The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028208	Bacillus velezensis strain SRCM102744 chromosome, complete genome	4100472	1052975	1098084	4100472	protease,coat	Cafeteria_roenbergensis_virus(11.11%)	47	NA	NA
WP_012118691.1|1052975_1053635_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003151042.1|1053740_1053929_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_012118692.1|1053966_1054386_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032865071.1|1054770_1056150_+	amino acid permease	NA	NA	NA	NA	NA
WP_007407653.1|1056214_1056715_-	YwgA family protein	NA	NA	NA	NA	NA
WP_136396689.1|1056754_1058056_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
WP_003151034.1|1058215_1058440_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_012118695.1|1058642_1059416_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_015240785.1|1059715_1059991_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_053573954.1|1059991_1060546_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_020957981.1|1060643_1061564_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.7e-36
WP_136396692.1|1061560_1062514_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_160223332.1|1062503_1063340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025285431.1|1063330_1064128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040238741.1|1064096_1065020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003151018.1|1065068_1065248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160223333.1|1065399_1066263_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_039253434.1|1066309_1067209_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
WP_160223334.1|1067324_1068302_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
WP_003151012.1|1068338_1069310_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_003151011.1|1069571_1070336_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_007407669.1|1070455_1071235_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025285436.1|1071251_1072451_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_124692678.1|1072463_1073645_-	MFS transporter	NA	NA	NA	NA	NA
WP_012118706.1|1073641_1075060_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_007407673.1|1075077_1075839_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	4.8e-21
WP_003151000.1|1075835_1076546_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_015418458.1|1076535_1077150_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_132105635.1|1077310_1078549_-	MFS transporter	NA	NA	NA	NA	NA
WP_015240794.1|1078771_1079974_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.4	1.1e-27
WP_012118711.1|1080006_1081425_-	amino acid permease	NA	NA	NA	NA	NA
WP_061581650.1|1081449_1083132_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_015240796.1|1083203_1084751_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003150991.1|1084958_1086245_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_022537147.1|1086429_1086891_-	member of the processed secretome	NA	NA	NA	NA	NA
WP_033574365.1|1087106_1087562_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_012118721.1|1087558_1088407_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	3.1e-37
WP_007407684.1|1088427_1089375_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
WP_031378582.1|1089377_1090115_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_160223335.1|1090142_1091147_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_160223336.1|1091148_1091892_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_012118725.1|1091881_1093003_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_059367570.1|1093002_1093866_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_160223337.1|1093866_1095036_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_114354765.1|1095058_1096483_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_015240806.1|1096487_1097258_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	25.4	5.8e-06
WP_007614539.1|1097538_1098084_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 2
NZ_CP028208	Bacillus velezensis strain SRCM102744 chromosome, complete genome	4100472	2041001	2050892	4100472		Synechococcus_phage(50.0%)	9	NA	NA
WP_082999062.1|2041001_2042294_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.0	7.7e-19
WP_025284370.1|2042369_2043089_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	45.2	2.6e-48
WP_003155758.1|2043088_2043343_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_007408898.1|2043339_2044023_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_082999063.1|2044006_2046235_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	1.0e-156
WP_007609856.1|2046210_2047641_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_094031563.1|2047732_2048773_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	3.7e-64
WP_007408902.1|2048769_2049357_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
WP_025284372.1|2049353_2050892_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	6.7e-78
>prophage 3
NZ_CP028208	Bacillus velezensis strain SRCM102744 chromosome, complete genome	4100472	2517412	2563915	4100472	integrase,coat,tRNA	Bacillus_phage(20.0%)	53	2562851:2562864	2563929:2563942
WP_015417209.1|2517412_2518405_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025284554.1|2519148_2520783_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015239567.1|2520889_2521825_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409113.1|2521828_2522746_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_003155039.1|2522758_2523835_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
WP_015239568.1|2523827_2524745_+	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_160222960.1|2524851_2526039_+	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_007409110.1|2526156_2526735_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003155034.1|2526913_2527309_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_007409109.1|2527366_2528023_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	9.9e-31
WP_160222961.1|2528298_2528955_+	adaptor protein MecA	NA	NA	NA	NA	NA
WP_160222962.1|2529105_2530266_+	competence protein CoiA	NA	NA	NA	NA	NA
WP_007409107.1|2530493_2532323_+	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_003155024.1|2532813_2533716_-	DsbA family protein	NA	NA	NA	NA	NA
WP_003155023.1|2533712_2534111_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
WP_007409105.1|2534339_2535026_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	71.2	7.9e-39
WP_014417426.1|2535030_2535603_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_003155020.1|2535727_2536093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610625.1|2536120_2536756_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_003155018.1|2536773_2537574_+	NAD kinase	NA	NA	NA	NA	NA
WP_150941121.1|2537588_2538482_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.8e-06
WP_007409101.1|2538515_2539265_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
WP_032871197.1|2539492_2541337_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_082998108.1|2541586_2542294_+	thiaminase II	NA	NA	NA	NA	NA
WP_015239576.1|2542271_2542889_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
WP_025284562.1|2542872_2543982_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
WP_007409096.1|2543978_2544182_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_007610655.1|2544178_2544949_+	thiazole synthase	NA	NA	NA	NA	NA
WP_082997844.1|2544945_2545956_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
WP_015417222.1|2545978_2546791_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_082997845.1|2546921_2547698_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_160222963.1|2547795_2548404_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239582.1|2548461_2548905_-|coat	Spore coat protein Z	coat	NA	NA	NA	NA
WP_003154995.1|2549050_2549533_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239583.1|2549683_2550184_-|coat	spore coat protein X	coat	NA	NA	NA	NA
WP_015239584.1|2550276_2550591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154992.1|2550628_2551015_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_015239585.1|2551185_2551542_+	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_012117306.1|2551828_2552026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610678.1|2552117_2552279_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154986.1|2552445_2552700_+	sporulation protein	NA	NA	NA	NA	NA
WP_032874483.1|2552768_2555054_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.3	1.9e-84
WP_007409082.1|2555172_2555427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_136396270.1|2555495_2556245_+	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_015239588.1|2556286_2557009_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_007409079.1|2557001_2557739_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	2.6e-27
WP_007409078.1|2557739_2557973_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012117312.1|2558133_2558565_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007610690.1|2558569_2559085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012117313.1|2559110_2559833_-	esterase family protein	NA	NA	NA	NA	NA
WP_012117314.1|2560201_2561323_+	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.7	3.3e-18
WP_052827270.1|2561315_2562491_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
2562851:2562864	attL	GGCGTTCTTTTTTT	NA	NA	NA	NA
WP_024085137.1|2562865_2563915_+|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	27.9	1.3e-08
WP_024085137.1|2562865_2563915_+|integrase	tyrosine-type recombinase/integrase	integrase	Q938N9	Temperate_phage	27.9	1.3e-08
2563929:2563942	attR	AAAAAAAGAACGCC	NA	NA	NA	NA
>prophage 4
NZ_CP028208	Bacillus velezensis strain SRCM102744 chromosome, complete genome	4100472	2623714	2659059	4100472	plate,tail,portal,terminase,holin	Bacillus_phage(34.38%)	47	NA	NA
WP_025284598.1|2623714_2625073_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.1	2.7e-14
WP_082187759.1|2625182_2625281_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_025284599.1|2625422_2625614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284601.1|2625687_2626452_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_025284602.1|2626596_2627064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087920760.1|2627269_2628406_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
WP_003154881.1|2628395_2628530_+	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_015417280.1|2628672_2629626_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_007610770.1|2629663_2630041_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_047935636.1|2630150_2630756_+	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	1.0e-42
WP_007610775.1|2630874_2631465_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_003154871.1|2631613_2631952_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_007407285.1|2632142_2632322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025284603.1|2632311_2633139_+	hypothetical protein	NA	S6BFM4	Thermus_phage	49.0	2.2e-19
WP_014417520.1|2633038_2633839_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
WP_100001386.1|2634103_2634445_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_100001388.1|2634434_2634638_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	51.5	1.4e-12
WP_007407279.1|2634751_2635264_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	3.8e-22
WP_100001390.1|2635376_2636174_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.8	1.6e-59
WP_025284605.1|2636170_2637469_+|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	9.4e-150
WP_160223388.1|2637517_2638909_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.8e-138
WP_160222991.1|2638928_2639774_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
WP_007407274.1|2639800_2640736_+|portal	phage portal protein	portal	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_015239680.1|2640752_2641136_+	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407272.1|2641132_2641489_+	DUF3599 family protein	NA	NA	NA	NA	NA
WP_042635121.1|2641485_2641989_+	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.1	2.7e-36
WP_160222992.1|2641985_2642432_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_160222993.1|2642428_2642638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610810.1|2642637_2644035_+|portal	phage portal protein	portal	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_003154837.1|2644036_2644480_+|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_003154836.1|2644555_2645002_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_015239684.1|2645043_2645196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160222994.1|2645183_2650229_+	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	47.0	8.7e-42
WP_160222995.1|2650221_2650881_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.4e-08
WP_044802866.1|2650894_2651872_+	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.9	2.9e-34
WP_007610818.1|2651871_2652138_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_003154825.1|2652241_2652667_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	1.5e-11
WP_076423970.1|2652659_2653706_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.3e-69
WP_015239689.1|2653689_2654268_+	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.9	3.1e-12
WP_060674884.1|2654264_2654537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052827325.1|2654539_2656171_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.5	1.6e-53
WP_043021266.1|2656183_2656555_+	YomQ/XkdW protein, phage-like element PBSX	NA	NA	NA	NA	NA
WP_007610833.1|2656559_2656757_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
WP_160222996.1|2656813_2657575_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_003154815.1|2657626_2657890_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_003154813.1|2657903_2658167_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_007407257.1|2658180_2659059_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 5
NZ_CP028208	Bacillus velezensis strain SRCM102744 chromosome, complete genome	4100472	3210770	3216984	4100472		Bacillus_phage(50.0%)	7	NA	NA
WP_003154061.1|3210770_3211163_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
WP_007611605.1|3211122_3213225_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_012117608.1|3213242_3214232_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_012117609.1|3214280_3214901_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
WP_160223066.1|3214950_3215709_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	8.1e-53
WP_007410369.1|3215742_3215967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417523.1|3216015_3216984_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 6
NZ_CP028208	Bacillus velezensis strain SRCM102744 chromosome, complete genome	4100472	3537642	3546586	4100472	holin	Bacillus_phage(100.0%)	9	NA	NA
WP_045926142.1|3537642_3538002_-	hypothetical protein	NA	O64028	Bacillus_phage	60.5	2.9e-32
WP_082786706.1|3538688_3538772_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_160223130.1|3539027_3539366_-	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	60.2	9.3e-25
WP_032870004.1|3540125_3540722_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	81.4	6.3e-85
WP_032870144.1|3540783_3541281_-	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	90.9	2.1e-89
WP_160223131.1|3541289_3543005_-	ribonuclease YeeF family protein	NA	O64023	Bacillus_phage	76.4	1.1e-249
WP_076982865.1|3543041_3543476_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_160223132.1|3543740_3544706_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	75.0	5.5e-78
WP_160223133.1|3544921_3546586_+	recombinase family protein	NA	O64015	Bacillus_phage	91.2	9.2e-275
>prophage 7
NZ_CP028208	Bacillus velezensis strain SRCM102744 chromosome, complete genome	4100472	3582558	3589374	4100472		Bacillus_phage(85.71%)	13	NA	NA
WP_102422238.1|3582558_3583113_-	hypothetical protein	NA	O64195	Bacillus_phage	93.3	3.8e-92
WP_014470254.1|3583210_3583450_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_052749755.1|3583680_3584355_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_160229003.1|3584390_3584726_-	hypothetical protein	NA	F8WPK8	Bacillus_phage	66.0	3.5e-40
WP_068947579.1|3584749_3584971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559717.1|3585018_3585240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559718.1|3585249_3586077_-	metallophosphoesterase	NA	O64184	Bacillus_phage	89.1	7.5e-153
WP_042976081.1|3586236_3586449_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	100.0	4.1e-31
WP_046559719.1|3586530_3586719_-	hypothetical protein	NA	A0A1P8CX75	Bacillus_phage	98.4	2.7e-26
WP_046559720.1|3587079_3587373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559721.1|3587956_3588313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559722.1|3588372_3588738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046559723.1|3588867_3589374_-	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	38.0	2.2e-30
>prophage 8
NZ_CP028208	Bacillus velezensis strain SRCM102744 chromosome, complete genome	4100472	3595713	3652134	4100472	terminase,integrase	Bacillus_phage(98.36%)	87	3588756:3588775	3646723:3646742
3588756:3588775	attL	TTATTTTATTTTTATTCTAA	NA	NA	NA	NA
WP_072589213.1|3595713_3596235_-	HNH endonuclease	NA	A0A1P8CX39	Bacillus_phage	92.5	5.7e-90
WP_160229007.1|3599067_3599745_-	ribonucleotide-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	92.4	1.8e-115
WP_145979853.1|3599752_3600148_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	85.5	1.3e-57
WP_096034949.1|3600144_3600495_-	hypothetical protein	NA	O64171	Bacillus_phage	45.8	1.4e-20
WP_077722329.1|3600697_3601030_-	hypothetical protein	NA	O64168	Bacillus_phage	90.7	2.9e-15
WP_160228872.1|3601061_3601529_-	hypothetical protein	NA	O64167	Bacillus_phage	77.6	4.5e-62
WP_160229009.1|3601543_3601756_-	DUF1653 domain-containing protein	NA	A0A1P8CX21	Bacillus_phage	75.4	2.8e-27
WP_160228874.1|3601770_3601962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228876.1|3601982_3602213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228878.1|3602514_3602868_-	hypothetical protein	NA	O64166	Bacillus_phage	84.3	8.1e-48
WP_160228879.1|3603264_3603612_-	hypothetical protein	NA	O64164	Bacillus_phage	91.3	7.0e-52
WP_160228881.1|3603626_3604022_-	hypothetical protein	NA	O64163	Bacillus_phage	85.5	1.9e-61
WP_020954083.1|3604054_3604234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228883.1|3604265_3604736_-	hypothetical protein	NA	O64162	Bacillus_phage	87.2	1.6e-75
WP_160228885.1|3604768_3604945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228887.1|3604971_3605199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228889.1|3605992_3606751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021493499.1|3606938_3607136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228891.1|3607150_3607378_-	hypothetical protein	NA	A0A1P8CX31	Bacillus_phage	78.7	1.7e-27
WP_160229011.1|3607415_3607631_-	hypothetical protein	NA	O64155	Bacillus_phage	58.6	3.2e-15
WP_053574337.1|3607772_3608120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053574338.1|3608158_3608656_-	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	78.8	5.3e-69
WP_014417936.1|3608815_3609019_-	YorP family protein	NA	O64150	Bacillus_phage	80.6	1.0e-26
WP_160228893.1|3609030_3609738_-	hypothetical protein	NA	O64147	Bacillus_phage	34.9	1.1e-24
WP_160228895.1|3609764_3613694_-	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	81.5	0.0e+00
WP_160228897.1|3613706_3615437_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	90.6	1.5e-307
WP_160228899.1|3615436_3616573_-	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	89.4	1.2e-204
WP_160228900.1|3616588_3618106_-	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	71.9	4.5e-212
WP_077722312.1|3618120_3618591_-	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	46.8	2.1e-38
WP_160228902.1|3618631_3619603_-	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	95.4	2.9e-172
WP_160228904.1|3619691_3620606_-	hypothetical protein	NA	O64140	Bacillus_phage	89.1	1.3e-153
WP_160228906.1|3620634_3621009_-	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	77.4	1.5e-52
WP_160228908.1|3621141_3621813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228910.1|3621874_3622261_-	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	2.7e-52
WP_160228912.1|3622299_3624042_-	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	63.1	2.3e-215
WP_160228914.1|3624038_3624860_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	65.8	2.0e-97
WP_160229013.1|3624960_3625359_-	hypothetical protein	NA	O64133	Bacillus_phage	62.9	2.0e-42
WP_014470192.1|3625542_3625815_-	hypothetical protein	NA	A0A1P8CWZ5	Bacillus_phage	80.0	2.1e-35
WP_014470191.1|3625804_3626692_-	hypothetical protein	NA	A0A1P8CWZ3	Bacillus_phage	93.9	3.6e-161
WP_160228916.1|3626672_3626915_-	hypothetical protein	NA	O64132	Bacillus_phage	82.2	9.9e-29
WP_160228918.1|3626986_3627661_+	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	97.9	1.9e-77
WP_160228920.1|3627730_3628543_+	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	88.5	9.4e-140
WP_014470184.1|3628760_3628958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228922.1|3629000_3629537_-|terminase	terminase small subunit	terminase	M4ZS05	Bacillus_phage	44.0	3.6e-07
WP_160229015.1|3629533_3630370_-	hypothetical protein	NA	A0A1P8CWY7	Bacillus_phage	64.8	8.6e-88
WP_038458648.1|3630717_3631080_-	hypothetical protein	NA	A0A140HLN5	Bacillus_phage	48.4	4.9e-32
WP_104843457.1|3631743_3632118_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	64.2	1.4e-37
WP_104843456.1|3632131_3632347_-	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	94.4	7.9e-30
WP_104843455.1|3632543_3632789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104843454.1|3632800_3633043_-	hypothetical protein	NA	A0A1P8CWY6	Bacillus_phage	90.0	4.1e-35
WP_046559768.1|3633158_3633497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228924.1|3633550_3633748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048406322.1|3633875_3634079_-	hypothetical protein	NA	O64115	Bacillus_phage	94.0	1.2e-32
WP_160228926.1|3634254_3635022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228928.1|3635060_3635738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160228930.1|3636077_3636812_-	hypothetical protein	NA	A0A0A8WIT2	Clostridium_phage	58.8	1.6e-66
WP_041352893.1|3636862_3637270_-	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	96.3	9.3e-72
WP_041352897.1|3637612_3637918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041352899.1|3637914_3638106_-	hypothetical protein	NA	R4JF30	Bacillus_phage	77.8	1.1e-22
WP_041352901.1|3638269_3638473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061573808.1|3638469_3638880_-	hypothetical protein	NA	A0A1P8CWX0	Bacillus_phage	60.9	3.4e-37
WP_102422308.1|3638876_3639077_-	hypothetical protein	NA	M4ZRU5	Bacillus_phage	85.9	5.5e-25
WP_020954128.1|3639523_3639769_-	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_064778402.1|3639843_3640143_-	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	50.0	7.9e-20
WP_021493552.1|3640308_3640530_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
WP_160228932.1|3640750_3641734_-|integrase	integrase	integrase	A0A1P8CWX4	Bacillus_phage	77.7	9.6e-139
WP_014471996.1|3641754_3643104_-	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.7	2.5e-190
WP_160228934.1|3643180_3644239_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.3	2.1e-155
WP_014471999.1|3644451_3644682_-	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
WP_014472000.1|3644696_3644909_-	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
WP_142295830.1|3645339_3645465_-	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_160228935.1|3645493_3646648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077722284.1|3646845_3647271_-	hypothetical protein	NA	O64093	Bacillus_phage	73.2	4.3e-51
3646723:3646742	attR	TTATTTTATTTTTATTCTAA	NA	NA	NA	NA
WP_077722283.1|3647333_3647870_-	hypothetical protein	NA	O64091	Bacillus_phage	87.6	1.7e-84
WP_154066722.1|3647900_3648032_-	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	87.8	2.3e-16
WP_160228937.1|3648043_3648259_-	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	54.9	3.0e-13
WP_160228939.1|3648261_3648513_-	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	62.7	1.9e-22
WP_014417903.1|3648583_3648766_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	87.9	1.7e-25
WP_104679114.1|3648780_3649005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005075.1|3649050_3649683_-	hypothetical protein	NA	A0A1P8CWV5	Bacillus_phage	52.4	2.2e-51
WP_160228941.1|3649798_3650062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246776.1|3650107_3650383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079005072.1|3650412_3650802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094246775.1|3650861_3651176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470139.1|3651213_3651591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470138.1|3651622_3651814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014470137.1|3651930_3652134_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	80.3	4.0e-23
>prophage 9
NZ_CP028208	Bacillus velezensis strain SRCM102744 chromosome, complete genome	4100472	3671617	3711741	4100472	terminase,holin,tail,integrase	Bacillus_phage(77.78%)	38	3676826:3676843	3711998:3712015
WP_102421749.1|3671617_3673432_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_160228979.1|3673458_3674901_+	hypothetical protein	NA	U5J9V5	Bacillus_phage	39.7	2.7e-89
WP_102421760.1|3674975_3676412_+	hypothetical protein	NA	A0A0K2FMA5	Brevibacillus_phage	32.9	6.2e-62
WP_014417873.1|3676436_3676979_+	hypothetical protein	NA	NA	NA	NA	NA
3676826:3676843	attL	ATATAAAGAGATTGCAGA	NA	NA	NA	NA
WP_014417872.1|3677003_3677996_+	hypothetical protein	NA	E0YJ30	Lactococcus_phage	31.6	2.0e-35
WP_022553077.1|3678048_3678582_+	hypothetical protein	NA	A0A0K2FLE1	Brevibacillus_phage	40.8	3.9e-25
WP_041481804.1|3678717_3679026_+	hypothetical protein	NA	A0A0H3UZ42	Geobacillus_virus	42.9	4.3e-13
WP_029974497.1|3679022_3679343_+	hypothetical protein	NA	U5J9I5	Bacillus_phage	37.9	9.7e-16
WP_160228981.1|3679339_3680005_+	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	53.6	3.1e-48
WP_160228983.1|3680001_3680508_+	hypothetical protein	NA	O64060	Bacillus_phage	67.3	4.4e-63
WP_160228984.1|3680504_3681230_+	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	31.8	4.7e-26
WP_160228986.1|3681268_3682066_+	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	36.8	2.0e-17
WP_014470099.1|3682086_3682554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022553073.1|3682625_3682982_+	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
WP_160228988.1|3682981_3684316_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.9	1.9e-25
WP_160229017.1|3684649_3684844_+	XkdX family protein	NA	A0A1P8CWR4	Bacillus_phage	63.0	2.0e-11
WP_020954185.1|3684924_3685410_+	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	65.2	1.8e-53
WP_160228990.1|3685409_3685826_+	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	66.9	9.0e-46
WP_160229019.1|3685833_3686817_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2FM05	Brevibacillus_phage	59.4	1.8e-108
WP_071181784.1|3687032_3687623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181783.1|3687579_3687846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071181782.1|3687847_3688279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014417859.1|3688435_3689062_+	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	28.9	3.1e-18
WP_160228992.1|3689126_3696011_+|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	77.1	0.0e+00
WP_160228994.1|3696055_3696817_+|tail	phage tail protein	tail	A0A1P8CWP8	Bacillus_phage	79.7	4.3e-110
WP_079005043.1|3700148_3700964_+	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	63.2	2.1e-94
WP_160229021.1|3701007_3703560_+	hypothetical protein	NA	D6R401	Bacillus_phage	37.4	2.6e-135
WP_079005041.1|3703732_3704779_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	54.7	1.1e-87
WP_014472511.1|3704885_3705257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470077.1|3705269_3705521_+|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	85.5	6.9e-33
WP_099762739.1|3705859_3706165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020954197.1|3706316_3707477_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.5	1.3e-33
WP_046559826.1|3707640_3708891_-	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	92.1	2.1e-223
WP_064778347.1|3708883_3709216_-	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	73.6	6.9e-41
WP_076982785.1|3709432_3710191_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_064778345.1|3710319_3710661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076982784.1|3710863_3710953_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_082921264.1|3711258_3711741_-	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	66.2	9.7e-60
3711998:3712015	attR	TCTGCAATCTCTTTATAT	NA	NA	NA	NA
>prophage 10
NZ_CP028208	Bacillus velezensis strain SRCM102744 chromosome, complete genome	4100472	3820341	3826594	4100472		Staphylococcus_phage(66.67%)	9	NA	NA
WP_160223149.1|3820341_3820935_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	9.9e-14
WP_160223150.1|3820924_3821680_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.2e-10
WP_003153376.1|3821887_3821977_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003153375.1|3822064_3822586_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153373.1|3822651_3823026_-	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_003153372.1|3823142_3823607_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153371.1|3823639_3824836_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
WP_007409425.1|3824850_3825498_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	1.5e-39
WP_160223151.1|3825478_3826594_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	9.8e-55
