The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	0	25609	2860128	head,portal,holin,capsid,protease,tail,terminase	Staphylococcus_phage(100.0%)	28	NA	NA
WP_000625088.1|0_1662_+|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
WP_000025274.1|1677_2865_+|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
WP_000642728.1|2848_3586_+|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
WP_000154559.1|3609_4755_+|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
WP_000238236.1|4774_5059_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
WP_000150936.1|5048_5333_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5316_5679_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114226.1|5675_6080_+	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
WP_000565498.1|6076_6484_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000268740.1|6484_7129_+|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
WP_071621395.1|7170_7395_+	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7444_7795_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_000504566.1|8039_12569_+|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	97.0	0.0e+00
WP_000567396.1|12565_14050_+|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	99.8	4.5e-297
WP_000582152.1|14065_17848_+	hypothetical protein	NA	A0A068A201	Staphylococcus_phage	99.6	0.0e+00
WP_001000058.1|17840_17993_+	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
WP_001262621.1|18038_18326_+	hypothetical protein	NA	A0A1X9H0N7	Staphylococcus_phage	100.0	7.6e-44
WP_000340977.1|18381_18756_+	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
WP_000034846.1|19167_19950_+	staphylococcal enterotoxin type P	NA	A0A075M4C7	Staphylococcus_phage	99.6	1.6e-149
WP_011447039.1|20152_20329_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_031762631.1|20381_20489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|20540_20795_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861026.1|20806_21562_+	CHAP domain-containing protein	NA	A0A075LZV3	Staphylococcus_phage	100.0	1.2e-152
WP_000920042.1|21752_22244_+	staphylokinase	NA	A0A075LYD3	Staphylococcus_phage	100.0	8.0e-86
WP_000727645.1|23319_23769_-	chemotaxis-inhibiting protein CHIPS	NA	A0A075LZI2	Staphylococcus_phage	100.0	8.7e-79
WP_000702262.1|24451_24802_+	complement inhibitor SCIN-A	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|24854_25115_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|25429_25609_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
>prophage 2
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	31218	33665	2860128		Staphylococcus_phage(100.0%)	3	NA	NA
WP_000991306.1|31218_32115_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
WP_000645727.1|32115_32796_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763043.1|32792_33665_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.0e-27
>prophage 3
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	39428	39830	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|39428_39830_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 4
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	44026	46053	2860128		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|44026_44587_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_000275727.1|44955_46053_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	3.3e-47
>prophage 5
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	50083	52367	2860128		Bacillus_virus(100.0%)	2	NA	NA
WP_160199221.1|50083_51553_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	3.5e-108
WP_000040866.1|51545_52367_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 6
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	56068	62835	2860128		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|56068_57364_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|57472_57775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272056.1|57946_58639_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|58635_60828_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774556.1|60831_62835_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.2	1.2e-114
>prophage 7
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	70009	75038	2860128		Catovirus(33.33%)	5	NA	NA
WP_001231451.1|70009_70957_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.2e-16
WP_001147865.1|71037_72399_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.6	1.4e-103
WP_000548781.1|72568_73099_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140172.1|73345_74416_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|74483_75038_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 8
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	78490	78904	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001557448.1|78490_78904_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.3	6.7e-17
>prophage 9
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	83958	84588	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|83958_84588_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 10
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	100068	101805	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_000597238.1|100068_101805_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
>prophage 11
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	115042	223593	2860128	protease,transposase,tRNA	Staphylococcus_phage(92.73%)	101	NA	NA
WP_001557163.1|115042_116362_-|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
WP_000063582.1|116945_118007_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_000649908.1|118264_119722_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_001144055.1|119708_120437_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.0e-36
WP_001793998.1|120572_121715_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_160199222.1|121719_122190_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_001251224.1|122348_122948_+	glucosamine-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000031108.1|122972_123125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901023.1|123672_124068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000116228.1|124263_125649_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_000669376.1|126101_126923_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_000437969.1|127085_128198_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_001045135.1|128219_128843_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000375864.1|129198_129663_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000992518.1|129841_130966_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000290301.1|131034_131379_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
WP_001802255.1|131917_132016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000238227.1|132306_133503_+	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_000584630.1|133492_136429_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001244175.1|136425_137367_+	3'-5' exoribonuclease YhaM	NA	NA	NA	NA	NA
WP_000782121.1|137487_138450_-	foldase	NA	NA	NA	NA	NA
WP_000477959.1|138654_139212_-	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000648118.1|139946_140312_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_000004981.1|140453_140876_-	HIT family protein	NA	NA	NA	NA	NA
WP_000216874.1|141009_141750_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
WP_000551836.1|141742_142966_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000737976.1|143089_143593_-	signal transduction protein TraP	NA	NA	NA	NA	NA
WP_001790154.1|143755_143866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233526.1|143855_144893_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_000162881.1|144950_145874_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000167542.1|145897_147298_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_000132890.1|147620_148175_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_010922839.1|149534_150317_+	staphylococcal enterotoxin type O	NA	A0A1X9H080	Staphylococcus_phage	36.7	1.1e-31
WP_000821658.1|150597_151317_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
WP_000713847.1|151351_152080_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
WP_001236362.1|153043_153799_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	41.4	6.0e-40
WP_000736709.1|154081_154858_+	staphylococcal enterotoxin type G	NA	NA	NA	NA	NA
WP_000848318.1|155409_156186_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000617704.1|156206_156443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001253432.1|156520_157015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206343.1|157848_158637_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	98.5	3.6e-144
WP_000473596.1|159999_160935_+	beta-channel forming cytolysin	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	1.4e-174
WP_000782463.1|160936_161920_+	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.4	1.8e-185
WP_000543854.1|162289_163081_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000550252.1|163085_163559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000469591.1|163814_164033_+	hypothetical protein	NA	A0A2H4PQH0	Staphylococcus_phage	80.6	2.0e-25
WP_001092780.1|164505_165087_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.8	9.6e-54
WP_001039427.1|166050_166758_+|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
WP_001039454.1|166882_167605_+|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
WP_001038872.1|167662_168382_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	98.7	1.3e-129
WP_001038704.1|168502_169222_+|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
WP_011447030.1|169170_169278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038752.1|169379_170099_+|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	99.6	1.9e-131
WP_001791797.1|170161_170296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001793440.1|170276_172016_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	2.4e-289
WP_000072627.1|172008_173238_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	4.0e-134
WP_001792025.1|174313_174415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001801861.1|174537_174633_-	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_000414216.1|175987_176560_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
WP_000627540.1|176660_177002_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
WP_000669024.1|177042_177669_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.8	3.1e-74
WP_000070642.1|177743_178739_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.9	2.6e-67
WP_001795210.1|178819_179470_-	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	94.0	2.9e-51
WP_012840523.1|179772_180228_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
WP_000348364.1|180386_181865_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
WP_000778528.1|181869_182871_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.3	5.3e-185
WP_000718107.1|182867_183125_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672013.1|183190_183664_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
WP_001822900.1|183668_184415_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
WP_000109906.1|184792_186385_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933820.1|186756_187953_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366163.1|188074_188983_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000453306.1|189194_190028_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
WP_000623470.1|192024_192378_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
WP_001200542.1|192374_192740_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091442.1|192995_193298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|193557_194271_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168903.1|194710_195346_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001030469.1|195641_196085_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
WP_001153742.1|196071_196515_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671057.1|196627_197098_-	RNA polymerase sigma factor SigS	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
WP_000384171.1|197296_197521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|197796_198651_+	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989121.1|198737_200030_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_000221177.1|200029_200344_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_001261668.1|200866_202369_+	FAD-dependent oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
WP_000384185.1|202861_203893_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	4.0e-196
WP_000493887.1|203899_204532_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
WP_001159037.1|204542_205724_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
WP_001008549.1|205736_206201_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
WP_001196362.1|206322_207324_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
WP_001790712.1|207434_207554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266096.1|207556_208384_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|208955_209357_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764419.1|209479_210043_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000526539.1|210039_210993_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025067.1|211102_212284_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
WP_001108730.1|212574_214989_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
WP_000836461.1|215010_215322_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
WP_001050574.1|215647_222208_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	98.2	2.3e-305
WP_000285020.1|222324_223593_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
>prophage 12
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	234998	240326	2860128		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|234998_235856_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048368.1|235884_236481_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118314.1|236501_240326_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 13
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	249066	250773	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862096.1|249066_250773_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.6	8.0e-274
>prophage 14
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	257377	260008	2860128	protease,tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|257377_258640_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279338.1|258733_260008_-|protease	trypsin-like serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 15
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	263777	267910	2860128		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808849.1|263777_265382_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291420.1|265368_266526_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553924.1|266640_267087_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174280.1|267166_267910_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.0	4.9e-18
>prophage 16
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	285502	288700	2860128		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226918.1|285502_288700_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.5	7.2e-135
>prophage 17
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	293633	295391	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232648.1|293633_295391_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 18
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	300275	308439	2860128		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080028.1|300275_300980_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_015445861.1|300979_302641_+	PAS domain S-box protein	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849428.1|303139_304627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038317.1|304920_307551_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114454.1|307566_308439_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 19
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	312354	323507	2860128	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|312354_313275_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_001790562.1|313367_313490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|313687_315625_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049145.1|316050_317544_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|317772_318300_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|318328_318529_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|318575_318932_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|319073_319682_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_001280022.1|319700_320630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|320634_320745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127573.1|320792_322094_+	trigger factor	NA	NA	NA	NA	NA
WP_000472302.1|322244_323507_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 20
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	333074	339721	2860128	transposase,tRNA	Catovirus(50.0%)	5	NA	NA
WP_000425353.1|333074_335705_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	3.7e-153
WP_001108346.1|335717_336989_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000261115.1|337258_337966_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000692869.1|337962_338517_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000868132.1|338635_339721_+|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
>prophage 21
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	343052	343784	2860128		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|343052_343784_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 22
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	352351	387964	2860128	tRNA	uncultured_Mediterranean_phage(18.75%)	31	NA	NA
WP_001005768.1|352351_353356_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|353357_354383_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|354405_355545_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|355563_355824_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_000749795.1|356098_358378_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
WP_000595011.1|358580_360854_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.1e-64
WP_000364542.1|360875_361394_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058587.1|361821_364011_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000869983.1|364022_364475_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000717800.1|364471_365347_+	cell wall amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|365807_367070_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|367085_368852_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001790559.1|369184_369313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|369312_370086_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102726.1|370246_371521_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.5	3.1e-105
WP_000704122.1|371605_372028_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|372127_372310_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|372349_372496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985878.1|372732_373746_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409157.1|374057_375200_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.8	5.4e-32
WP_000066097.1|375200_376319_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567017.1|377013_377682_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283312.1|377683_380161_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000734075.1|380503_383134_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|383196_383457_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|383460_383889_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|383903_384212_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342258.1|384496_385135_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	3.2e-10
WP_000137772.1|385137_386061_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|386072_387341_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|387340_387964_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 23
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	394636	395857	2860128		Lactococcus_phage(100.0%)	1	NA	NA
WP_000542320.1|394636_395857_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	33.3	2.2e-52
>prophage 24
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	404643	410807	2860128		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|404643_405105_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_000953309.1|405163_407311_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.6e-32
WP_001282563.1|407367_408342_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|408386_408638_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|408983_410807_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 25
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	414301	417409	2860128		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|414301_416134_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119021.1|416269_417409_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 26
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	423879	424827	2860128		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|423879_424827_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 27
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	427880	441626	2860128	tRNA	Klosneuvirus(28.57%)	13	NA	NA
WP_001030080.1|427880_429272_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001797828.1|429606_430230_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|430240_431059_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217257.1|431119_432937_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.3	7.9e-54
WP_001283055.1|433160_434267_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624577.1|434397_435075_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683940.1|435077_436178_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_001062177.1|436291_437638_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924220.1|437647_438538_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
WP_001213908.1|438663_439449_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564315.1|439490_440354_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|440340_440751_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|441026_441626_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 28
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	447799	448423	2860128		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|447799_448423_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 29
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	453967	456779	2860128		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019691.1|453967_455314_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.2	1.7e-61
WP_000202188.1|455306_456779_+	glycine dehydrogenase subunit 2	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 30
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	464279	470850	2860128		Indivirus(66.67%)	6	NA	NA
WP_001286928.1|464279_465617_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|465609_465840_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183383.1|465817_466699_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	2.0e-10
WP_001124985.1|467130_467583_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942210.1|467598_469278_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291533.1|469428_470850_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	5.1e-40
>prophage 31
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	477679	479086	2860128		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|477679_479086_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 32
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	485512	486997	2860128		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|485512_486997_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 33
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	490524	584918	2860128	head,plate,portal,holin,capsid,protease,tail,terminase,tRNA,integrase	Staphylococcus_phage(75.31%)	114	501930:501958	547600:547628
WP_001171335.1|490524_491433_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	32.0	4.4e-05
WP_000365240.1|491514_492057_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000392691.1|492161_492611_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000447733.1|492659_493547_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183429.1|493624_494131_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273371.1|494222_494954_+	segregation and condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
WP_000368656.1|494946_495489_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|495481_496219_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|496351_497077_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987774.1|497057_498809_+	HAMP domain-containing protein	NA	A0A1V0SGX0	Hokovirus	33.2	2.2e-21
WP_001557355.1|499052_499979_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001558502.1|499971_501999_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	100.0	1.6e-116
501930:501958	attL	ACCATCACATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_000264751.1|502041_503247_-|integrase	site-specific integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	100.0	7.7e-223
WP_160199223.1|503372_503987_+	ATPase	NA	A0A2I6PEZ0	Staphylococcus_phage	99.0	3.3e-105
WP_072433242.1|503983_504130_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	93.8	2.2e-15
WP_000705240.1|504166_504349_-	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
WP_000348133.1|504445_505366_-	exonuclease	NA	B5WZL1	Staphylococcus_phage	100.0	2.5e-173
WP_000801423.1|505381_505996_-	helix-turn-helix domain-containing protein	NA	B5WZL2	Staphylococcus_phage	100.0	9.0e-111
WP_001030311.1|506167_506395_+	hypothetical protein	NA	B5WZL3	Staphylococcus_phage	100.0	3.3e-34
WP_001148559.1|506420_507197_+	hypothetical protein	NA	M1RZB2	Staphylococcus_phage	100.0	1.5e-142
WP_001001383.1|507212_507431_+	hypothetical protein	NA	B5WZL5	Staphylococcus_phage	100.0	7.8e-33
WP_001025401.1|507480_507726_+	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_001128433.1|507694_508060_-	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_031867168.1|508114_508330_+	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	97.2	2.7e-30
WP_001124192.1|508356_508620_+	helix-turn-helix domain-containing protein	NA	M1SVD9	Staphylococcus_phage	98.9	2.2e-45
WP_001285954.1|508632_508794_+	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
WP_000174994.1|508872_509196_+	hypothetical protein	NA	A0A2I6PF12	Staphylococcus_phage	100.0	5.9e-53
WP_031857745.1|509210_509573_+	hypothetical protein	NA	A0A2I6PF03	Staphylococcus_phage	99.2	2.4e-55
WP_031822698.1|509569_510736_+	DUF2800 domain-containing protein	NA	A0A2I6PEL9	Staphylococcus_phage	99.0	5.9e-220
WP_000645048.1|510761_511319_+	DUF2815 family protein	NA	A0A2I6PEP8	Staphylococcus_phage	100.0	1.8e-97
WP_001802096.1|511386_513339_+	DNA polymerase	NA	A0A2I6PE86	Staphylococcus_phage	100.0	0.0e+00
WP_086154326.1|513351_513537_+	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	98.4	2.1e-26
WP_000113974.1|513536_513938_+	PVL family protein	NA	A0A2I6PEL5	Staphylococcus_phage	100.0	1.2e-68
WP_000022736.1|513937_514192_+	DUF3310 domain-containing protein	NA	Q6R831	Staphylococcus_virus	100.0	1.3e-42
WP_078064221.1|514191_514440_+	hypothetical protein	NA	M9NTB1	Staphylococcus_phage	97.5	1.7e-39
WP_000693989.1|514453_514660_+	hypothetical protein	NA	A0A2K9VBT9	Staphylococcus_phage	100.0	3.0e-34
WP_000695759.1|514662_515064_+	hypothetical protein	NA	A0A0N7E0T5	Staphylococcus_phage	100.0	7.0e-72
WP_000979209.1|515060_515408_+	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
WP_000144703.1|515404_515713_+	hypothetical protein	NA	Q6R826	Staphylococcus_virus	96.1	8.4e-49
WP_001065088.1|515705_515954_+	DUF1024 family protein	NA	A0A2K9VBU0	Staphylococcus_phage	98.8	2.0e-37
WP_000185653.1|515946_516477_+	dUTP pyrophosphatase	NA	C8CH05	Staphylococcus_phage	100.0	1.7e-94
WP_000195803.1|516513_516720_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_000592205.1|516716_517103_+	hypothetical protein	NA	A0A0H3U465	Staphylococcus_phage	96.9	2.4e-61
WP_000595263.1|517099_517252_+	transcriptional activator RinB	NA	A0A2I6PEM5	Staphylococcus_phage	100.0	2.0e-19
WP_000265252.1|517319_517520_+	DUF1514 domain-containing protein	NA	A0A2I6PEP5	Staphylococcus_phage	100.0	4.9e-26
WP_000884870.1|517807_520255_+	hypothetical protein	NA	A0A2I6PEP4	Staphylococcus_phage	100.0	0.0e+00
WP_072324141.1|520357_520462_-	hypothetical protein	NA	Q4ZCF8	Staphylococcus_virus	97.1	2.1e-12
WP_000665203.1|520595_520886_+	VRR-NUC domain-containing protein	NA	A0A2I6PEN7	Staphylococcus_phage	100.0	6.5e-51
WP_001802078.1|520866_522234_+	DEAD/DEAH box helicase	NA	A0A2I6PE95	Staphylococcus_phage	99.8	2.3e-263
WP_000513699.1|522246_522684_+	transcriptional regulator	NA	A0A2I6PDC2	Staphylococcus_phage	100.0	4.6e-77
WP_000160689.1|522840_523155_+	HNH endonuclease	NA	A0A2I6PDC4	Staphylococcus_phage	100.0	2.5e-56
WP_000778932.1|523283_523589_+|terminase	terminase	terminase	A0A2I6PE27	Staphylococcus_phage	100.0	2.9e-49
WP_000153555.1|523578_525270_+|terminase	terminase large subunit	terminase	A0A2I6PE44	Staphylococcus_phage	100.0	0.0e+00
WP_001100671.1|525274_526513_+|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	99.8	2.6e-234
WP_000061862.1|526496_527270_+|protease	Clp protease ClpP	protease	M1TAZ4	Staphylococcus_phage	98.4	3.0e-135
WP_001142738.1|527281_528445_+|capsid	phage major capsid protein	capsid	M9QQM0	Staphylococcus_phage	100.0	4.2e-218
WP_000050973.1|528513_528792_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_000395495.1|528803_529136_+	hypothetical protein	NA	A0A2I6PDD6	Staphylococcus_phage	99.1	8.2e-58
WP_000110020.1|529132_529534_+	hypothetical protein	NA	A0A2I6PDD3	Staphylococcus_phage	100.0	6.2e-68
WP_001023802.1|529534_529930_+	DUF3168 domain-containing protein	NA	A0A2I6PDD8	Staphylococcus_phage	100.0	2.6e-66
WP_000807541.1|529964_530606_+|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	99.1	5.0e-120
WP_000169127.1|530697_531153_+	Ig domain-containing protein	NA	A0A2I6PER6	Staphylococcus_phage	100.0	5.7e-78
WP_000589167.1|531210_531561_+	hypothetical protein	NA	A0A2I6PEQ2	Staphylococcus_phage	100.0	1.1e-55
WP_000438833.1|531602_531761_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_001003455.1|531774_537975_+|tail	phage tail tape measure protein	tail	M9QQM6	Staphylococcus_phage	99.4	0.0e+00
WP_001190533.1|537974_538799_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_000384474.1|538807_540391_+	peptidase	NA	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
WP_000179858.1|540390_540681_+	hypothetical protein	NA	U5U457	Staphylococcus_phage	100.0	2.1e-49
WP_000429558.1|540696_542607_+	minor structural protein	NA	A0A2I6PEQ9	Staphylococcus_phage	100.0	0.0e+00
WP_000067127.1|542606_544073_+|plate	BppU family phage baseplate upper protein	plate	A0A2I6PES7	Staphylococcus_phage	100.0	1.5e-273
WP_001166599.1|544072_544462_+	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000916020.1|544454_544619_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_000466784.1|544664_544964_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000339146.1|545099_545402_+|holin	phage holin	holin	A0A2I6PET6	Staphylococcus_phage	100.0	7.0e-48
WP_000909213.1|545412_546867_+	CHAP domain-containing protein	NA	U5U7D2	Staphylococcus_phage	100.0	2.6e-289
WP_000126130.1|547588_547804_+	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	2.0e-25
547600:547628	attR	ACCATCACATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_000476865.1|547893_548799_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000476354.1|548856_549753_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001557351.1|549828_550083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000913227.1|550223_551180_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001186912.1|551581_552127_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001151997.1|552232_552481_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163801.1|552588_553542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902099.1|553531_554911_+	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	33.6	1.4e-55
WP_000069291.1|555063_556524_+	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_001792205.1|556648_556765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001174258.1|556925_557912_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_000681757.1|558026_558995_-	asparaginase	NA	NA	NA	NA	NA
WP_000644391.1|559071_559731_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001795818.1|559761_559914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001792202.1|559994_560186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133961.1|560442_561618_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000165530.1|561839_563150_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000161745.1|563166_564165_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001043863.1|564335_564608_+	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|565038_565611_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774684.1|565613_566339_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001817755.1|566355_567300_+	heptaprenyl diphosphate synthase subunit II	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|567391_567841_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|568049_568250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269921.1|568635_569802_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	31.8	5.8e-34
WP_000776307.1|569827_570892_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_000253231.1|570901_572200_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000389524.1|572206_573451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005212.1|573464_574040_+	IDEAL domain-containing protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
WP_000154683.1|574029_574617_+	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_001827022.1|574688_575369_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000839926.1|575704_576022_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000690025.1|576265_577408_+	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000361540.1|577412_578615_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	4.2e-35
WP_000049921.1|578601_579573_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525078.1|579596_582290_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858779.1|582611_583904_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.3	8.7e-55
WP_000362218.1|584231_584918_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
>prophage 34
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	588658	589285	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_001108889.1|588658_589285_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.7e-24
>prophage 35
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	598610	599489	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|598610_599489_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 36
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	638324	647714	2860128		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|638324_639029_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|639273_639468_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000691942.1|639479_639731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000404645.1|639768_640893_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995287.1|640908_641346_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934894.1|641769_642726_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|642925_643405_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166059.1|643419_644259_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
WP_000159903.1|644344_644878_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|644870_645299_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473653.1|645310_645811_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|645810_646032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342132.1|646223_647714_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	2.9e-22
>prophage 37
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	651124	653136	2860128		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|651124_651784_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166801.1|651780_653136_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 38
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	659301	660093	2860128		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|659301_660093_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 39
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	663633	668664	2860128	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|663633_664770_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001788788.1|664801_665431_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis protein	lysis	NA	NA	NA	NA
WP_001215907.1|665449_665719_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|665881_666190_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|666360_666561_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|666757_667159_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216946.1|667398_668664_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
>prophage 40
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	676711	678313	2860128		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|676711_678313_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 41
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	683402	686856	2860128		Indivirus(50.0%)	3	NA	NA
WP_000079447.1|683402_684254_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
WP_000974847.1|684260_684902_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077571.1|685041_686856_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.1	5.1e-154
>prophage 42
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	690270	690972	2860128		Tupanvirus(100.0%)	1	NA	NA
WP_000571259.1|690270_690972_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.0e-13
>prophage 43
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	699068	701423	2860128		Acinetobacter_phage(100.0%)	3	NA	NA
WP_000153613.1|699068_699851_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.9	2.7e-27
WP_000173833.1|699852_700851_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	8.5e-34
WP_000604816.1|700856_701423_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 44
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	705741	707004	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|705741_707004_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 45
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	716663	721057	2860128		Bacillus_phage(50.0%)	2	NA	NA
WP_001289546.1|716663_719066_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.4	1.8e-93
WP_031771138.1|719065_721057_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	8.0e-116
>prophage 46
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	727048	728695	2860128		Vibrio_phage(100.0%)	1	NA	NA
WP_001088978.1|727048_728695_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 47
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	732363	733485	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691301.1|732363_733485_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 48
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	737635	743291	2860128		Phage_Wrath(25.0%)	7	NA	NA
WP_001208755.1|737635_738259_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	5.9e-17
WP_000380730.1|738638_739502_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	9.1e-16
WP_001791425.1|739575_739680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688122.1|739676_740654_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085655.1|740810_741080_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|741533_741683_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000082539.1|741773_743291_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 49
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	753429	757705	2860128		Bacillus_phage(50.0%)	6	NA	NA
WP_000841346.1|753429_753963_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|754101_754290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|754402_755005_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670307.1|755001_756093_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603970.1|756096_756828_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593436.1|756796_757705_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	3.1e-22
>prophage 50
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	762088	766392	2860128	head	Staphylococcus_phage(80.0%)	8	NA	NA
WP_000899334.1|762088_762325_-|head	phage head morphogenesis protein	head	Q4ZE35	Staphylococcus_virus	70.6	2.3e-22
WP_000956747.1|762370_762622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000477492.1|762749_762854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000006110.1|763364_763550_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_001788716.1|763973_764084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002340.1|764783_764990_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
WP_001795785.1|765283_765508_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	5.0e-19
WP_001791958.1|766194_766392_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.1e-09
>prophage 51
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	771461	771938	2860128		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|771461_771938_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 52
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	777880	784362	2860128		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103743.1|777880_778699_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|779173_779716_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516269.1|779721_781731_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.8e-60
WP_000073352.1|781743_784362_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
>prophage 53
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	793776	794820	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|793776_794820_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 54
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	799018	804559	2860128		Bacillus_virus(33.33%)	4	NA	NA
WP_000664775.1|799018_800305_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.4	7.9e-16
WP_000089941.1|800304_801570_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293306.1|801600_802314_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001811366.1|802318_804559_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	6.9e-84
>prophage 55
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	809699	821512	2860128	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864190.1|809699_810671_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282298.1|810685_811603_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|811771_812122_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043635.1|812507_814625_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020853.1|814629_814947_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|814943_815228_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097460.1|815248_816424_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036633.1|816444_816912_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001801936.1|817201_821512_-	DNA polymerase III subunit alpha	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 56
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	825785	826556	2860128		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473699.1|825785_826556_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 57
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	831335	845009	2860128	protease,tRNA	Erwinia_phage(16.67%)	10	NA	NA
WP_000379054.1|831335_832739_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	4.9e-27
WP_000072681.1|832804_833350_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015601.1|833346_834243_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	3.6e-31
WP_000195254.1|834660_835968_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|836123_838199_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000672869.1|839419_840664_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041666.1|840691_841810_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110253.1|842036_842945_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|842966_844133_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176393.1|844241_845009_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 58
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	858393	860643	2860128		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|858393_859125_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|859240_859474_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|859908_860643_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 59
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	871013	873008	2860128		Moumouvirus(100.0%)	1	NA	NA
WP_160199225.1|871013_873008_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.4	2.7e-23
>prophage 60
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	876155	877091	2860128	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|876155_877091_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 61
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	882103	884360	2860128		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|882103_883303_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|883518_883737_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368226.1|883736_884360_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	1.0e-21
>prophage 62
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	887674	888286	2860128		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|887674_888286_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 63
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	892253	896864	2860128		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|892253_893354_-	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_000767028.1|893355_894630_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|894647_895529_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|895556_896864_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 64
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	901328	904082	2860128	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384691.1|901328_904082_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 65
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	923665	923854	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245796.1|923665_923854_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	2.5e-19
>prophage 66
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	932870	934830	2860128		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001802045.1|932870_933095_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765708.1|933051_933198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857488.1|933870_934830_+	beta-channel forming cytolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
>prophage 67
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	950460	955018	2860128		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|950460_950775_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249272.1|950947_953296_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	3.2e-15
WP_000161938.1|953305_955018_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 68
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	960020	961079	2860128	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|960020_961079_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 69
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	973025	975933	2860128		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|973025_973508_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_001263796.1|973509_974052_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|974121_974511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|974513_974768_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757575.1|975006_975933_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	2.2e-12
>prophage 70
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	987450	989298	2860128		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182653.1|987450_989298_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 71
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	997430	1006263	2860128		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|997430_998525_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020625.1|998537_999077_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455597.1|999220_999496_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|999663_1001070_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863439.1|1001073_1002366_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|1002456_1003434_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|1003437_1004550_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668336.1|1004720_1005347_-	cell-wall-binding lipoprotein	NA	NA	NA	NA	NA
WP_000957037.1|1005711_1006263_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.0	1.6e-13
>prophage 72
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1012275	1016655	2860128		Bacillus_virus(50.0%)	5	NA	NA
WP_001289618.1|1012275_1012509_+	glutaredoxin family protein	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_000040051.1|1012745_1014464_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1014466_1014733_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505966.1|1014886_1015429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685067.1|1015482_1016655_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
>prophage 73
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1020086	1034848	2860128		Prochlorococcus_phage(22.22%)	14	NA	NA
WP_000921965.1|1020086_1021487_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273253.1|1021479_1022286_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101899.1|1022552_1023800_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709277.1|1023821_1025300_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_000238669.1|1025314_1025881_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
WP_000030811.1|1025883_1026912_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
WP_000483720.1|1026904_1028389_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
WP_000032740.1|1028367_1030557_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
WP_000666806.1|1030549_1031221_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000848350.1|1031222_1031486_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174053.1|1031485_1032190_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_001010413.1|1032193_1033318_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861573.1|1033304_1033787_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225836.1|1033987_1034848_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	4.4e-39
>prophage 74
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1045302	1049049	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001074534.1|1045302_1049049_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
>prophage 75
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1052715	1053726	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000676537.1|1052715_1053726_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.2e-16
>prophage 76
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1062031	1065752	2860128		Enterococcus_phage(50.0%)	7	NA	NA
WP_001788574.1|1062031_1062322_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	38.0	7.5e-07
WP_001790177.1|1062385_1062517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081351.1|1062562_1063522_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000766008.1|1064009_1064366_+	DoxX family protein	NA	NA	NA	NA	NA
WP_160199228.1|1064454_1064592_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001795266.1|1064732_1065023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571167.1|1065110_1065752_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-19
>prophage 77
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1075946	1081157	2860128	protease	Pithovirus(33.33%)	3	NA	NA
WP_001795272.1|1075946_1078271_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000928413.1|1078489_1079293_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049950.1|1079594_1081157_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
>prophage 78
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1100089	1101898	2860128		Streptococcus_phage(100.0%)	1	NA	NA
WP_160199229.1|1100089_1101898_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	4.2e-47
>prophage 79
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1107710	1109680	2860128		Bacillus_virus(100.0%)	2	NA	NA
WP_000427767.1|1107710_1108691_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.3e-15
WP_001067052.1|1108693_1109680_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	1.4e-15
>prophage 80
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1113331	1115345	2860128		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786734.1|1113331_1114273_-	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
WP_000140050.1|1114262_1115345_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 81
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1123936	1130746	2860128		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1123936_1125082_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047069.1|1125191_1126061_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353954.1|1126119_1128729_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.3	5.5e-117
WP_001044230.1|1128931_1130746_-	O-acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	6.7e-37
>prophage 82
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1135865	1139519	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_000154921.1|1135865_1139519_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.5	2.0e-24
>prophage 83
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1149673	1156854	2860128		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185319.1|1149673_1150603_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
WP_000138487.1|1151129_1152374_-	NAD-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_000167309.1|1152482_1153673_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.0e-33
WP_000838029.1|1153980_1155108_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1155468_1155846_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035063.1|1156260_1156854_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 84
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1166774	1170402	2860128		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009692.1|1166774_1168250_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	4.5e-47
WP_000046076.1|1168380_1169589_-	NADH dehydrogenase	NA	NA	NA	NA	NA
WP_001143495.1|1170042_1170402_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.7e-14
>prophage 85
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1174445	1177114	2860128		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1174445_1175660_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129659.1|1175656_1177114_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.5	2.6e-39
>prophage 86
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1180340	1238945	2860128	plate,head,holin,portal,capsid,tail,transposase,terminase,integrase	Staphylococcus_phage(77.14%)	84	1203808:1203824	1238561:1238577
WP_001557163.1|1180340_1181660_-|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
WP_000598444.1|1181865_1182249_-	YutD family protein	NA	NA	NA	NA	NA
WP_000201875.1|1182378_1183296_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_001241246.1|1183379_1184699_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000927632.1|1184725_1185553_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000608129.1|1185565_1186414_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_016170465.1|1186461_1186545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000267236.1|1186755_1187823_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_000582326.1|1187836_1188877_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000274029.1|1189241_1189556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000382163.1|1190386_1190587_-	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
WP_000139423.1|1190573_1190684_-	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	100.0	1.7e-12
WP_001788502.1|1190754_1190907_-	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
WP_160199230.1|1191151_1192606_-	CHAP domain-containing protein	NA	I1W626	Staphylococcus_phage	99.6	9.8e-289
WP_000339141.1|1192616_1192919_-|holin	phage holin	holin	A0A2I6PF56	Staphylococcus_phage	100.0	3.1e-48
WP_000398878.1|1192974_1193370_-	hypothetical protein	NA	Q4ZBP5	Staphylococcus_phage	100.0	2.7e-68
WP_031924638.1|1193374_1194613_-|plate	BppU family phage baseplate upper protein	plate	A0A0F6N3G7	Staphylococcus_phage	98.5	8.5e-209
WP_031924637.1|1194625_1196524_-	CHAP domain-containing protein	NA	B2ZZ02	Staphylococcus_phage	99.5	0.0e+00
WP_000466777.1|1196660_1196960_-	DUF2951 domain-containing protein	NA	A0A0F6N3M6	Staphylococcus_phage	100.0	9.9e-47
WP_000782200.1|1196999_1197173_-	XkdX family protein	NA	A0A0F6N3L7	Staphylococcus_phage	100.0	6.6e-27
WP_000705896.1|1197176_1197554_-	DUF2977 domain-containing protein	NA	A0A0F6N3G4	Staphylococcus_phage	100.0	1.5e-60
WP_160199231.1|1197553_1199377_-|plate	BppU family phage baseplate upper protein	plate	Q4ZDD5	Staphylococcus_virus	93.2	1.2e-283
WP_160199232.1|1199376_1201287_-	hypothetical protein	NA	I1W633	Staphylococcus_phage	99.4	0.0e+00
WP_160199233.1|1201301_1203203_-	peptidase	NA	Q4ZDD8	Staphylococcus_virus	99.8	0.0e+00
WP_000350680.1|1203211_1204159_-|tail	phage tail family protein	tail	Q8SDT6	Staphylococcus_phage	100.0	2.1e-183
1203808:1203824	attL	TGTTTTTATCTAATTTC	NA	NA	NA	NA
WP_160199234.1|1204171_1207639_-	hypothetical protein	NA	A1KX38	Staphylococcus_virus	98.6	5.3e-240
WP_000105584.1|1207655_1208000_-	hypothetical protein	NA	A0A0F6N3F7	Staphylococcus_phage	100.0	2.5e-57
WP_001100163.1|1208029_1208395_-	hypothetical protein	NA	Q8SDT9	Staphylococcus_phage	100.0	2.8e-59
WP_000002583.1|1208456_1209038_-|tail	phage major tail protein, TP901-1 family	tail	Q8SDU0	Staphylococcus_phage	100.0	4.9e-106
WP_000188652.1|1209056_1209440_-	hypothetical protein	NA	E0Y3L5	Staphylococcus_virus	100.0	2.6e-68
WP_001017811.1|1209451_1209799_-	HK97 gp10 family phage protein	NA	I1W643	Staphylococcus_phage	100.0	5.3e-60
WP_001268304.1|1209798_1210101_-	hypothetical protein	NA	E0Y3L3	Staphylococcus_virus	96.0	2.8e-49
WP_000208959.1|1210097_1210430_-|head,tail	phage head-tail connector protein	head,tail	E0Y3L2	Staphylococcus_virus	100.0	7.1e-54
WP_001609090.1|1210438_1210726_-	hypothetical protein	NA	E9LT47	Staphylococcus_phage	98.9	6.8e-45
WP_001609089.1|1210747_1211722_-|capsid	phage major capsid protein	capsid	I1W645	Staphylococcus_phage	98.5	7.7e-181
WP_000354305.1|1211735_1212350_-	DUF4355 domain-containing protein	NA	I1W646	Staphylococcus_phage	100.0	2.9e-40
WP_153095539.1|1212481_1212655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380771.1|1212736_1213732_-|head	phage head morphogenesis protein	head	E0Y3K7	Staphylococcus_virus	97.3	1.3e-180
WP_048520341.1|1213738_1215274_-|portal	phage portal protein	portal	A1KX25	Staphylococcus_virus	98.6	3.3e-287
WP_122888510.1|1215284_1216580_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0F6N3L3	Staphylococcus_phage	99.1	1.1e-254
WP_001038245.1|1216582_1217077_-|terminase	terminase small subunit	terminase	A0A0F6N3K6	Staphylococcus_phage	99.4	2.3e-88
WP_000162701.1|1217264_1217687_-	RinA family phage transcriptional activator	NA	A0A0F6N3E5	Staphylococcus_phage	100.0	1.2e-74
WP_000989998.1|1217710_1217857_-	hypothetical protein	NA	A0A059T5A8	Staphylococcus_phage	100.0	2.2e-15
WP_031925049.1|1217857_1218031_-	transcriptional regulator	NA	A9CR97	Staphylococcus_phage	98.2	7.5e-23
WP_031925048.1|1218027_1218414_-	phage protein	NA	Q4ZBK1	Staphylococcus_phage	91.4	1.6e-60
WP_000608276.1|1218406_1218643_-	hypothetical protein	NA	A0A2I6PEM4	Staphylococcus_phage	94.9	2.0e-34
WP_001613442.1|1218635_1218923_-	DUF1381 domain-containing protein	NA	Q4ZAB6	Staphylococcus_virus	96.8	4.4e-44
WP_000185706.1|1218959_1219490_-	hypothetical protein	NA	I1W653	Staphylococcus_phage	100.0	9.2e-96
WP_000097971.1|1219482_1219689_-	hypothetical protein	NA	A0A1W6JNF7	Staphylococcus_phage	81.2	1.6e-24
WP_031870214.1|1219688_1219931_-	DUF1024 family protein	NA	E9LT37	Staphylococcus_phage	98.8	1.3e-36
WP_000144708.1|1219923_1220232_-	hypothetical protein	NA	Q4ZBK6	Staphylococcus_phage	100.0	8.1e-52
WP_000979209.1|1220228_1220576_-	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
WP_000695759.1|1220572_1220974_-	hypothetical protein	NA	A0A0N7E0T5	Staphylococcus_phage	100.0	7.0e-72
WP_160199235.1|1220976_1221183_-	hypothetical protein	NA	A0A0N9BAW9	Staphylococcus_phage	94.1	2.8e-32
WP_160199236.1|1221197_1221446_-	hypothetical protein	NA	A0A2I6PDI0	Staphylococcus_phage	98.8	1.2e-42
WP_160199237.1|1221446_1221806_-	hypothetical protein	NA	A0A0E3T8L4	Staphylococcus_phage	98.3	5.0e-61
WP_054193486.1|1221806_1221992_-	DUF3113 family protein	NA	A0A068A236	Staphylococcus_phage	95.1	4.6e-26
WP_160199238.1|1221996_1222401_-	DUF1064 domain-containing protein	NA	G4KNP2	Staphylococcus_phage	99.3	4.8e-68
WP_001123679.1|1222411_1222633_-	DUF3269 family protein	NA	Q9G021	Staphylococcus_phage	98.6	3.8e-35
WP_064138655.1|1222645_1222804_-	hypothetical protein	NA	A0A2I6PDX0	Staphylococcus_phage	98.1	4.5e-22
WP_064138656.1|1222800_1223586_-	ATP-binding protein	NA	A0A059T7P1	Staphylococcus_phage	98.9	1.0e-143
WP_072470612.1|1223598_1224420_-	replication protein	NA	A0A059T619	Staphylococcus_phage	98.9	8.6e-117
WP_053005614.1|1224391_1225174_-	AP2 domain-containing protein	NA	A0A2I6PDA5	Staphylococcus_phage	98.0	4.1e-140
WP_160199239.1|1225173_1225839_-	hypothetical protein	NA	A7TWM9	Staphylococcus_phage	99.1	1.4e-125
WP_000704705.1|1225851_1226403_-	single-stranded DNA-binding protein	NA	Q4ZBM4	Staphylococcus_phage	100.0	3.4e-101
WP_000139738.1|1226432_1227212_-	ATP-binding protein	NA	Q9G028	Staphylococcus_virus	99.2	2.1e-141
WP_000815401.1|1227204_1227426_-	DUF2483 domain-containing protein	NA	A7TWM6	Staphylococcus_phage	100.0	3.2e-34
WP_015978341.1|1227435_1227696_-	DUF1108 family protein	NA	A0A0H4IP62	Staphylococcus_phage	100.0	2.0e-43
WP_000066019.1|1227787_1227949_-	DUF1270 family protein	NA	Q4ZB72	Staphylococcus_virus	100.0	2.5e-20
WP_000977381.1|1227941_1228163_-	hypothetical protein	NA	A0A0F6N3I2	Staphylococcus_phage	100.0	1.5e-31
WP_000993183.1|1228176_1228626_-	hypothetical protein	NA	A0A0H3U2S4	Staphylococcus_phage	100.0	2.3e-79
WP_000187184.1|1228665_1228890_-	hypothetical protein	NA	A0A0F6N4M2	Staphylococcus_phage	100.0	3.2e-34
WP_072433279.1|1228890_1229682_-	phage antirepressor KilAC domain-containing protein	NA	Q8SDX0	Staphylococcus_phage	99.2	7.2e-145
WP_000394020.1|1229869_1230073_-	hypothetical protein	NA	A0A0E3XBM9	Staphylococcus_phage	100.0	4.7e-32
WP_031790429.1|1230088_1230343_-	helix-turn-helix transcriptional regulator	NA	B7T095	Staphylococcus_virus	100.0	1.8e-41
WP_000874711.1|1230532_1231171_+	LexA family transcriptional regulator	NA	I1W622	Staphylococcus_phage	100.0	1.5e-116
WP_000896616.1|1231221_1231722_+	hypothetical protein	NA	B7T094	Staphylococcus_virus	100.0	1.1e-71
WP_031790428.1|1231725_1232241_+	hypothetical protein	NA	I1W624	Staphylococcus_phage	99.4	7.2e-37
WP_031764589.1|1232303_1233353_+|integrase	site-specific integrase	integrase	A1KWY3	Staphylococcus_virus	99.7	5.9e-203
WP_001074405.1|1233420_1234818_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_001010508.1|1234968_1235433_-	SUF system NifU family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_000807663.1|1235422_1236664_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	8.2e-111
WP_000205567.1|1236778_1238086_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1238183_1238945_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
1238561:1238577	attR	TGTTTTTATCTAATTTC	NA	NA	NA	NA
>prophage 87
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1242432	1243458	2860128		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571213.1|1242432_1243458_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
>prophage 88
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1246774	1251952	2860128		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1246774_1247131_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147952.1|1247274_1247595_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1247745_1248285_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150011.1|1248367_1249084_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.1	1.5e-16
WP_000974460.1|1249231_1249654_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569884.1|1250052_1250547_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255551.1|1250701_1251319_+	amino acid transporter	NA	NA	NA	NA	NA
WP_001802951.1|1251391_1251952_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.4	3.8e-31
>prophage 89
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1255352	1256596	2860128		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1255352_1255553_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_000141557.1|1255909_1256596_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	1.7e-33
>prophage 90
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1265658	1274535	2860128		Staphylococcus_phage(50.0%)	9	NA	NA
WP_000757397.1|1265658_1266387_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	37.5	1.3e-18
WP_001057759.1|1266578_1266725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058299.1|1266740_1267064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001085183.1|1268385_1268850_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	98.7	1.6e-80
WP_160199240.1|1268871_1271244_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	5.6e-92
WP_001165959.1|1271277_1272018_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_000556760.1|1272133_1272367_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1272433_1272892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1273230_1274535_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 91
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1283706	1289637	2860128		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1283706_1284294_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1284857_1285802_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_160199241.1|1285912_1286908_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	42.6	8.2e-53
WP_000369722.1|1286904_1287816_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1288701_1289637_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 92
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1294084	1296931	2860128		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662677.1|1294084_1296931_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 93
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1300249	1301089	2860128		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000753319.1|1300249_1301089_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 94
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1307167	1312873	2860128		Streptococcus_phage(66.67%)	5	NA	NA
WP_001557172.1|1307167_1308250_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	9.9e-44
WP_000686344.1|1308613_1309480_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192949.1|1309623_1310265_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
WP_000258150.1|1310429_1311485_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1311802_1312873_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 95
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1323672	1335495	2860128		uncultured_Caudovirales_phage(55.56%)	12	NA	NA
WP_000616840.1|1323672_1324434_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
WP_001245577.1|1324430_1325387_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|1325373_1326345_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|1326383_1326539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1326719_1327691_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855514.1|1327808_1329914_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1329876_1330275_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068501.1|1331075_1331942_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1331961_1332462_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1332802_1334308_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031760357.1|1334385_1334487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429006.1|1334577_1335495_+	lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.1e-07
>prophage 96
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1340059	1347145	2860128		Bacillus_virus(25.0%)	4	NA	NA
WP_000589248.1|1340059_1341037_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	7.1e-25
WP_000983677.1|1341258_1343040_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525106.1|1343051_1344935_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
WP_000098285.1|1345204_1347145_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 97
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1350284	1360131	2860128		Pandoravirus(12.5%)	12	NA	NA
WP_001217796.1|1350284_1351436_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.7	6.0e-23
WP_000604514.1|1351419_1352013_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_000446724.1|1352363_1353032_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1353033_1353453_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|1353456_1354170_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000604990.1|1354268_1354853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093562.1|1355132_1355573_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1355915_1356389_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1356363_1357050_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244415.1|1357049_1358105_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702781.1|1358176_1359160_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	43.3	1.5e-62
WP_000931238.1|1359291_1360131_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.5	9.6e-55
>prophage 98
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1371743	1373117	2860128		Megavirus(100.0%)	1	NA	NA
WP_000952041.1|1371743_1373117_-	deoxyribodipyrimidine photo-lyase	NA	K7Y8W8	Megavirus	31.6	2.8e-43
>prophage 99
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1378094	1384374	2860128		Bacillus_phage(33.33%)	6	NA	NA
WP_000857598.1|1378094_1379768_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.2	3.4e-11
WP_000737160.1|1379764_1381396_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	6.7e-12
WP_000469894.1|1381614_1382490_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1382661_1383345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148826.1|1383347_1383806_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820897.1|1383807_1384374_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	4.7e-21
>prophage 100
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1391164	1391638	2860128		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|1391164_1391638_-	cupin	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 101
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1396900	1397698	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|1396900_1397698_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 102
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1402529	1403291	2860128		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1402529_1403291_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 103
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1407665	1408709	2860128		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001030772.1|1407665_1408709_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 104
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1415232	1416030	2860128		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1415232_1416030_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 105
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1419255	1423214	2860128		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1419255_1420983_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793067.1|1421403_1422699_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1422815_1423214_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 106
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1430148	1430892	2860128		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1430148_1430892_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 107
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1443430	1443991	2860128	integrase	Streptococcus_phage(100.0%)	1	1437584:1437598	1447581:1447595
1437584:1437598	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|1443430_1443991_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|1443430_1443991_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
1447581:1447595	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 108
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1456819	1460173	2860128		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1456819_1457830_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001792725.1|1458328_1458850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000180234.1|1458877_1460173_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 109
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1467745	1469068	2860128		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860592.1|1467745_1469068_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	2.6e-107
>prophage 110
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1480372	1481029	2860128		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1480372_1481029_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 111
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1484670	1487991	2860128		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100835.1|1484670_1486047_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.5	3.9e-21
WP_000347061.1|1486590_1487991_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 112
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1511243	1511906	2860128		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1511243_1511906_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 113
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1518489	1519677	2860128		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|1518489_1519677_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 114
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1522705	1533659	2860128		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1522705_1524787_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1524909_1525380_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1525445_1525859_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1525956_1526211_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_001788197.1|1526347_1529944_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1530107_1533659_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 115
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1537342	1542125	2860128	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1537342_1537891_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1537903_1538086_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1538141_1538285_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872882.1|1538399_1538969_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664737.1|1539049_1539574_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1539573_1540320_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1540327_1540732_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631969.1|1540724_1542125_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.8	1.2e-54
>prophage 116
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1548136	1550593	2860128	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1548136_1550593_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpC	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 117
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1564220	1574491	2860128	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1564220_1565708_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1565760_1565853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613722.1|1566246_1566723_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1566719_1567085_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167944.1|1567062_1567866_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	3.0e-21
WP_000057594.1|1568081_1569014_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148598.1|1569192_1570074_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_160199244.1|1570301_1572395_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	2.4e-110
WP_000551283.1|1572651_1573191_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176709.1|1573195_1574491_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	4.8e-13
>prophage 118
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1583747	1586212	2860128		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1583747_1584713_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252543.1|1584859_1586212_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 119
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1592117	1595215	2860128	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051136.1|1592117_1594091_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.0	3.2e-93
WP_000279926.1|1594375_1595215_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 120
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1599121	1599739	2860128		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1599121_1599739_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 121
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1608878	1610576	2860128		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109040.1|1608878_1610576_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 122
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1627224	1633463	2860128		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170264.1|1627224_1628229_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.2	1.6e-24
WP_000825530.1|1628560_1629403_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467994.1|1629439_1630099_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569281.1|1630102_1631128_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	3.7e-32
WP_001036648.1|1631422_1632565_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634098.1|1632557_1633463_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	3.8e-49
>prophage 123
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1659409	1662169	2860128		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072584.1|1659409_1660621_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.2	2.2e-44
WP_031770049.1|1660624_1662169_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	97.9	1.8e-285
>prophage 124
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1674706	1680155	2860128	transposase	Paenibacillus_phage(25.0%)	5	NA	NA
WP_000159787.1|1674706_1674979_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	50.6	1.3e-13
WP_000041880.1|1675377_1676082_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	37.1	5.8e-29
WP_000551643.1|1676473_1677010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424963.1|1677122_1678664_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1678688_1680155_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 125
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1689115	1690639	2860128		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930514.1|1689115_1690639_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.4e-40
>prophage 126
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1698953	1705282	2860128		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000934799.1|1698953_1699457_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1699477_1699774_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052484.1|1700017_1700209_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	1.1e-22
WP_001218732.1|1700294_1701392_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1701403_1701607_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373073.1|1701636_1702518_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001557587.1|1702671_1703517_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655692.1|1704178_1705282_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 127
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1715220	1716063	2860128		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209551.1|1715220_1716063_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	3.8e-11
>prophage 128
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1737372	1740107	2860128		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280799.1|1737372_1738395_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_001191954.1|1738372_1739317_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449069.1|1739306_1740107_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.4	5.8e-41
>prophage 129
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1758346	1759024	2860128		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911017.1|1758346_1759024_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 130
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1774694	1779134	2860128		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549287.1|1774694_1779134_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	25.6	6.3e-28
>prophage 131
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1789739	1791401	2860128		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570070.1|1789739_1790399_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736784.1|1790450_1791401_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 132
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1800199	1801636	2860128		Pandoravirus(100.0%)	1	NA	NA
WP_000164003.1|1800199_1801636_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.1e-29
>prophage 133
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1805396	1809935	2860128		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000925394.1|1805396_1807136_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	1.5e-62
WP_000608818.1|1807395_1808070_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975351.1|1808213_1809935_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 134
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1819262	1820306	2860128		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645608.1|1819262_1820306_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	3.5e-14
>prophage 135
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1827520	1829050	2860128		Vibrio_phage(100.0%)	1	NA	NA
WP_000838205.1|1827520_1829050_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	4.5e-10
>prophage 136
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1837925	1839431	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008400.1|1837925_1839431_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 137
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1850538	1855897	2860128		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1850538_1852788_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837116.1|1853375_1854344_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127990.1|1854340_1855897_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 138
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1866107	1868167	2860128		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818915.1|1866107_1867205_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166920.1|1867588_1868167_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	39.1	9.7e-14
>prophage 139
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1876716	1879904	2860128		Planktothrix_phage(33.33%)	3	NA	NA
WP_000067352.1|1876716_1878309_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	4.1e-22
WP_000794565.1|1878818_1879016_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	43.3	2.1e-05
WP_000960712.1|1879181_1879904_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	4.1e-22
>prophage 140
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1883775	1884456	2860128		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571407.1|1883775_1884456_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	2.9e-33
>prophage 141
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1901261	1902446	2860128		Klosneuvirus(100.0%)	1	NA	NA
WP_001084442.1|1901261_1902446_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	2.0e-34
>prophage 142
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1907282	1917566	2860128		Tupanvirus(50.0%)	3	NA	NA
WP_160199262.1|1907282_1914458_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.7	4.5e-68
WP_000826861.1|1914904_1916155_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706135.1|1916540_1917566_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.5	8.5e-29
>prophage 143
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1921101	1924331	2860128		Bacillus_virus(50.0%)	4	NA	NA
WP_000590855.1|1921101_1921842_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	2.5e-38
WP_000171919.1|1922183_1922696_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_000356963.1|1922874_1923078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013485.1|1923371_1924331_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 144
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1927672	1930157	2860128		Catovirus(50.0%)	2	NA	NA
WP_000723436.1|1927672_1928818_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	25.9	4.6e-23
WP_000779504.1|1928894_1930157_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	4.3e-22
>prophage 145
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1936992	1943557	2860128		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|1936992_1938117_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028283.1|1938120_1939230_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1939242_1940271_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_160199250.1|1940260_1942084_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.8	3.4e-28
WP_000565304.1|1942103_1942868_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037332.1|1942870_1943557_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 146
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1947577	1948753	2860128		Clostridium_phage(100.0%)	1	NA	NA
WP_000469833.1|1947577_1948753_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.6	2.0e-29
>prophage 147
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1954192	1954966	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1954192_1954966_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 148
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1962997	1963597	2860128		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1962997_1963597_-	Superoxide dismutase [Mn/Fe] 2	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 149
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1968534	1973631	2860128		Catovirus(50.0%)	6	NA	NA
WP_001793242.1|1968534_1969515_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
WP_001789407.1|1969584_1969707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183771.1|1969850_1970627_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414629.1|1970838_1971465_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|1971660_1972425_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223713.1|1972428_1973631_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	3.9e-09
>prophage 150
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	1981897	1986107	2860128		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1981897_1982878_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1983108_1984101_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000924990.1|1984116_1985112_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136633.1|1985108_1986107_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.8	5.2e-15
>prophage 151
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2019182	2020247	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816133.1|2019182_2020247_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.8	7.7e-09
>prophage 152
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2030935	2037589	2860128		Streptococcus_phage(50.0%)	4	NA	NA
WP_000852430.1|2030935_2032957_-	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	29.0	6.6e-41
WP_000029431.1|2032975_2034652_-	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
WP_000631574.1|2034672_2034753_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000446429.1|2034919_2037589_+	sensor histidine kinase KdpD	NA	A0A2K9L0Z8	Tupanvirus	21.5	6.0e-10
>prophage 153
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2045371	2051703	2860128	transposase	Bacillus_phage(66.67%)	7	NA	NA
WP_000815646.1|2045371_2046721_+	recombinase family protein	NA	Q9T200	Bacillus_phage	25.1	1.4e-18
WP_001186602.1|2046742_2048371_+	recombinase family protein	NA	A0A0S2SXR4	Bacillus_phage	31.4	2.4e-46
WP_000859155.1|2048888_2049239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700853.1|2049325_2049637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160199252.1|2049654_2050161_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_000659050.1|2050181_2050499_+	RadC family protein	NA	NA	NA	NA	NA
WP_000868132.1|2050617_2051703_+|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
>prophage 154
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2055034	2055766	2860128		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|2055034_2055766_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 155
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2074569	2084579	2860128		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2074569_2075370_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104165.1|2075758_2076547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060140.1|2076547_2077882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|2077874_2079701_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|2079713_2080415_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2081617_2082901_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2083178_2084579_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 156
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2091269	2100315	2860128	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884332.1|2091269_2092556_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	4.5e-88
WP_000177465.1|2092934_2094449_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.2e-90
WP_000449218.1|2094774_2095587_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819067.1|2095674_2098344_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	4.6e-119
WP_000255578.1|2098380_2100315_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
>prophage 157
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2110415	2116972	2860128		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_000742837.1|2110415_2111255_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491382.1|2111705_2112059_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2112126_2112522_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054128.1|2112781_2113351_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|2113468_2113669_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_000672033.1|2114060_2114252_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_000143647.1|2114343_2116224_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|2116213_2116972_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 158
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2131225	2132938	2860128		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138654.1|2131225_2132938_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 159
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2138566	2139580	2860128		Faustovirus(100.0%)	1	NA	NA
WP_000639184.1|2138566_2139580_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.9	9.6e-09
>prophage 160
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2151919	2152612	2860128		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|2151919_2152612_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 161
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2178710	2180570	2860128		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125628.1|2178710_2180570_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 162
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2206253	2208004	2860128		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143425.1|2206253_2207141_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	2.5e-05
WP_000923760.1|2207248_2208004_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 163
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2211424	2211922	2860128		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2211424_2211922_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 164
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2216916	2219300	2860128		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071729.1|2216916_2218767_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	9.3e-236
WP_000173331.1|2218763_2219300_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.0	3.9e-41
>prophage 165
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2224178	2234292	2860128	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2224178_2225888_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2226165_2226378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028775.1|2226657_2227101_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172341.1|2227294_2228893_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_001791980.1|2228952_2229282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2229577_2231074_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031409.1|2231267_2232158_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237629.1|2232280_2232697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030072.1|2232954_2234292_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.0e-18
>prophage 166
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2264625	2268414	2860128		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751263.1|2264625_2265327_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	5.2e-38
WP_000379821.1|2266602_2268414_+	O-acetyltransferase OatA	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 167
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2276848	2280963	2860128		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161369.1|2276848_2277847_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	1.0e-34
WP_000076661.1|2277937_2278144_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024139.1|2278554_2280963_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	3.2e-127
>prophage 168
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2290204	2293240	2860128	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058993.1|2290204_2292310_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
WP_000455988.1|2292718_2293240_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
>prophage 169
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2299666	2306050	2860128		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062663.1|2299666_2301406_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473679.1|2301706_2303773_+	PTS glucoside EIICBA component	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206031.1|2304152_2304563_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2304604_2304961_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228167.1|2305081_2306050_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	4.0e-12
>prophage 170
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2315339	2316332	2860128		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161545.1|2315339_2316332_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	3.7e-37
>prophage 171
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2325610	2326306	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000538625.1|2325610_2326306_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	3.0e-38
>prophage 172
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2345056	2345923	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_000721336.1|2345056_2345923_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	1.3e-78
>prophage 173
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2354106	2359302	2860128		Streptococcus_phage(50.0%)	3	NA	NA
WP_075339662.1|2354106_2355915_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.3	6.6e-93
WP_000755946.1|2356046_2356439_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000088733.1|2356440_2359302_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	3.1e-28
>prophage 174
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2367144	2367840	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_000217456.1|2367144_2367840_+	oxidoreductase	NA	W8CYX9	Bacillus_phage	35.6	4.3e-08
>prophage 175
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2372394	2373213	2860128		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824948.1|2372394_2373213_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	27.2	1.3e-08
>prophage 176
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2381265	2382823	2860128		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173871.1|2381265_2382081_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	8.8e-13
WP_000598772.1|2382073_2382823_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	9.0e-20
>prophage 177
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2390094	2394523	2860128		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000923526.1|2390094_2390757_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.8	5.5e-21
WP_000072149.1|2390749_2391526_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026189.1|2391921_2393109_+	DHA family class C beta-lactamase	NA	NA	NA	NA	NA
WP_160199255.1|2393170_2394523_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 178
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2397917	2399776	2860128		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948974.1|2397917_2399144_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|2399140_2399776_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 179
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2417503	2423765	2860128		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2417503_2418646_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779360.1|2418913_2419300_+	GtrA family protein	NA	NA	NA	NA	NA
WP_000482652.1|2419433_2419541_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064825.1|2420243_2422007_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	2.5e-36
WP_000486487.1|2422031_2423765_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 180
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2427226	2432997	2860128		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971550.1|2427226_2428342_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	1.6e-20
WP_000286875.1|2428352_2429045_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200956.1|2429055_2429523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783428.1|2429574_2430552_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916704.1|2430553_2431501_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	3.2e-139
WP_000594519.1|2432067_2432997_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 181
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2441054	2441786	2860128		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|2441054_2441786_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 182
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2458435	2459995	2860128		Escherichia_phage(100.0%)	1	NA	NA
WP_000692648.1|2458435_2459995_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 183
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2481323	2482358	2860128		Bacillus_virus(100.0%)	1	NA	NA
WP_000655971.1|2481323_2482358_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 184
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2492202	2496099	2860128		Hokovirus(33.33%)	4	NA	NA
WP_000477338.1|2492202_2493576_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	2.3e-13
WP_000249497.1|2493568_2494243_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761395.1|2494378_2495434_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229920.1|2495433_2496099_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
>prophage 185
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2499835	2501044	2860128		Salmonella_phage(100.0%)	1	NA	NA
WP_000999131.1|2499835_2501044_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	3.9e-33
>prophage 186
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2513134	2514034	2860128		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524830.1|2513134_2514034_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 187
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2521406	2521826	2860128		Bacillus_phage(100.0%)	1	NA	NA
WP_000920239.1|2521406_2521826_-	FosB1/FosB3 family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	2.6e-37
>prophage 188
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2527518	2528400	2860128		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000235289.1|2527518_2528400_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	3.8e-62
>prophage 189
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2536278	2536914	2860128		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2536278_2536914_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 190
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2549857	2553837	2860128		Staphylococcus_phage(50.0%)	4	NA	NA
WP_011447058.1|2549857_2550496_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6JQU5	Staphylococcus_phage	48.1	2.6e-36
WP_000684147.1|2550806_2551931_+	NAD(P)-binding protein	NA	A0A2K9L3K5	Tupanvirus	22.8	9.3e-13
WP_000417018.1|2552022_2552976_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	6.4e-31
WP_000737705.1|2553336_2553837_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 191
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2557754	2558558	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717381.1|2557754_2558558_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.3e-07
>prophage 192
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2577538	2578144	2860128		Pithovirus(100.0%)	1	NA	NA
WP_000913024.1|2577538_2578144_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.1	4.3e-12
>prophage 193
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2590114	2593282	2860128		Leptospira_phage(100.0%)	1	NA	NA
WP_000592307.1|2590114_2593282_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	1.1e-61
>prophage 194
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2616965	2618632	2860128		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389658.1|2616965_2617775_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.7e-19
WP_000155387.1|2617771_2618632_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	9.7e-10
>prophage 195
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2627414	2635070	2860128		Enterobacteria_phage(33.33%)	7	NA	NA
WP_000411031.1|2627414_2628431_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.7	1.0e-18
WP_000655241.1|2629004_2629187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130149.1|2629680_2631345_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	8.0e-45
WP_000186134.1|2631381_2632086_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769705.1|2632469_2632895_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044362.1|2633189_2634005_+	hydrolase	NA	NA	NA	NA	NA
WP_001044441.1|2634215_2635070_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	37.9	4.9e-06
>prophage 196
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2638452	2640762	2860128		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001015500.1|2638452_2639301_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
WP_000875476.1|2639533_2639737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791678.1|2639823_2639985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557494.1|2640021_2640762_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 197
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2647082	2648495	2860128		Pandoravirus(100.0%)	1	NA	NA
WP_000169224.1|2647082_2648495_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 198
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2653977	2655540	2860128		Vibrio_phage(100.0%)	1	NA	NA
WP_000792342.1|2653977_2655540_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 199
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2665742	2666711	2860128		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2665742_2666711_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 200
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2684163	2685072	2860128		Klosneuvirus(100.0%)	1	NA	NA
WP_000167867.1|2684163_2685072_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 201
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2688663	2696109	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001048259.1|2688663_2696109_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	31.5	3.9e-22
>prophage 202
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2702365	2705185	2860128		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334463.1|2702365_2704171_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
WP_000908182.1|2704402_2705185_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.3e-09
>prophage 203
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2716365	2720196	2860128		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2716365_2716809_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2716929_2717640_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083318.1|2717953_2718616_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242311.1|2718894_2720196_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	3.6e-133
>prophage 204
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2728136	2729747	2860128		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2728136_2729747_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 205
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2737550	2745300	2860128		Bacillus_virus(25.0%)	9	NA	NA
WP_000273358.1|2737550_2738150_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2738150_2739227_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248732.1|2739213_2740050_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_015445903.1|2740082_2741180_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.3	2.3e-40
WP_000697334.1|2741176_2741596_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654184.1|2741702_2742227_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2742253_2743492_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2743519_2744149_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723418.1|2744172_2745300_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 206
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2755704	2756100	2860128		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|2755704_2756100_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 207
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2762371	2763019	2860128		Moumouvirus(100.0%)	1	NA	NA
WP_001187630.1|2762371_2763019_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 208
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2770219	2771740	2860128		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2770219_2771740_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 209
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2778930	2780958	2860128		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000546611.1|2778930_2780958_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	2.3e-25
>prophage 210
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2786107	2789491	2860128		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2786107_2786470_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390827.1|2786818_2787820_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2787938_2788265_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190829.1|2788266_2788746_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041111.1|2788720_2789491_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	2.2e-21
>prophage 211
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2803075	2807799	2860128		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094583.1|2803075_2804605_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_072399972.1|2804634_2805654_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2805775_2806030_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_160195538.1|2806029_2807799_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.6	7.0e-63
>prophage 212
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2811559	2825620	2860128	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159042.1|2811559_2812585_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.6	3.4e-62
WP_000106332.1|2812899_2814510_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	28.1	1.9e-19
WP_001792272.1|2814598_2814727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602057.1|2814871_2816800_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	30.2	9.3e-53
WP_001283612.1|2817052_2817688_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_072414299.1|2818042_2819071_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581076.1|2819130_2819355_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052270.1|2819562_2820813_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
WP_000790331.1|2820995_2821946_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_000141432.1|2822094_2823579_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	26.5	2.3e-19
WP_001253312.1|2823575_2824535_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|2824903_2825620_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 213
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2832801	2834778	2860128		uncultured_virus(100.0%)	2	NA	NA
WP_000917289.1|2832801_2833086_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240655.1|2833161_2834778_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
>prophage 214
NZ_CP047859	Staphylococcus aureus strain UP_1405 chromosome, complete genome	2860128	2838727	2859658	2860128	integrase	Staphylococcus_phage(97.22%)	38	2841570:2841584	2851273:2851287
WP_000791411.1|2838727_2839783_+	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
WP_000595392.1|2839804_2840821_+	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.2	6.7e-26
2841570:2841584	attL	CTATCATTATCGAAT	NA	NA	NA	NA
WP_000857180.1|2841939_2842977_-|integrase	site-specific integrase	integrase	Q38086	Staphylococcus_phage	98.6	1.4e-175
WP_000427213.1|2843039_2843282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001558608.1|2843292_2844276_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000694772.1|2844375_2844558_-	hypothetical protein	NA	A0A2I6PDF8	Staphylococcus_phage	100.0	6.9e-27
WP_000591749.1|2844761_2845103_-	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
WP_000759682.1|2845108_2846041_-	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
WP_001031454.1|2846056_2846770_-	helix-turn-helix transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
WP_000854072.1|2846903_2847167_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
WP_001025404.1|2847182_2847398_+	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
WP_000128909.1|2847386_2847716_-	hypothetical protein	NA	M9NS98	Staphylococcus_phage	98.2	5.1e-52
WP_001148605.1|2847766_2848519_+	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
WP_001148856.1|2848534_2848732_+	hypothetical protein	NA	O80075	Staphylococcus_phage	100.0	2.5e-30
WP_000762521.1|2848718_2849099_-	DUF2513 domain-containing protein	NA	Q9T1Z5	Staphylococcus_phage	100.0	1.2e-68
WP_001120201.1|2849153_2849477_+	DUF771 domain-containing protein	NA	A0A075LYF5	Staphylococcus_phage	100.0	3.0e-57
WP_000048129.1|2849473_2849635_+	DUF1270 family protein	NA	A0A1P8L6G0	Staphylococcus_phage	100.0	1.9e-20
WP_000165371.1|2849729_2850032_+	DUF2482 family protein	NA	A0A1P8L6F8	Staphylococcus_phage	100.0	7.0e-48
WP_000291510.1|2850036_2850297_+	DUF1108 family protein	NA	A0A1P8L6F5	Staphylococcus_phage	100.0	5.2e-44
WP_001205732.1|2850305_2850569_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_160195539.1|2850577_2852521_+	AAA family ATPase	NA	A0A1P8L6F1	Staphylococcus_phage	99.8	0.0e+00
2851273:2851287	attR	ATTCGATAATGATAG	NA	NA	NA	NA
WP_000180600.1|2852522_2853443_+	recombinase RecT	NA	A0A1P8L6F6	Staphylococcus_phage	100.0	5.1e-166
WP_064135358.1|2853523_2854141_+	MBL fold metallo-hydrolase	NA	A0A1P8L6F7	Staphylococcus_phage	100.0	1.2e-86
WP_000934759.1|2854141_2854612_+	single-stranded DNA-binding protein	NA	A0A1P8L6D9	Staphylococcus_phage	100.0	5.7e-81
WP_000148333.1|2854641_2855535_+	DnaD domain-containing protein	NA	A0A1P8L6F0	Staphylococcus_phage	100.0	3.2e-141
WP_000338528.1|2855541_2855760_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401969.1|2855768_2856173_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A075M042	Staphylococcus_phage	100.0	8.4e-73
WP_000101279.1|2856185_2856557_+	hypothetical protein	NA	A0A2I6PDG3	Staphylococcus_phage	91.1	1.4e-50
WP_000111491.1|2856556_2856814_+	DUF3310 domain-containing protein	NA	A0A1X9H067	Staphylococcus_phage	98.8	6.3e-42
WP_000178987.1|2856810_2857059_+	hypothetical protein	NA	A0A0K1LL46	Staphylococcus_phage	96.3	7.5e-40
WP_001065108.1|2857073_2857319_+	DUF1024 family protein	NA	Q8SDV5	Staphylococcus_phage	95.1	1.7e-36
WP_000185693.1|2857315_2857852_+	hypothetical protein	NA	Q9MBR0	Staphylococcus_prophage	100.0	1.6e-95
WP_001282077.1|2857888_2858134_+	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	98.8	2.5e-35
WP_000195784.1|2858130_2858337_+	DUF1381 domain-containing protein	NA	A0A2I6PEA2	Staphylococcus_phage	94.1	1.1e-17
WP_000595265.1|2858333_2858483_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_001557462.1|2858482_2858683_+	DUF1514 domain-containing protein	NA	D2JLD9	Staphylococcus_phage	98.5	5.3e-28
WP_000590122.1|2858710_2859127_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988332.1|2859358_2859658_+	HNH endonuclease	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
