The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047876	Escherichia coli strain LD22-1 chromosome, complete genome	4775730	1086250	1093390	4775730		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1086250_1086889_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1086885_1088148_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1088144_1089053_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1089248_1090016_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1090066_1090723_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272898.1|1090828_1093390_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP047876	Escherichia coli strain LD22-1 chromosome, complete genome	4775730	1686056	1695498	4775730		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569325.1|1686056_1686983_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1686987_1687719_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1687699_1687807_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1687866_1688598_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1688819_1690505_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1690501_1691221_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1691267_1691738_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1691778_1692240_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1692364_1694365_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1694361_1695498_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 3
NZ_CP047876	Escherichia coli strain LD22-1 chromosome, complete genome	4775730	1787092	1794630	4775730		Enterobacteria_phage(28.57%)	7	NA	NA
WP_001374058.1|1787092_1788487_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.6	6.3e-19
WP_001471778.1|1788644_1789640_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	8.6e-10
WP_001374047.1|1789882_1790776_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	5.1e-46
WP_001374049.1|1791144_1792230_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_001374048.1|1792229_1793129_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	2.0e-29
WP_001471777.1|1793186_1794065_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
WP_001471776.1|1794069_1794630_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	4.6e-53
>prophage 4
NZ_CP047876	Escherichia coli strain LD22-1 chromosome, complete genome	4775730	2408548	2528790	4775730	lysis,terminase,tail,transposase,tRNA,integrase	Escherichia_phage(42.59%)	112	2434984:2435000	2527923:2527939
WP_001373192.1|2408548_2409757_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	2.9e-209
WP_001261013.1|2410287_2410956_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586733.1|2411258_2411852_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|2411848_2412841_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234054.1|2412964_2413945_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_000140877.1|2413939_2414476_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2414538_2414763_-	YdcH family protein	NA	NA	NA	NA	NA
WP_000375956.1|2414902_2416558_-	glucan biosynthesis protein	NA	NA	NA	NA	NA
WP_000013786.1|2416782_2418126_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|2418342_2419266_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098551.1|2419303_2420944_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_001320773.1|2421342_2421492_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2421563_2421737_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|2421981_2422512_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048667.1|2422700_2423702_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115957.1|2423743_2425183_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027931.1|2425379_2426180_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000139614.1|2426451_2430354_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048948.1|2430554_2431160_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627376.1|2431210_2432527_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_000890935.1|2434288_2435185_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
2434984:2435000	attL	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
WP_000177536.1|2435184_2435790_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_000097801.1|2438329_2439190_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_001123454.1|2439420_2440011_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039886.1|2439992_2440943_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_000632286.1|2441043_2442357_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206190.1|2442383_2443589_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2443588_2444011_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973371.1|2444000_2445428_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000969780.1|2445429_2446218_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292341.1|2446217_2446985_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206364.1|2446981_2448052_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189197.1|2448059_2448557_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2448571_2449318_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2449326_2449614_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191073.1|2449625_2450555_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186504.1|2450839_2452885_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535440.1|2453132_2455406_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_000138608.1|2455463_2456963_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001067519.1|2457198_2458104_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001296730.1|2458275_2458602_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698141.1|2458609_2458795_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_000900909.1|2458791_2461431_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|2461638_2462628_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001299385.1|2462738_2463161_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2463157_2463424_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628159.1|2463697_2467222_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|2467587_2468721_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|2468861_2469296_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_001157925.1|2469560_2469734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795384.1|2470073_2470187_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2470255_2470489_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078178.1|2470805_2471396_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_001351719.1|2471493_2472069_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_089078768.1|2472068_2475296_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_001233133.1|2475360_2475960_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.0	1.6e-107
WP_032202219.1|2476027_2479507_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.5	0.0e+00
WP_000090943.1|2479567_2480170_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_001349612.1|2480106_2480850_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	8.9e-145
WP_001152432.1|2480855_2481554_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|2481553_2481892_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_000840620.1|2481884_2485118_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.7	1.3e-112
WP_012565075.1|2485591_2485951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|2486101_2487064_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_000144678.1|2487090_2487483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|2487479_2487860_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|2487860_2488244_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|2488243_2488639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000918490.1|2488861_2490001_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	74.7	1.7e-158
WP_000770036.1|2490099_2490864_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	6.6e-87
WP_001317036.1|2490968_2492081_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_000763708.1|2492064_2493471_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	6.7e-186
WP_000625347.1|2493473_2494775_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
WP_000089446.1|2494755_2495850_-	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
WP_000126788.1|2495853_2496063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204033.1|2496040_2496973_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_001291092.1|2496965_2497760_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	7.5e-49
WP_001097895.1|2497897_2499355_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2499551_2499737_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001135310.1|2499953_2500451_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|2500450_2500666_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2500917_2501292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2501463_2501892_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640162.1|2502934_2503477_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	4.9e-76
WP_000247763.1|2503473_2503764_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|2503763_2504363_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000149055.1|2505176_2505515_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001117227.1|2506238_2507438_+	MFS transporter	NA	NA	NA	NA	NA
WP_000957774.1|2507449_2508142_+	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_000019009.1|2508138_2509020_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625667.1|2509150_2510428_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001676522.1|2510491_2512489_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|2512829_2513252_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262393.1|2513292_2514363_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_000693853.1|2514434_2514860_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2514856_2515111_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2515190_2515610_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001169151.1|2516041_2516197_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|2516193_2516682_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|2517123_2517345_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|2517344_2517515_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|2517589_2517865_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001532611.1|2517966_2520567_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000166319.1|2520559_2521369_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|2521425_2521620_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|2521612_2521822_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|2521900_2522116_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040852.1|2522117_2523353_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_001153728.1|2523404_2524340_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.0e-145
WP_000123745.1|2524468_2525842_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2526319_2527303_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_032219717.1|2527557_2528790_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	4.0e-17
2527923:2527939	attR	TTATCAGCGCAAAAAAC	NA	NA	NA	NA
>prophage 5
NZ_CP047876	Escherichia coli strain LD22-1 chromosome, complete genome	4775730	2963822	3051618	4775730	lysis,terminase,capsid,tail,portal,tRNA,protease,plate,integrase,head	Salmonella_phage(59.65%)	92	2999675:2999689	3053331:3053345
WP_000886683.1|2963822_2965115_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|2965205_2966549_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2966559_2967171_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077063.1|2967325_2971432_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2971566_2972061_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|2972605_2973571_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|2973693_2975460_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_087889451.1|2975460_2977182_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	26.4	2.0e-22
WP_001241678.1|2977223_2977928_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2978212_2978431_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|2979115_2981392_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|2981422_2981743_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2982065_2982290_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188176.1|2982362_2984309_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|2984305_2985421_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|2985571_2986528_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_089618368.1|2986524_2988183_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001297311.1|2988608_2989304_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491142.1|2989798_2990698_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|2990841_2992494_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|2992505_2993474_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815350.1|2993606_2995325_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000566372.1|2995361_2996363_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|2996373_2997804_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|2997902_2998916_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_089078699.1|2998912_2999743_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
2999675:2999689	attL	AATGCCTTTTTCGCC	NA	NA	NA	NA
WP_001160737.1|2999739_3000063_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|3000188_3000704_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3000921_3001650_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3001667_3002399_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3002405_3003122_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3003121_3003790_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3004081_3004813_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149733.1|3004987_3006115_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|3006155_3006644_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|3006703_3007549_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105430.1|3007545_3008499_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996025.1|3008508_3009642_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126072.1|3009736_3010849_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3011200_3011677_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684311.1|3011764_3012667_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189178.1|3012727_3013450_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201554.1|3013433_3013721_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195240.1|3013880_3014138_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3014167_3014545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024867.1|3014814_3016500_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3016735_3016954_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_032162474.1|3017044_3018145_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	3.2e-175
WP_000980416.1|3018141_3018627_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	8.3e-67
WP_001282787.1|3018623_3021701_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|3021693_3021813_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3021827_3022130_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3022184_3022700_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_032162475.1|3022709_3023882_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	3.5e-204
WP_032162477.1|3024024_3024591_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	1.1e-86
WP_077775464.1|3024618_3025020_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	38.4	4.5e-10
WP_000376436.1|3025023_3025443_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.8	1.7e-36
WP_033813583.1|3025414_3026017_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	85.4	3.2e-92
WP_160204321.1|3026016_3027576_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	70.8	4.4e-202
WP_001086824.1|3027572_3028178_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	1.8e-111
WP_000268280.1|3028170_3029079_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	7.8e-143
WP_000177597.1|3029065_3029425_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_000993752.1|3029421_3030000_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	8.8e-92
WP_000829157.1|3030068_3030515_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_001039949.1|3030507_3030939_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	1.7e-71
WP_001080916.1|3031034_3031463_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.1	3.8e-47
WP_000727850.1|3031459_3031837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001341072.1|3031838_3032312_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000171568.1|3032331_3032547_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3032550_3032754_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673530.1|3032753_3033218_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000059191.1|3033313_3033964_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_063104903.1|3033967_3035026_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.7	9.9e-182
WP_000216237.1|3035042_3035876_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098422.1|3036018_3037785_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000520389.1|3037784_3038813_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.4	3.4e-171
WP_126719504.1|3038882_3040025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100207729.1|3040284_3041187_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_001217575.1|3041787_3042021_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|3042031_3042220_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_160183901.1|3042373_3044788_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.9	0.0e+00
WP_105906347.1|3044784_3045642_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	2.8e-158
WP_021578435.1|3045638_3045866_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.0e-35
WP_001415207.1|3045865_3046099_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	5.4e-32
WP_094314085.1|3046166_3046508_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_000956192.1|3046625_3046922_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_064485159.1|3046929_3047439_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.7e-86
WP_000035244.1|3047471_3047693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160183900.1|3047818_3048700_+	chromosome partitioning protein ParB	NA	A0A1S6KZZ7	Salmonella_phage	45.3	1.1e-40
WP_105906349.1|3048780_3049983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000584504.1|3049984_3050506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064485156.1|3050586_3051618_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	3.3e-105
3053331:3053345	attR	GGCGAAAAAGGCATT	NA	NA	NA	NA
>prophage 6
NZ_CP047876	Escherichia coli strain LD22-1 chromosome, complete genome	4775730	3082624	3180466	4775730	lysis,capsid,terminase,tail,portal,transposase,protease,integrase,head	Enterobacteria_phage(44.0%)	115	3108903:3108938	3181900:3181935
WP_000399648.1|3082624_3083605_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000961458.1|3083883_3085476_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_001056384.1|3085694_3086615_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000056415.1|3086673_3087792_-	anion transporter	NA	NA	NA	NA	NA
WP_000091016.1|3087788_3088256_-	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_001001761.1|3088441_3088570_+	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_001054662.1|3088841_3090425_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001295296.1|3090473_3090989_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|3091041_3091107_-	protein YliM	NA	NA	NA	NA	NA
WP_001315365.1|3091341_3092229_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|3092527_3093031_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|3093434_3094181_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|3094319_3094979_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|3094975_3095698_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001267250.1|3095814_3098037_+	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001275941.1|3098033_3098960_-	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_000710619.1|3099235_3099496_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430045.1|3099759_3102042_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990177.1|3102083_3102761_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146369.1|3102834_3103101_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3103365_3103626_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443512.1|3103853_3104939_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|3105079_3106042_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_089078766.1|3106069_3108220_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	5.7e-43
WP_001145128.1|3108339_3108822_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
3108903:3108938	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACA	NA	NA	NA	NA
WP_047629675.1|3109053_3110418_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001315358.1|3110646_3111318_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|3111320_3112316_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996092.1|3112308_3114045_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|3114037_3115171_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032219673.1|3115181_3116288_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3116249_3116660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113351.1|3116792_3117554_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650337.1|3117550_3118792_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045448.1|3118791_3119748_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_001088641.1|3119783_3120497_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_001331162.1|3120566_3121214_-	membrane protein	NA	NA	NA	NA	NA
WP_000373624.1|3121415_3122120_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852287.1|3122256_3122709_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|3122710_3122956_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080885.1|3122948_3123434_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|3123436_3123949_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001315357.1|3123970_3124960_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001295302.1|3125356_3126265_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3126456_3128478_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044882.1|3129056_3129734_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246805.1|3129726_3130482_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118822.1|3130468_3131623_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3131619_3132660_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001367048.1|3132746_3134036_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
WP_000767389.1|3134094_3134571_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001471252.1|3135316_3136648_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	3.2e-20
WP_001471251.1|3136721_3137306_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	3.7e-106
WP_024203579.1|3137305_3140704_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233090.1|3140768_3141368_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_089078764.1|3141438_3144936_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.5	0.0e+00
WP_000090895.1|3144996_3145629_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_000194783.1|3145565_3146309_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001512626.1|3146314_3147013_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.1e-133
WP_000847345.1|3147012_3147342_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_032292244.1|3147338_3149918_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	98.1	0.0e+00
WP_000459480.1|3149910_3150345_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	2.0e-64
WP_000479139.1|3150326_3150749_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.4e-70
WP_001439072.1|3150764_3151505_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	4.0e-129
WP_000683143.1|3151512_3151908_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_000975086.1|3151904_3152483_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	98.4	3.9e-79
WP_000752996.1|3152494_3152848_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_023566743.1|3152859_3153255_-	DNA packaging protein from bacteriophage origin	NA	A0A2R9YJP4	Escherichia_phage	95.5	7.4e-58
WP_000063254.1|3153296_3154322_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_001358225.1|3154377_3154710_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_047629419.1|3154719_3156039_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	2.4e-233
WP_047629415.1|3156019_3157621_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.1e-309
WP_000198149.1|3157617_3157824_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001597877.1|3157820_3159746_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_063625344.1|3159720_3160266_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	8.1e-95
WP_001309326.1|3160654_3160888_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|3160945_3161356_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3161707_3161860_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_001228702.1|3161888_3162095_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_089078763.1|3162311_3162809_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	97.6	3.5e-89
WP_000839596.1|3162808_3163024_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737280.1|3163607_3164705_+	porin	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_001204791.1|3164894_3165278_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_001309323.1|3165363_3165453_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	80.8	8.0e-05
WP_085948178.1|3165515_3166728_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
WP_001099712.1|3166813_3167176_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000950954.1|3167195_3167390_-	protein ninF	NA	NA	NA	NA	NA
WP_000386643.1|3167382_3167724_-	DUF2591 domain-containing protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001254223.1|3167726_3167903_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000153280.1|3167899_3168427_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|3168423_3168864_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000145931.1|3168937_3169228_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788910.1|3169224_3169926_-	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_052976200.1|3169922_3170822_-	replication protein	NA	K7P7F0	Enterobacteria_phage	98.3	1.1e-170
WP_000251069.1|3170854_3171148_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_001194218.1|3171267_3171483_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028393.1|3171586_3172219_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	100.0	5.4e-119
WP_021526961.1|3172215_3172620_+	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	99.3	1.9e-69
WP_089078685.1|3172837_3173293_+	antitermination protein	NA	J3JZZ6	Escherichia_phage	96.1	4.0e-63
WP_000281856.1|3173293_3173776_-	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213975.1|3174042_3174243_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000065373.1|3174425_3174794_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_001198858.1|3174866_3175007_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000358700.1|3174999_3175143_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	95.7	1.8e-17
WP_000995439.1|3175217_3175514_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_089078684.1|3175519_3176305_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	98.9	1.5e-147
WP_000186835.1|3176301_3176982_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	99.1	4.6e-132
WP_072126246.1|3176978_3177161_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_000548531.1|3177133_3177325_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3177335_3177617_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763367.1|3177715_3177937_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001348592.1|3178147_3178750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3178992_3179160_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3179199_3179418_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533642.1|3179395_3180466_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	100.0	5.1e-202
3181900:3181935	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTACA	NA	NA	NA	NA
>prophage 7
NZ_CP047876	Escherichia coli strain LD22-1 chromosome, complete genome	4775730	3641022	3729138	4775730	lysis,capsid,terminase,tail,portal,transposase,protease,holin,plate,integrase,head	Shigella_phage(50.0%)	94	3667879:3667895	3726584:3726600
WP_000131044.1|3641022_3643056_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|3643184_3643772_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|3643785_3645258_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|3645271_3646942_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001295805.1|3648016_3648580_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_160183922.1|3648909_3649323_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_085947772.1|3649292_3650506_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_160183921.1|3650554_3650965_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001406334.1|3651118_3651880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071593451.1|3653025_3654219_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001209088.1|3654402_3655068_+	membrane protein	NA	NA	NA	NA	NA
WP_001315273.1|3655313_3656009_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023914.1|3656001_3657429_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102101.1|3657439_3658159_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339593.1|3658687_3659542_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001046293.1|3659767_3661093_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000474077.1|3661201_3661438_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3661449_3662043_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001709928.1|3662202_3663072_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	2.1e-52
WP_001315271.1|3663320_3664178_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092603.1|3664299_3668553_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
3667879:3667895	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|3669668_3669770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|3670132_3670396_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3670395_3670536_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|3670570_3670798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296902.1|3671620_3672163_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|3672237_3672825_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3672882_3673551_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131079.1|3673576_3676102_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001315269.1|3676091_3677735_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|3677703_3678414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303809.1|3678726_3679056_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3679303_3679918_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|3680335_3681025_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643333.1|3681021_3681978_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_000667026.1|3681974_3684173_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121354.1|3684182_3685139_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111353.1|3685117_3685528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012602456.1|3686345_3687560_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_160183920.1|3687594_3689028_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.3	3.2e-106
WP_000355484.1|3689431_3690205_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000904983.1|3690262_3690817_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	2.8e-87
WP_010376608.1|3691348_3691696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001583217.1|3693089_3693674_-	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_001583215.1|3693664_3694723_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	5.6e-201
WP_000424732.1|3694709_3695135_-	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_112919928.1|3695134_3695683_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.3	1.1e-94
WP_000999511.1|3695682_3696762_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_000219910.1|3696758_3698087_-	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|3698147_3699983_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661047.1|3700124_3700394_-|tail	phage tail assembly protein	tail	S5FNR3	Shigella_phage	100.0	3.5e-43
WP_000090998.1|3700393_3700750_-	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_096962341.1|3700749_3702246_-|tail	phage tail protein	tail	M1FN90	Enterobacteria_phage	99.0	7.7e-273
WP_032225398.1|3702229_3702400_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	3.5e-25
WP_112919927.1|3702408_3702969_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213502.1|3702965_3703472_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	100.0	1.7e-91
WP_000702388.1|3703446_3703857_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.8	5.9e-74
WP_000927719.1|3703853_3704177_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|3704179_3704380_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257507.1|3704429_3705635_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001193632.1|3705649_3706300_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_000466255.1|3706277_3707519_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_032257813.1|3707518_3707701_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	98.3	2.9e-25
WP_160183923.1|3707712_3709209_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	1.3e-299
WP_000929181.1|3709442_3709937_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001407091.1|3710062_3710413_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.8	2.0e-62
WP_001407090.1|3710483_3711242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023566046.1|3711323_3711788_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	66.4	8.5e-45
WP_001407088.1|3711780_3712263_-	glycoside hydrolase family protein	NA	U5P0A9	Shigella_phage	92.4	2.1e-83
WP_001120496.1|3712266_3712593_-|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_001446998.1|3712889_3713831_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_001208502.1|3713852_3714302_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_085949407.1|3714337_3714706_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_001360050.1|3714720_3715710_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061381.1|3715717_3716527_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	1.6e-152
WP_000767124.1|3716546_3716936_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	100.0	7.1e-69
WP_001721080.1|3716932_3717259_-	lexA DNA-binding domain protein	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	4.5e-53
WP_021543207.1|3717255_3717909_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
WP_160183919.1|3717908_3718403_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	5.6e-87
WP_000104967.1|3718399_3719341_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_023148278.1|3719330_3719510_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	3.9e-14
WP_000515830.1|3719685_3720237_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|3720280_3720481_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_160183918.1|3720571_3721246_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	4.6e-132
WP_000549623.1|3721480_3721687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|3721658_3722093_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000008236.1|3722637_3723174_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242749.1|3723164_3723527_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3723526_3723832_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000433939.1|3723831_3724182_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051887.1|3724058_3725222_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893255.1|3725426_3726680_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
3726584:3726600	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|3726691_3727795_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749882.1|3728082_3729138_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	1.3e-117
>prophage 8
NZ_CP047876	Escherichia coli strain LD22-1 chromosome, complete genome	4775730	3759971	3822162	4775730	protease,transposase,tRNA,plate	Enterobacteria_phage(12.5%)	51	NA	NA
WP_000611742.1|3759971_3760385_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|3760388_3762239_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|3762202_3763285_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_089078729.1|3763309_3764590_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|3764586_3765111_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246416.1|3765113_3766445_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343293.1|3766449_3767211_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614334.1|3767219_3769979_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	4.7e-82
WP_000088859.1|3769975_3770719_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240532.1|3770723_3772136_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985420.1|3772244_3775679_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087751.1|3775689_3777042_+	membrane protein	NA	NA	NA	NA	NA
WP_089078728.1|3777065_3777548_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908058.1|3777591_3778506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|3778515_3778995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|3779131_3779917_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|3780456_3781188_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917883.1|3781252_3781720_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297210.1|3781716_3782439_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052720.1|3782472_3783228_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|3783299_3784658_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211690.1|3784705_3785476_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|3785553_3786354_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648606.1|3786594_3787509_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|3787505_3788309_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140174.1|3794069_3794642_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|3794829_3795861_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|3795853_3796507_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|3796546_3797362_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202335.1|3797479_3797884_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|3797880_3798588_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|3798699_3800418_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_160183917.1|3801498_3802479_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239192.1|3802728_3803439_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|3803452_3803875_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|3803871_3804417_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|3804582_3804783_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|3804769_3805030_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176578.1|3805078_3806377_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|3806441_3806831_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|3806887_3809029_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|3809127_3810087_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294757.1|3810099_3813582_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|3813618_3814215_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139667.1|3814211_3815360_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|3815359_3816148_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3816151_3816607_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|3816711_3817737_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|3817740_3818226_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|3818347_3820780_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|3820809_3822162_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 1
NZ_CP047878	Escherichia coli strain LD22-1 plasmid pLD22-1-135kb, complete sequence	135123	1262	74598	135123	transposase,bacteriocin,protease,integrase	Enterobacteria_phage(23.53%)	55	NA	NA
WP_001066954.1|1262_2003_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_065203495.1|2123_2312_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_000175738.1|2685_3594_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|3656_4766_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|5198_6152_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|7425_7584_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024133197.1|8932_9079_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.0e-06
WP_000928804.1|10420_11608_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733250.1|11604_13545_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001312828.1|13548_14919_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|15715_16657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|18917_20111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738422.1|23196_23490_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|26636_27752_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001312839.1|27765_31551_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_000933675.1|31654_32884_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_064055648.1|32968_33925_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|33969_36147_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001259759.1|37089_37293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014640552.1|37270_37507_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|37970_38252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203272.1|38609_39137_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|39380_40196_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|40245_40599_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|40776_41568_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|41564_42254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|42297_42648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064055658.1|43179_47001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000142450.1|47423_47771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311056.1|48072_48555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023154360.1|48671_49520_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	39.0	5.0e-27
WP_000969990.1|49565_49847_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001143760.1|50703_53709_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
WP_001235713.1|53872_54430_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_015058868.1|54612_55473_+	class A broad-spectrum beta-lactamase TEM-135	NA	Q1MVP3	Enterobacteria_phage	99.7	3.0e-160
WP_004201280.1|56214_56688_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_086525284.1|57901_58606_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
WP_001516695.1|59683_60340_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|61119_62511_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001493762.1|62547_63120_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_012477564.1|63256_63847_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_000844627.1|63964_64207_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159186494.1|64238_64889_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032153701.1|64994_66194_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|66460_66766_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|66793_68008_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001447541.1|68224_69109_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|69139_70633_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|70843_71068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|71064_71802_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|72287_72428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|72433_73138_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001398199.1|73260_73662_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|73594_73852_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|73944_74598_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP047877	Escherichia coli strain LD22-1 plasmid pLD22-1-MCR1, complete sequence	251000	57775	99927	251000	integrase,transposase,protease	Escherichia_phage(30.77%)	45	52724:52737	65235:65248
52724:52737	attL	CGGGATGAATATAA	NA	NA	NA	NA
WP_012478345.1|57775_58750_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_049589868.1|58945_60571_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_160183281.1|60642_61449_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_001805195.1|61384_61729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|61750_62926_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|63096_63309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|63669_64752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|64918_66418_-	kinase	NA	NA	NA	NA	NA
65235:65248	attR	CGGGATGAATATAA	NA	NA	NA	NA
WP_000081622.1|66443_68081_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|68080_69121_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|69206_69845_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|69844_70486_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
WP_001388628.1|70508_71147_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|71609_72077_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|72094_73303_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|73313_74270_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|74269_75349_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|75350_76124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|76116_77259_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|77268_78327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|78650_79232_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|79231_80389_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|80411_80867_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
WP_062914744.1|80889_81930_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|81978_82557_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|82624_83200_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|83628_84870_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|85432_85714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|85763_85955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|86046_86418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|86760_87153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|87756_88050_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|88054_89380_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|89440_89647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|89748_90159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146881499.1|90171_90987_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_001043843.1|91240_91666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|92214_92523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|92538_93396_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_152921942.1|94244_94712_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	4.9e-08
WP_063120614.1|95369_96503_-	permease	NA	NA	NA	NA	NA
WP_001175593.1|96608_96932_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|97474_98179_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|98290_98995_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389365.1|99162_99927_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 2
NZ_CP047877	Escherichia coli strain LD22-1 plasmid pLD22-1-MCR1, complete sequence	251000	103265	160778	251000	integrase,transposase	Escherichia_phage(33.33%)	56	103213:103272	156766:157586
103213:103272	attL	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067855.1|103265_103970_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000105383.1|104236_105673_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000427623.1|106090_107095_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032193599.1|107667_108372_-	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067858.1|108401_109106_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_152921935.1|109117_109273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193209.1|109915_110734_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|110730_111936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|112215_113535_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000833382.1|113785_115213_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|115427_115943_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|115945_116842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|117063_117297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|117958_118189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|118525_118987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|119016_119424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|119474_119792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|120168_120519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|122208_122913_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001617865.1|123215_124091_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_014839980.1|124702_125119_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|125123_125642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071448054.1|125641_126388_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|126393_127098_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|127211_127988_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000602738.1|129538_130291_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|132101_132587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|132783_133874_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|133963_134779_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|134865_135168_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|135061_135313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|135343_136837_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|136948_137254_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214121.1|137281_138496_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001447541.1|138712_139597_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|140521_141226_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_065800308.1|141310_141700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|141964_142969_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_015344976.1|143047_145999_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|146001_146562_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_081316080.1|146687_147272_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|147240_148254_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|148398_148896_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|149007_149298_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|149303_150095_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|150356_151616_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|151708_152500_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|152669_153002_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000034420.1|154181_154973_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|155441_155687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|155724_156588_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001067855.1|156818_157523_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|157673_158489_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
156766:157586	attR	CGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_001067855.1|158678_159383_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|159607_159811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|159938_160778_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
