100.0	1.5e-60
WP_000259619.1|1198351_1200175_-|plate	BppU family phage baseplate upper protein	plate	A1KX42	Staphylococcus_virus	99.2	3.9e-295
WP_000369017.1|1200174_1202085_-	hypothetical protein	NA	Q4ZDD6	Staphylococcus_virus	98.9	0.0e+00
WP_000152714.1|1202099_1204001_-	peptidase	NA	I1W634	Staphylococcus_phage	99.8	0.0e+00
WP_000350675.1|1204009_1204957_-|tail	phage tail family protein	tail	A0A0F6N3L4	Staphylococcus_phage	100.0	2.8e-183
1204606:1204622	attL	TGTTTTTATCTAATTTC	NA	NA	NA	NA
WP_000141480.1|1204969_1208437_-	hypothetical protein	NA	A0A0F6N3F9	Staphylococcus_phage	100.0	4.2e-245
WP_000105584.1|1208453_1208798_-	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
WP_001100161.1|1208827_1209193_-	hypothetical protein	NA	A0A0F6N4J9	Staphylococcus_phage	100.0	3.6e-59
WP_000002577.1|1209254_1209836_-|tail	phage major tail protein, TP901-1 family	tail	A0A0F6N3L8	Staphylococcus_phage	100.0	4.9e-106
WP_000188643.1|1209854_1210238_-	hypothetical protein	NA	E0Y3L5	Staphylococcus_virus	98.4	3.8e-67
WP_001017817.1|1210249_1210597_-	HK97 gp10 family phage protein	NA	A0A0F6N3F5	Staphylococcus_phage	99.1	2.0e-59
WP_001268312.1|1210596_1210899_-	hypothetical protein	NA	A4ZFB6	Staphylococcus_virus	100.0	1.1e-50
WP_000208960.1|1210895_1211228_-|head,tail	phage head-tail connector protein	head,tail	A0A0F6N3F4	Staphylococcus_phage	100.0	5.5e-54
WP_001114086.1|1211236_1211524_-	hypothetical protein	NA	S4V6D9	Staphylococcus_phage	98.9	1.4e-45
WP_000438511.1|1211545_1212520_-|capsid	phage major capsid protein	capsid	E0Y3L0	Staphylococcus_virus	100.0	2.2e-183
WP_000392151.1|1212533_1213154_-	DUF4355 domain-containing protein	NA	S4V984	Staphylococcus_phage	98.5	1.7e-69
WP_000072208.1|1213262_1213433_-	hypothetical protein	NA	A0A0F6N3E9	Staphylococcus_phage	100.0	1.5e-23
WP_001133044.1|1213505_1214501_-|head	phage head morphogenesis protein	head	A0A0F6N3F1	Staphylococcus_phage	100.0	2.0e-184
WP_000909970.1|1214507_1216046_-|portal	phage portal protein	portal	A0A0F6N4I8	Staphylococcus_phage	100.0	2.4e-293
WP_000273011.1|1216056_1217352_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0F6N3L3	Staphylococcus_phage	100.0	3.0e-257
WP_001038244.1|1217354_1217849_-|terminase	terminase small subunit	terminase	A0A0F6N3K6	Staphylococcus_phage	100.0	7.8e-89
WP_000162701.1|1218036_1218459_-	RinA family phage transcriptional activator	NA	A0A0F6N3E5	Staphylococcus_phage	100.0	1.2e-74
WP_000990004.1|1218524_1218629_-	hypothetical protein	NA	B2ZYX7	Staphylococcus_phage	100.0	7.0e-08
WP_000595257.1|1218629_1218803_-	transcriptional activator RinB	NA	Q4ZBK0	Staphylococcus_phage	100.0	6.4e-22
WP_000608278.1|1218795_1219032_-	hypothetical protein	NA	Q4ZDP0	Staphylococcus_virus	100.0	2.8e-36
WP_001072795.1|1219024_1219228_-	hypothetical protein	NA	A0A0N9BAX5	Staphylococcus_phage	100.0	5.2e-31
WP_000132921.1|1219224_1219419_-	hypothetical protein	NA	A0A2I6PEC2	Staphylococcus_phage	100.0	6.0e-29
WP_000617154.1|1219415_1219622_-	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	72.1	1.0e-18
WP_000185647.1|1219658_1220192_-	dUTP pyrophosphatase	NA	A1KX16	Staphylococcus_virus	99.4	2.4e-96
WP_072471035.1|1220184_1220379_-	hypothetical protein	NA	A0A0E3T9L7	Staphylococcus_phage	87.5	8.5e-23
WP_001065060.1|1220341_1220596_-	DUF1024 family protein	NA	A1KX15	Staphylococcus_virus	97.6	2.5e-38
WP_001557190.1|1220588_1220960_-	hypothetical protein	NA	A0A0F6N3K4	Staphylococcus_phage	100.0	3.6e-54
WP_000131376.1|1220968_1221211_-	hypothetical protein	NA	A0A0F6N3E1	Staphylococcus_phage	98.8	1.9e-40
WP_000029376.1|1221214_1221571_-	hypothetical protein	NA	A0A0F6N3E3	Staphylococcus_phage	100.0	6.5e-61
WP_000101252.1|1221698_1222004_-	hypothetical protein	NA	A0A0F6N4H9	Staphylococcus_phage	100.0	1.7e-49
WP_001187243.1|1222004_1222190_-	DUF3113 family protein	NA	A0A0F6N3K7	Staphylococcus_phage	100.0	1.1e-27
WP_000049794.1|1222194_1222599_-	DUF1064 domain-containing protein	NA	A1KX76	Staphylococcus_virus	100.0	9.6e-69
WP_001123695.1|1222608_1222830_-	DUF3269 family protein	NA	A0A0H3U2V4	Staphylococcus_phage	100.0	2.2e-35
WP_000256589.1|1222842_1223001_-	hypothetical protein	NA	A0A2H4PQI7	Staphylococcus_phage	100.0	4.5e-22
WP_000803062.1|1222994_1223774_-	ATP-binding protein	NA	G4KNP1	Staphylococcus_phage	100.0	3.8e-146
WP_000414755.1|1224620_1224902_+	hypothetical protein	NA	A0A1W6JPU7	Staphylococcus_phage	100.0	2.6e-49
WP_001124438.1|1225040_1225715_-	hypothetical protein	NA	R4IH15	Staphylococcus_phage	96.9	1.4e-125
WP_000934385.1|1225728_1226157_-	single-stranded DNA-binding protein	NA	B2ZYV4	Staphylococcus_phage	100.0	3.9e-60
WP_000139720.1|1226156_1226780_-	DUF1071 domain-containing protein	NA	A0A2H4PQQ6	Staphylococcus_phage	100.0	1.4e-114
WP_000815401.1|1226772_1226994_-	DUF2483 domain-containing protein	NA	A7TWM6	Staphylococcus_phage	100.0	3.2e-34
WP_000291090.1|1227003_1227264_-	DUF1108 family protein	NA	Q4ZDA1	Staphylococcus_virus	100.0	1.2e-43
WP_000165363.1|1227268_1227571_-	DUF2482 family protein	NA	A0A0F6N3N3	Staphylococcus_phage	100.0	1.4e-48
WP_000066011.1|1227664_1227826_-	DUF1270 domain-containing protein	NA	Q4ZAZ7	Staphylococcus_virus	100.0	2.5e-20
WP_000977381.1|1227818_1228040_-	hypothetical protein	NA	A0A0F6N3I2	Staphylococcus_phage	100.0	1.5e-31
WP_001094943.1|1228053_1228503_-	hypothetical protein	NA	A1KWZ2	Staphylococcus_virus	100.0	3.0e-79
WP_000187184.1|1228542_1228767_-	hypothetical protein	NA	A0A0F6N4M2	Staphylococcus_phage	100.0	3.2e-34
WP_001002757.1|1228767_1229535_-	phage antirepressor Ant	NA	A0A0F6N3N8	Staphylococcus_phage	100.0	1.1e-142
WP_000108122.1|1229534_1229729_-	helix-turn-helix transcriptional regulator	NA	A0A0F6N3M9	Staphylococcus_phage	100.0	1.1e-25
WP_001055143.1|1229991_1230324_+	helix-turn-helix transcriptional regulator	NA	R4IH08	Staphylococcus_phage	100.0	4.1e-57
WP_000775187.1|1230340_1231015_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0F6N3H6	Staphylococcus_phage	100.0	4.9e-126
WP_000661437.1|1231042_1231768_+	hypothetical protein	NA	A0A0F6N4L7	Staphylococcus_phage	100.0	9.9e-125
WP_000392186.1|1231799_1232732_+	hypothetical protein	NA	A0EWN8	Staphylococcus_virus	100.0	3.9e-174
WP_000337826.1|1232711_1232891_-	hypothetical protein	NA	A0EWN7	Staphylococcus_virus	100.0	8.3e-25
WP_001145726.1|1233003_1234053_+|integrase	site-specific integrase	integrase	A1KWY3	Staphylococcus_virus	99.7	4.5e-203
WP_001074405.1|1234120_1235518_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_001010508.1|1235668_1236133_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_000807663.1|1236122_1237364_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
WP_000205567.1|1237478_1238786_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1238883_1239645_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
1239261:1239277	attR	TGTTTTTATCTAATTTC	NA	NA	NA	NA
>prophage 87
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1243132	1244158	2870548		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571213.1|1243132_1244158_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
>prophage 88
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1247474	1252652	2870548		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1247474_1247831_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147952.1|1247974_1248295_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1248445_1248985_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150011.1|1249067_1249784_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.1	1.5e-16
WP_000974460.1|1249931_1250354_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1250752_1251247_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255551.1|1251401_1252019_+	amino acid transporter	NA	NA	NA	NA	NA
WP_001802951.1|1252091_1252652_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.4	3.8e-31
>prophage 89
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1256052	1257296	2870548		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1256052_1256253_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_000141557.1|1256609_1257296_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	1.7e-33
>prophage 90
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1266358	1275235	2870548		Staphylococcus_phage(50.0%)	9	NA	NA
WP_000757397.1|1266358_1267087_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	37.5	1.3e-18
WP_001057759.1|1267278_1267425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058299.1|1267440_1267764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001085183.1|1269085_1269550_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	98.7	1.6e-80
WP_001050048.1|1269571_1271944_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	4.3e-92
WP_001165959.1|1271977_1272718_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_000556760.1|1272833_1273067_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1273133_1273592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1273930_1275235_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 91
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1284406	1290337	2870548		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1284406_1284994_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1285557_1286502_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1286612_1287608_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369722.1|1287604_1288516_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1289401_1290337_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 92
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1294784	1297631	2870548		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662677.1|1294784_1297631_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 93
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1300949	1301789	2870548		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000753319.1|1300949_1301789_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 94
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1307867	1313573	2870548		Streptococcus_phage(66.67%)	5	NA	NA
WP_001557172.1|1307867_1308950_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	9.9e-44
WP_000686344.1|1309313_1310180_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192949.1|1310323_1310965_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
WP_000258150.1|1311129_1312185_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1312502_1313573_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 95
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1324372	1347845	2870548		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616840.1|1324372_1325134_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
WP_001245577.1|1325130_1326087_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|1326073_1327045_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|1327083_1327239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1327419_1328391_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855514.1|1328508_1330614_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1330576_1330975_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068501.1|1331775_1332642_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1332661_1333162_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1333502_1335008_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031760357.1|1335085_1335187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429006.1|1335277_1336195_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.1e-07
WP_000197262.1|1337073_1337616_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663030.1|1337954_1339013_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
WP_000180991.1|1339252_1340767_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589248.1|1340759_1341737_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	7.1e-25
WP_000983677.1|1341958_1343740_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525106.1|1343751_1345635_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
WP_000098285.1|1345904_1347845_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 96
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1350984	1360831	2870548		Pandoravirus(12.5%)	12	NA	NA
WP_001217796.1|1350984_1352136_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.7	6.0e-23
WP_000604514.1|1352119_1352713_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_000446724.1|1353063_1353732_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1353733_1354153_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|1354156_1354870_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000604990.1|1354968_1355553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093562.1|1355832_1356273_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1356615_1357089_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1357063_1357750_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244415.1|1357749_1358805_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702781.1|1358876_1359860_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	1.5e-62
WP_000931238.1|1359991_1360831_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.5	9.6e-55
>prophage 97
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1372443	1373817	2870548		Megavirus(100.0%)	1	NA	NA
WP_000952041.1|1372443_1373817_-	deoxyribodipyrimidine photo-lyase	NA	K7Y8W8	Megavirus	31.6	2.8e-43
>prophage 98
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1378794	1385074	2870548		Bacillus_phage(33.33%)	6	NA	NA
WP_000857598.1|1378794_1380468_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.2	3.4e-11
WP_000737160.1|1380464_1382096_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	6.7e-12
WP_000469894.1|1382314_1383190_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1383361_1384045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148826.1|1384047_1384506_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820897.1|1384507_1385074_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	4.7e-21
>prophage 99
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1391864	1392338	2870548		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|1391864_1392338_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 100
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1397600	1398398	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|1397600_1398398_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 101
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1403229	1403991	2870548		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1403229_1403991_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 102
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1408365	1409409	2870548		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001030772.1|1408365_1409409_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 103
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1415932	1416730	2870548		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1415932_1416730_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 104
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1419955	1423914	2870548		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1419955_1421683_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793067.1|1422103_1423399_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1423515_1423914_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 105
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1430848	1431592	2870548		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1430848_1431592_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 106
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1444130	1444691	2870548	integrase	Streptococcus_phage(100.0%)	1	1438284:1438298	1448281:1448295
1438284:1438298	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|1444130_1444691_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|1444130_1444691_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
1448281:1448295	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 107
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1457519	1460873	2870548		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1457519_1458530_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001792725.1|1459028_1459550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180234.1|1459577_1460873_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 108
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1468445	1469768	2870548		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860592.1|1468445_1469768_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	2.6e-107
>prophage 109
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1481072	1481729	2870548		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1481072_1481729_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 110
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1485370	1488691	2870548		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100835.1|1485370_1486747_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
WP_000347061.1|1487290_1488691_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 111
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1511978	1512641	2870548		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1511978_1512641_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 112
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1519224	1520412	2870548		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|1519224_1520412_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 113
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1523440	1534394	2870548		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1523440_1525522_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1525644_1526115_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1526180_1526594_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1526691_1526946_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|1527082_1530679_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1530842_1534394_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 114
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1538077	1542860	2870548	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1538077_1538626_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1538638_1538821_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1538876_1539020_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872882.1|1539134_1539704_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664737.1|1539784_1540309_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1540308_1541055_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1541062_1541467_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631969.1|1541459_1542860_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.8	1.2e-54
>prophage 115
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1548871	1551328	2870548	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1548871_1551328_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 116
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1570133	1580404	2870548	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1570133_1571621_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1571673_1571766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613722.1|1572159_1572636_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1572632_1572998_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167944.1|1572975_1573779_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	3.0e-21
WP_000057594.1|1573994_1574927_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148598.1|1575105_1575987_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167888.1|1576214_1578308_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	4.0e-110
WP_000551283.1|1578564_1579104_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176709.1|1579108_1580404_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	4.8e-13
>prophage 117
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1589660	1592125	2870548		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1589660_1590626_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252543.1|1590772_1592125_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 118
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1598030	1601128	2870548	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051136.1|1598030_1600004_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.0	3.2e-93
WP_000279926.1|1600288_1601128_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 119
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1605034	1605652	2870548		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1605034_1605652_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 120
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1614791	1616489	2870548		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109040.1|1614791_1616489_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 121
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1633137	1639376	2870548		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170264.1|1633137_1634142_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.2	1.6e-24
WP_000825530.1|1634473_1635316_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467994.1|1635352_1636012_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569281.1|1636015_1637041_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	3.7e-32
WP_001036648.1|1637335_1638478_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634098.1|1638470_1639376_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	3.8e-49
>prophage 122
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1665322	1668082	2870548		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072584.1|1665322_1666534_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.2	2.2e-44
WP_031770049.1|1666537_1668082_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	97.9	1.8e-285
>prophage 123
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1680619	1686068	2870548	transposase	Paenibacillus_phage(25.0%)	5	NA	NA
WP_000159787.1|1680619_1680892_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	50.6	1.3e-13
WP_000041880.1|1681290_1681995_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	37.1	5.8e-29
WP_000551643.1|1682386_1682923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424963.1|1683035_1684577_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1684601_1686068_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 124
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1695028	1696552	2870548		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930514.1|1695028_1696552_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.4e-40
>prophage 125
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1704866	1711195	2870548		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000934799.1|1704866_1705370_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1705390_1705687_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052484.1|1705930_1706122_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	1.1e-22
WP_001218732.1|1706207_1707305_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1707316_1707520_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373073.1|1707549_1708431_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001557587.1|1708584_1709430_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655692.1|1710091_1711195_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 126
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1721133	1721976	2870548		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209551.1|1721133_1721976_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	3.8e-11
>prophage 127
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1743285	1746020	2870548		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280799.1|1743285_1744308_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_001191954.1|1744285_1745230_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449069.1|1745219_1746020_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.4	5.8e-41
>prophage 128
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1764259	1764937	2870548		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911017.1|1764259_1764937_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 129
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1780607	1785047	2870548		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549287.1|1780607_1785047_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	25.6	6.3e-28
>prophage 130
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1795652	1797314	2870548		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570070.1|1795652_1796312_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736784.1|1796363_1797314_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 131
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1806112	1807549	2870548		Pandoravirus(100.0%)	1	NA	NA
WP_000164003.1|1806112_1807549_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.1e-29
>prophage 132
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1811309	1815848	2870548		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1811309_1813049_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_000608818.1|1813308_1813983_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975351.1|1814126_1815848_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 133
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1825175	1826219	2870548		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645608.1|1825175_1826219_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	3.5e-14
>prophage 134
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1833432	1834962	2870548		Vibrio_phage(100.0%)	1	NA	NA
WP_160195266.1|1833432_1834962_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	4.5e-10
>prophage 135
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1843837	1845343	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008400.1|1843837_1845343_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 136
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1856450	1861809	2870548		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1856450_1858700_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837116.1|1859287_1860256_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127990.1|1860252_1861809_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 137
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1872019	1874079	2870548		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818915.1|1872019_1873117_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166920.1|1873500_1874079_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	39.1	9.7e-14
>prophage 138
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1882628	1885816	2870548		Planktothrix_phage(33.33%)	3	NA	NA
WP_000067352.1|1882628_1884221_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	4.1e-22
WP_000794565.1|1884730_1884928_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	43.3	2.1e-05
WP_000960712.1|1885093_1885816_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	4.1e-22
>prophage 139
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1889687	1890368	2870548		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571407.1|1889687_1890368_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	2.9e-33
>prophage 140
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1907173	1908358	2870548		Klosneuvirus(100.0%)	1	NA	NA
WP_001084442.1|1907173_1908358_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	2.0e-34
>prophage 141
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1913194	1923478	2870548		Tupanvirus(50.0%)	3	NA	NA
WP_000605281.1|1913194_1920370_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.7	4.5e-68
WP_000826861.1|1920816_1922067_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706135.1|1922452_1923478_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.5	8.5e-29
>prophage 142
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1927013	1930243	2870548		Bacillus_virus(50.0%)	4	NA	NA
WP_000590855.1|1927013_1927754_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	2.5e-38
WP_000171919.1|1928095_1928608_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1928786_1928990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013485.1|1929283_1930243_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 143
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1933584	1936069	2870548		Catovirus(50.0%)	2	NA	NA
WP_000723436.1|1933584_1934730_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	25.9	4.6e-23
WP_000779504.1|1934806_1936069_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	4.3e-22
>prophage 144
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1942904	1949469	2870548		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|1942904_1944029_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028283.1|1944032_1945142_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1945154_1946183_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940790.1|1946172_1947996_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	5.2e-29
WP_000565304.1|1948015_1948780_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037332.1|1948782_1949469_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 145
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1953489	1954665	2870548		Clostridium_phage(100.0%)	1	NA	NA
WP_000469833.1|1953489_1954665_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.6	2.0e-29
>prophage 146
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1960104	1960878	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1960104_1960878_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 147
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1968909	1969509	2870548		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1968909_1969509_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 148
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1974446	1979543	2870548		Catovirus(50.0%)	6	NA	NA
WP_001793242.1|1974446_1975427_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
WP_001789407.1|1975496_1975619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183771.1|1975762_1976539_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414629.1|1976750_1977377_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|1977572_1978337_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223713.1|1978340_1979543_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	3.9e-09
>prophage 149
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	1987809	1992019	2870548		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1987809_1988790_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1989020_1990013_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000924990.1|1990028_1991024_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136633.1|1991020_1992019_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.8	5.2e-15
>prophage 150
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2025101	2026166	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816133.1|2025101_2026166_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.8	7.7e-09
>prophage 151
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2036853	2043507	2870548		Streptococcus_phage(50.0%)	4	NA	NA
WP_000852430.1|2036853_2038875_-	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	29.0	6.6e-41
WP_000029431.1|2038893_2040570_-	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
WP_000631574.1|2040590_2040671_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000446429.1|2040837_2043507_+	sensor histidine kinase KdpD	NA	A0A2K9L0Z8	Tupanvirus	21.5	6.0e-10
>prophage 152
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2051289	2057621	2870548	transposase	Bacillus_phage(66.67%)	7	NA	NA
WP_000815646.1|2051289_2052639_+	recombinase family protein	NA	Q9T200	Bacillus_phage	25.1	1.4e-18
WP_001186602.1|2052660_2054289_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	31.4	2.4e-46
WP_000859155.1|2054806_2055157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700853.1|2055243_2055555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001092169.1|2055572_2056079_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_000659050.1|2056099_2056417_+	RadC family protein	NA	NA	NA	NA	NA
WP_000868132.1|2056535_2057621_+|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
>prophage 153
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2060952	2061684	2870548		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|2060952_2061684_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 154
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2074233	2074908	2870548	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001106057.1|2074233_2074908_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
>prophage 155
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2079291	2080254	2870548	transposase	Streptococcus_phage(50.0%)	2	NA	NA
WP_001817892.1|2079291_2079489_+	protein rep	NA	A0A286QS97	Streptococcus_phage	62.0	1.2e-08
WP_001106057.1|2079579_2080254_+|transposase	IS6-like element IS257 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	99.1	2.6e-127
>prophage 156
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2085909	2095919	2870548		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2085909_2086710_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104165.1|2087098_2087887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060140.1|2087887_2089222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|2089214_2091041_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|2091053_2091755_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2092957_2094241_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2094518_2095919_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 157
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2102609	2111655	2870548	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884332.1|2102609_2103896_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	4.5e-88
WP_000177465.1|2104274_2105789_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.2e-90
WP_000449218.1|2106114_2106927_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819067.1|2107014_2109684_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	4.6e-119
WP_000255578.1|2109720_2111655_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
>prophage 158
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2121755	2128312	2870548		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_000742837.1|2121755_2122595_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491382.1|2123045_2123399_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2123466_2123862_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054128.1|2124121_2124691_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|2124808_2125009_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_000672033.1|2125400_2125592_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_000143647.1|2125683_2127564_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|2127553_2128312_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 159
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2142565	2144278	2870548		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138654.1|2142565_2144278_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 160
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2149906	2150920	2870548		Faustovirus(100.0%)	1	NA	NA
WP_000639184.1|2149906_2150920_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.9	9.6e-09
>prophage 161
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2163259	2163952	2870548		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|2163259_2163952_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 162
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2190050	2191910	2870548		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125628.1|2190050_2191910_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 163
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2217593	2219344	2870548		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143425.1|2217593_2218481_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	2.5e-05
WP_000923760.1|2218588_2219344_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 164
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2222764	2223262	2870548		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2222764_2223262_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 165
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2228256	2230640	2870548		Enterococcus_phage(100.0%)	2	NA	NA
WP_160195270.1|2228256_2230107_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	1.6e-235
WP_000173331.1|2230103_2230640_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.0	3.9e-41
>prophage 166
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2235518	2245632	2870548	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2235518_2237228_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2237505_2237718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028775.1|2237997_2238441_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172341.1|2238634_2240233_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_001791980.1|2240292_2240622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2240917_2242414_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031409.1|2242607_2243498_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237629.1|2243620_2244037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030072.1|2244294_2245632_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.0e-18
>prophage 167
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2275965	2279754	2870548		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751263.1|2275965_2276667_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	5.2e-38
WP_000379821.1|2277942_2279754_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 168
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2288188	2292303	2870548		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161369.1|2288188_2289187_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	1.0e-34
WP_000076661.1|2289277_2289484_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024139.1|2289894_2292303_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	3.2e-127
>prophage 169
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2301544	2304580	2870548	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058993.1|2301544_2303650_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
WP_000455988.1|2304058_2304580_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
>prophage 170
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2311006	2317390	2870548		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062663.1|2311006_2312746_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473679.1|2313046_2315113_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206031.1|2315492_2315903_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2315944_2316301_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228167.1|2316421_2317390_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	4.0e-12
>prophage 171
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2326679	2327672	2870548		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161545.1|2326679_2327672_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	3.7e-37
>prophage 172
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2336950	2337646	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000538625.1|2336950_2337646_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	3.0e-38
>prophage 173
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2356397	2357264	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_000721336.1|2356397_2357264_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	1.3e-78
>prophage 174
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2365449	2370645	2870548		Streptococcus_phage(50.0%)	3	NA	NA
WP_075339662.1|2365449_2367258_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.3	6.6e-93
WP_000755946.1|2367389_2367782_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000088733.1|2367783_2370645_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	3.1e-28
>prophage 175
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2378487	2379183	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_000217456.1|2378487_2379183_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	35.6	4.3e-08
>prophage 176
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2383737	2384556	2870548		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824948.1|2383737_2384556_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	27.2	1.3e-08
>prophage 177
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2392608	2394166	2870548		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173871.1|2392608_2393424_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	8.8e-13
WP_000598772.1|2393416_2394166_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	9.0e-20
>prophage 178
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2401437	2405866	2870548		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000923526.1|2401437_2402100_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.8	5.5e-21
WP_000072149.1|2402092_2402869_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026189.1|2403264_2404452_+	DHA family class C beta-lactamase	NA	NA	NA	NA	NA
WP_000700925.1|2404513_2405866_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 179
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2409260	2411119	2870548		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948974.1|2409260_2410487_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|2410483_2411119_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 180
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2428847	2435109	2870548		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2428847_2429990_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779360.1|2430257_2430644_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482652.1|2430777_2430885_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064825.1|2431587_2433351_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	2.5e-36
WP_000486487.1|2433375_2435109_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 181
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2438570	2444341	2870548		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971550.1|2438570_2439686_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	1.6e-20
WP_000286875.1|2439696_2440389_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200956.1|2440399_2440867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783428.1|2440918_2441896_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916704.1|2441897_2442845_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	3.2e-139
WP_000594519.1|2443411_2444341_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 182
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2452398	2453130	2870548		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|2452398_2453130_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 183
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2469779	2471339	2870548		Escherichia_phage(100.0%)	1	NA	NA
WP_000692648.1|2469779_2471339_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 184
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2492667	2493702	2870548		Bacillus_virus(100.0%)	1	NA	NA
WP_000655971.1|2492667_2493702_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 185
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2503547	2507444	2870548		Hokovirus(33.33%)	4	NA	NA
WP_000477338.1|2503547_2504921_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	2.3e-13
WP_000249497.1|2504913_2505588_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761395.1|2505723_2506779_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229920.1|2506778_2507444_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
>prophage 186
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2511180	2512389	2870548		Salmonella_phage(100.0%)	1	NA	NA
WP_000999131.1|2511180_2512389_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	3.9e-33
>prophage 187
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2524479	2525379	2870548		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524830.1|2524479_2525379_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 188
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2532751	2533171	2870548		Bacillus_phage(100.0%)	1	NA	NA
WP_000920239.1|2532751_2533171_-	FosB1/FosB3 family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	2.6e-37
>prophage 189
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2538923	2539805	2870548		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000235289.1|2538923_2539805_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	3.8e-62
>prophage 190
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2547683	2548319	2870548		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2547683_2548319_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 191
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2561262	2565241	2870548		Staphylococcus_phage(66.67%)	3	NA	NA
WP_011447058.1|2561262_2561901_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_000417018.1|2563426_2564380_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	6.4e-31
WP_000737705.1|2564740_2565241_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 192
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2569158	2569962	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717381.1|2569158_2569962_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.3e-07
>prophage 193
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2588942	2589548	2870548		Pithovirus(100.0%)	1	NA	NA
WP_000913024.1|2588942_2589548_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.1	4.3e-12
>prophage 194
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2601518	2604686	2870548		Leptospira_phage(100.0%)	1	NA	NA
WP_000592307.1|2601518_2604686_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	1.1e-61
>prophage 195
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2628369	2630036	2870548		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389658.1|2628369_2629179_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.7e-19
WP_000155387.1|2629175_2630036_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	9.7e-10
>prophage 196
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2638818	2646474	2870548		Enterobacteria_phage(33.33%)	7	NA	NA
WP_000411031.1|2638818_2639835_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.7	1.0e-18
WP_000655241.1|2640408_2640591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130149.1|2641084_2642749_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	8.0e-45
WP_000186134.1|2642785_2643490_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769705.1|2643873_2644299_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044362.1|2644593_2645409_+	hydrolase	NA	NA	NA	NA	NA
WP_001044441.1|2645619_2646474_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	37.9	4.9e-06
>prophage 197
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2649856	2652166	2870548		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001015500.1|2649856_2650705_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
WP_000875476.1|2650937_2651141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791678.1|2651227_2651389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557494.1|2651425_2652166_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 198
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2658486	2659899	2870548		Pandoravirus(100.0%)	1	NA	NA
WP_000169224.1|2658486_2659899_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 199
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2663862	2665425	2870548		Vibrio_phage(100.0%)	1	NA	NA
WP_000792342.1|2663862_2665425_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 200
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2675627	2676596	2870548		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2675627_2676596_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 201
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2694048	2694957	2870548		Klosneuvirus(100.0%)	1	NA	NA
WP_000167867.1|2694048_2694957_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 202
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2698548	2705994	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001048259.1|2698548_2705994_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	31.5	3.9e-22
>prophage 203
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2712250	2715070	2870548		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334463.1|2712250_2714056_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
WP_000908182.1|2714287_2715070_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.3e-09
>prophage 204
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2726250	2730081	2870548		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2726250_2726694_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2726814_2727525_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083318.1|2727838_2728501_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242311.1|2728779_2730081_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	3.6e-133
>prophage 205
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2738021	2739632	2870548		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2738021_2739632_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 206
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2747435	2755185	2870548		Bacillus_virus(25.0%)	9	NA	NA
WP_000273358.1|2747435_2748035_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2748035_2749112_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248732.1|2749098_2749935_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_015445903.1|2749967_2751065_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.3	2.3e-40
WP_000697334.1|2751061_2751481_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654184.1|2751587_2752112_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2752138_2753377_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2753404_2754034_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723418.1|2754057_2755185_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 207
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2765589	2765985	2870548		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|2765589_2765985_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 208
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2772256	2772904	2870548		Moumouvirus(100.0%)	1	NA	NA
WP_001187630.1|2772256_2772904_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 209
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2780104	2781625	2870548		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2780104_2781625_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 210
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2788815	2790843	2870548		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546611.1|2788815_2790843_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	2.3e-25
>prophage 211
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2795992	2799376	2870548		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2795992_2796355_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390827.1|2796703_2797705_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2797823_2798150_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190829.1|2798151_2798631_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041111.1|2798605_2799376_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	2.2e-21
>prophage 212
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2813494	2815024	2870548		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000094583.1|2813494_2815024_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
>prophage 213
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2821978	2836039	2870548	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159042.1|2821978_2823004_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.6	3.4e-62
WP_000106332.1|2823318_2824929_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	28.1	1.9e-19
WP_001792272.1|2825017_2825146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602057.1|2825290_2827219_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	30.2	9.3e-53
WP_001283612.1|2827471_2828107_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_072414299.1|2828461_2829490_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581076.1|2829549_2829774_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052270.1|2829981_2831232_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
WP_000790331.1|2831414_2832365_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141432.1|2832513_2833998_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	26.5	2.3e-19
WP_001253312.1|2833994_2834954_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|2835322_2836039_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 214
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2843220	2845197	2870548		uncultured_virus(100.0%)	2	NA	NA
WP_000917289.1|2843220_2843505_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240655.1|2843580_2845197_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
>prophage 215
NZ_CP047865	Staphylococcus aureus strain UP_844 chromosome, complete genome	2870548	2849146	2870078	2870548	integrase	Staphylococcus_phage(97.14%)	37	2851989:2852003	2861692:2861706
WP_000791411.1|2849146_2850202_+	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
WP_000595392.1|2850223_2851240_+	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.2	6.7e-26
2851989:2852003	attL	CTATCATTATCGAAT	NA	NA	NA	NA
WP_000857180.1|2852358_2853396_-|integrase	site-specific integrase	integrase	Q38086	Staphylococcus_phage	98.6	1.4e-175
WP_000427213.1|2853458_2853701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001558608.1|2853711_2854695_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000694772.1|2854794_2854977_-	hypothetical protein	NA	A0A2I6PDF8	Staphylococcus_phage	100.0	6.9e-27
WP_000591749.1|2855180_2855522_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000759682.1|2855527_2856460_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|2856475_2857189_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_000854072.1|2857322_2857586_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
WP_001025404.1|2857601_2857817_+	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
WP_000128909.1|2857805_2858135_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	98.2	5.1e-52
WP_001148605.1|2858185_2858938_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_001148856.1|2858953_2859151_+	hypothetical protein	NA	O80075	Staphylococcus_phage	100.0	2.5e-30
WP_000762521.1|2859137_2859518_-	DUF2513 domain-containing protein	NA	Q9T1Z5	Staphylococcus_phage	100.0	1.2e-68
WP_001120201.1|2859572_2859896_+	DUF771 domain-containing protein	NA	A0A075LYF5	Staphylococcus_phage	100.0	3.0e-57
WP_000048129.1|2859892_2860054_+	DUF1270 family protein	NA	A0A1P8L6G0	Staphylococcus_phage	100.0	1.9e-20
WP_000165371.1|2860148_2860451_+	DUF2482 family protein	NA	A0A1P8L6F8	Staphylococcus_phage	100.0	7.0e-48
WP_000291510.1|2860455_2860716_+	DUF1108 family protein	NA	A0A1P8L6F5	Staphylococcus_phage	100.0	5.2e-44
WP_001205732.1|2860724_2860988_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700554.1|2860996_2862940_+	AAA family ATPase	NA	A0A1P8L6F1	Staphylococcus_phage	100.0	0.0e+00
2861692:2861706	attR	ATTCGATAATGATAG	NA	NA	NA	NA
WP_000180600.1|2862941_2863862_+	recombinase RecT	NA	A0A1P8L6F6	Staphylococcus_phage	100.0	5.1e-166
WP_064135358.1|2863942_2864560_+	MBL fold metallo-hydrolase	NA	A0A1P8L6F7	Staphylococcus_phage	100.0	1.2e-86
WP_000934759.1|2864560_2865031_+	single-stranded DNA-binding protein	NA	A0A1P8L6D9	Staphylococcus_phage	100.0	5.7e-81
WP_000338528.1|2865961_2866180_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401969.1|2866188_2866593_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A075M042	Staphylococcus_phage	100.0	8.4e-73
WP_000101279.1|2866605_2866977_+	hypothetical protein	NA	A0A2I6PDG3	Staphylococcus_phage	91.1	1.4e-50
WP_000111491.1|2866976_2867234_+	DUF3310 domain-containing protein	NA	A0A1X9H067	Staphylococcus_phage	98.8	6.3e-42
WP_000178987.1|2867230_2867479_+	hypothetical protein	NA	A0A0K1LL46	Staphylococcus_phage	96.3	7.5e-40
WP_001065108.1|2867493_2867739_+	DUF1024 family protein	NA	Q8SDV5	Staphylococcus_phage	95.1	1.7e-36
WP_000185693.1|2867735_2868272_+	hypothetical protein	NA	Q9MBR0	Staphylococcus_prophage	100.0	1.6e-95
WP_001282077.1|2868308_2868554_+	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	98.8	2.5e-35
WP_000195784.1|2868550_2868757_+	DUF1381 domain-containing protein	NA	A0A2I6PEA2	Staphylococcus_phage	94.1	1.1e-17
WP_000595265.1|2868753_2868903_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_001557462.1|2868902_2869103_+	DUF1514 domain-containing protein	NA	D2JLD9	Staphylococcus_phage	98.5	5.3e-28
WP_000590122.1|2869130_2869547_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988332.1|2869778_2870078_+	HNH endonuclease	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
