The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	0	45046	4744425	protease,tail,capsid,lysis,head,plate,terminase,portal,holin	Escherichia_phage(58.33%)	54	NA	NA
WP_160599464.1|0_2298_+	replication endonuclease	NA	Q858T4	Yersinia_virus	98.3	0.0e+00
WP_001697730.1|2384_3407_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	59.0	5.5e-113
WP_000373633.1|3436_4117_-	hypothetical protein	NA	A0A0R6PER3	Moraxella_phage	31.7	9.9e-18
WP_000351260.1|4118_5261_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	42.9	1.6e-73
WP_097312607.1|5634_6669_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	9.3e-201
WP_000156847.1|6668_8441_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_160599465.1|8614_9469_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_160599466.1|9527_10601_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	98.9	1.3e-200
WP_000203418.1|10604_11348_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_112872538.1|11447_11957_+|head	head completion/stabilization protein	head	A0A0F7L9Y3	Escherichia_phage	99.4	4.3e-90
WP_000846399.1|11956_12160_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|12163_12445_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|12444_12942_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_160599468.1|12956_13382_+	protein lysA	NA	Q858W1	Yersinia_virus	94.3	4.5e-61
WP_072665050.1|13369_13795_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	98.6	1.1e-67
WP_001440152.1|13766_13940_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000917180.1|13902_14370_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	4.3e-81
WP_001001787.1|14362_14815_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_097312609.1|14886_15672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_097312610.1|15755_16391_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	97.6	2.2e-112
WP_032277167.1|16387_16735_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121479.1|16739_17648_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285340.1|17640_18252_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_097312611.1|18248_19556_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.6	1.8e-180
WP_097312612.1|19555_20158_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	1.6e-99
WP_000466305.1|20129_20564_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.6	5.3e-49
WP_160599470.1|20982_21576_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.4	4.1e-100
WP_089581985.1|21635_22826_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
WP_160599472.1|22838_23357_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	98.8	2.1e-92
WP_001031303.1|23413_23689_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|23721_23841_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_160599474.1|23833_26281_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_052918758.1|26295_26775_+|tail	phage tail protein	tail	U5N3F6	Enterobacteria_phage	98.1	4.3e-84
WP_097312614.1|26774_27938_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	3.7e-206
WP_000468308.1|28019_28238_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001145759.1|28507_29020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076742.1|29227_30130_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|30310_31273_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045685.1|31592_32582_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708998.1|32688_33444_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|33498_34266_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|34373_34973_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155273.1|35073_35514_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|35725_36025_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|36051_36480_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796332.1|36484_37231_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|37327_38338_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|38472_39981_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|40003_40849_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|41273_41519_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|41603_42089_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|42181_43108_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|43174_44506_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|44515_45046_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	61804	69051	4744425		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424839.1|61804_62467_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
WP_001185117.1|62478_64980_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|65288_66368_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|66382_66703_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184811.1|66753_69051_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 3
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	86151	88035	4744425		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591385.1|86151_88035_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	26.8	2.0e-07
>prophage 4
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	96539	99592	4744425		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|96539_97490_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|98407_99592_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 5
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	103708	112037	4744425		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_160599480.1|103708_107737_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|107813_112037_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 6
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	121254	123018	4744425		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|121254_121926_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|121968_122559_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|122745_123018_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 7
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	129157	130747	4744425		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|129157_130747_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 8
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	146290	149974	4744425		Dickeya_phage(100.0%)	1	NA	NA
WP_000096017.1|146290_149974_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	85.2	5.4e-25
>prophage 9
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	175477	176593	4744425		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|175477_176593_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 10
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	185809	186418	4744425		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|185809_186418_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 11
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	193012	204806	4744425	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_000918363.1|193012_194428_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_160599486.1|194480_195560_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	6.8e-29
WP_000486989.1|195812_197006_+	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_001321562.1|197507_197711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088551916.1|198219_199589_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_050487229.1|199609_200272_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_000270375.1|200382_200799_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_000155657.1|200802_201159_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_160599488.1|201193_204016_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|204269_204806_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 12
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	212768	215225	4744425		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001469679.1|212768_215225_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	36.1	3.2e-74
>prophage 13
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	220037	223130	4744425		Liberibacter_phage(100.0%)	1	NA	NA
WP_001469683.1|220037_223130_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.4	3.7e-59
>prophage 14
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	227959	229309	4744425		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|227959_229309_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 15
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	235670	237629	4744425		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|235670_237629_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 16
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	247251	249399	4744425		Escherichia_phage(100.0%)	1	NA	NA
WP_077251947.1|247251_249399_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	3.1e-33
>prophage 17
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	254644	261013	4744425		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001066030.1|254644_256630_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	1.2e-148
WP_001171687.1|256902_257832_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|257815_258511_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|258521_259502_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_160599491.1|259480_261013_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
>prophage 18
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	267143	268693	4744425		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611405.1|267143_267824_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001075514.1|267934_268693_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 19
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	274222	275011	4744425		Cedratvirus(100.0%)	1	NA	NA
WP_001193408.1|274222_275011_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 20
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	280247	281750	4744425		Burkholderia_virus(100.0%)	1	NA	NA
WP_160599495.1|280247_281750_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 21
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	302945	306157	4744425	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295090.1|302945_304463_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
WP_000856829.1|304699_306157_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 22
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	320434	322418	4744425		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|320434_320728_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|320771_322418_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 23
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	326941	327475	4744425		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|326941_327475_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 24
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	332395	333373	4744425		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|332395_333373_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 25
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	340801	341347	4744425		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|340801_341347_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 26
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	345383	358414	4744425	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_001514857.1|345383_346721_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|346730_348578_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|348570_349521_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|349606_349915_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|349990_351271_+	GTPase HflX	NA	NA	NA	NA	NA
WP_072644035.1|351356_352616_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|352618_353623_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|353704_353902_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|354005_355304_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|355508_355934_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|355972_358414_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 27
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	362347	363511	4744425		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|362347_363511_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 28
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	404519	411007	4744425		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|404519_405050_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|405359_406316_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205790.1|406455_407958_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_021578254.1|407971_408994_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|408980_409976_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_032255047.1|410008_411007_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 29
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	415194	417956	4744425		Cronobacter_phage(50.0%)	2	NA	NA
WP_001106239.1|415194_415659_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	3.8e-53
WP_000187790.1|415817_417956_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	6.9e-267
>prophage 30
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	421594	427691	4744425		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_001181324.1|421594_422542_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|422726_422780_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|422920_425617_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|425822_426209_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|426281_426743_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|426755_427691_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 31
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	436489	446776	4744425	tRNA	Klosneuvirus(25.0%)	7	NA	NA
WP_045154120.1|436489_439345_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.4	1.8e-140
WP_000786399.1|439344_439788_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|440045_441557_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|441823_442924_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|442923_444006_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_032202307.1|444124_445627_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	4.6e-84
WP_001572522.1|445756_446776_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	5.4e-44
>prophage 32
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	451632	452613	4744425		Stx2-converting_phage(100.0%)	1	NA	NA
WP_032256289.1|451632_452613_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.2	2.7e-101
>prophage 33
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	463645	469809	4744425	transposase	Escherichia_phage(66.67%)	6	NA	NA
WP_000208194.1|463645_465106_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
WP_000833686.1|465320_466094_+	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000062558.1|466234_467065_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_158302278.1|467296_468220_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.9e-176
WP_120795393.1|468723_468807_+	iraD leader peptide	NA	NA	NA	NA	NA
WP_094315047.1|468885_469809_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	6.4e-177
>prophage 34
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	481863	482808	4744425	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_063080653.1|481863_482808_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	5.9e-61
>prophage 35
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	489337	493306	4744425		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001387312.1|489337_490807_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
WP_000819019.1|490873_493306_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
>prophage 36
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	510692	512348	4744425		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032255950.1|510692_512348_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 37
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	522962	524242	4744425		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|522962_523700_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|523702_524242_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 38
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	532163	535039	4744425		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175943.1|532163_533753_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|534145_534751_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|534877_535039_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 39
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	540876	542199	4744425		Geobacillus_virus(100.0%)	1	NA	NA
WP_089629313.1|540876_542199_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.5	6.8e-79
>prophage 40
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	548919	554274	4744425		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093813.1|548919_550152_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
WP_000046749.1|550458_552126_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409442.1|552336_554274_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 41
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	557557	559671	4744425		Bacillus_phage(50.0%)	2	NA	NA
WP_001188663.1|557557_558247_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219614.1|558246_559671_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
>prophage 42
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	571439	581857	4744425	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130189.1|571439_572393_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|572507_573095_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|573129_573696_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|573844_574558_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843568.1|574583_574988_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|575364_577281_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|577369_578500_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001300563.1|578762_579875_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001181672.1|579952_580162_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_000681368.1|580690_581857_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 43
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	585514	588331	4744425	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286865.1|585514_588331_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 44
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	592737	593886	4744425		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|592737_593886_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 45
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	599480	605141	4744425		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000351353.1|599480_601034_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.6e-34
WP_000349924.1|601107_602325_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|602453_603596_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|603626_605141_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 46
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	613035	614435	4744425		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|613035_613515_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|613592_614435_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 47
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	622179	627602	4744425		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|622179_625086_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035680.1|625250_627602_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 48
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	634050	634749	4744425		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916281.1|634050_634749_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 49
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	647451	649176	4744425		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_160599515.1|647451_649176_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	27.1	2.9e-37
>prophage 50
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	675265	676309	4744425		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|675265_676309_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 51
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	680554	681106	4744425		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|680554_681106_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 52
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	689733	691158	4744425		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|689733_691158_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 53
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	698904	705527	4744425		Mamastrovirus(33.33%)	5	NA	NA
WP_072650785.1|698904_700455_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_160599518.1|700656_703047_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|703252_703789_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|703829_704492_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|704600_705527_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 54
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	708789	709692	4744425		Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|708789_709692_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 55
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	715043	721849	4744425	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174632.1|715043_716462_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937398.1|716500_717427_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|717463_717919_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
WP_000396036.1|718096_718801_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294674.1|718815_719346_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001619115.1|719419_721849_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	5.1e-40
>prophage 56
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	727083	727881	4744425		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|727083_727881_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 57
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	733915	734260	4744425		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|733915_734260_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 58
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	738189	739614	4744425	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|738189_739614_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 59
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	752211	752970	4744425		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|752211_752970_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 60
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	761798	765914	4744425		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|761798_762395_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|762431_765914_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 61
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	778918	779950	4744425		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594006.1|778918_779950_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 62
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	786563	794195	4744425		Indivirus(25.0%)	9	NA	NA
WP_000997050.1|786563_787367_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	1.4e-39
WP_000648577.1|787363_788278_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|788518_789319_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016012.1|789322_789946_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|789993_791352_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052717.1|791423_792179_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001297210.1|792212_792935_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|792931_793399_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001300756.1|793463_794195_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
>prophage 63
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	800801	804720	4744425		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|800801_801380_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333379.1|801585_802353_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|802323_803064_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|803219_803498_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|803500_803761_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_015675129.1|803946_804720_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
>prophage 64
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	819474	822432	4744425		Hokovirus(50.0%)	2	NA	NA
WP_000859525.1|819474_819870_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_072651030.1|819987_822432_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.0	1.4e-32
>prophage 65
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	851568	863306	4744425	integrase	Enterobacteria_phage(33.33%)	12	853036:853048	859465:859477
WP_000749863.1|851568_852624_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|852911_854015_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
853036:853048	attL	GGCATCGGATTGT	NA	NA	NA	NA
WP_000893279.1|854026_855280_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	2.2e-95
WP_063112868.1|855635_856850_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	3.7e-132
WP_032318916.1|856992_857874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083330.1|858071_858269_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	48.1	1.7e-07
WP_095762562.1|858268_858616_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	43.6	9.5e-17
WP_096106451.1|858628_859462_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_077580825.1|859454_859637_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
859465:859477	attR	ACAATCCGATGCC	NA	NA	NA	NA
WP_096106453.1|859623_860475_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_096106454.1|860530_860872_+	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	49.1	2.1e-24
WP_094307810.1|860864_863306_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.4	1.6e-137
>prophage 66
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	867335	869534	4744425		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000667036.1|867335_869534_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	4.3e-38
>prophage 67
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	890516	891842	4744425		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046307.1|890516_891842_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 68
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	897417	903337	4744425	holin	Catovirus(50.0%)	4	NA	NA
WP_001159095.1|897417_899088_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|899101_900574_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|900587_901175_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|901303_903337_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 69
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	914724	915774	4744425		Tupanvirus(100.0%)	1	NA	NA
WP_000692744.1|914724_915774_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	1.4e-71
>prophage 70
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	924548	926435	4744425		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010270.1|924548_926435_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
>prophage 71
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	929727	930627	4744425		Lactobacillus_phage(100.0%)	1	NA	NA
WP_160599797.1|929727_930627_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.0	1.2e-15
>prophage 72
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	935244	939524	4744425		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_072651012.1|935244_938319_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.1	0.0e+00
WP_000805902.1|938441_939524_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 73
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	944934	946895	4744425		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_032255708.1|944934_945885_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.1e-35
WP_001013499.1|945881_946895_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 74
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	950474	955320	4744425		Prochlorococcus_phage(50.0%)	4	NA	NA
WP_000842102.1|950474_951584_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
WP_001141271.1|951618_951894_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_160599799.1|952079_952793_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000939399.1|954552_955320_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-25
>prophage 75
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	963113	964271	4744425		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|963113_964271_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 76
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	971685	972801	4744425		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|971685_972801_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 77
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	977090	987065	4744425		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|977090_978002_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_072650825.1|978126_979035_+	fructokinase	NA	NA	NA	NA	NA
WP_001459514.1|979177_980362_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_072650826.1|980487_983634_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|983630_984833_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|985022_985712_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893598.1|985769_987065_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.2	1.0e-26
>prophage 78
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	994017	1002998	4744425	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|994017_995145_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|995167_995500_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|995527_997375_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|997385_998357_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|998485_998833_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|999009_999894_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|1000192_1000732_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|1000882_1001332_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150472.1|1001335_1002439_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_001021161.1|1002527_1002998_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 79
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1024557	1029604	4744425	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|1024557_1025181_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1025306_1026581_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|1026768_1029123_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1029331_1029604_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 80
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1032733	1033429	4744425		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|1032733_1033429_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 81
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1036752	1040299	4744425		Bacillus_phage(100.0%)	2	NA	NA
WP_001235622.1|1036752_1038525_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
WP_001256201.1|1038517_1040299_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 82
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1049135	1052285	4744425		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|1049135_1052285_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 83
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1059293	1067855	4744425		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|1059293_1059845_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122020.1|1059973_1061905_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1061957_1062287_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1062286_1062892_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|1063001_1064876_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|1065056_1065701_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250103.1|1065936_1066899_+	ferrochelatase	NA	NA	NA	NA	NA
WP_032255982.1|1066895_1067855_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	2.2e-15
>prophage 84
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1076099	1079261	4744425		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|1076099_1076441_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000078268.1|1076756_1079261_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	3.8e-115
>prophage 85
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1083800	1084478	4744425		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|1083800_1084478_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 86
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1087614	1095399	4744425		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|1087614_1088301_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|1088297_1090712_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_160599528.1|1091142_1095399_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.2	9.9e-23
>prophage 87
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1101772	1103554	4744425		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|1101772_1103554_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 88
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1109744	1110890	4744425		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706344.1|1109744_1110890_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 89
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1122467	1129103	4744425	transposase,tRNA	Moumouvirus(33.33%)	7	NA	NA
WP_000912345.1|1122467_1123853_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143558.1|1123888_1124410_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1124517_1124730_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|1124731_1125598_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1126068_1126611_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1126830_1127523_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_158302278.1|1128179_1129103_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.9e-176
>prophage 90
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1136288	1136972	4744425		Bacillus_phage(100.0%)	1	NA	NA
WP_000770953.1|1136288_1136972_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 91
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1140242	1143386	4744425		Leptospira_phage(100.0%)	1	NA	NA
WP_160599532.1|1140242_1143386_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.5	2.9e-59
>prophage 92
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1150894	1162857	4744425		Synechococcus_phage(16.67%)	11	NA	NA
WP_072650799.1|1150894_1151572_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	29.7	2.0e-18
WP_000146343.1|1151645_1151912_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|1152176_1152437_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|1152665_1153751_-	malate/lactate/ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000386551.1|1153891_1154854_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001400136.1|1154881_1157032_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_072650800.1|1157151_1157634_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_000007101.1|1157865_1159230_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_088541696.1|1159458_1160130_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000743444.1|1160132_1161128_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001459597.1|1161120_1162857_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 93
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1173453	1174362	4744425		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1173453_1174362_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 94
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1180843	1182133	4744425		Klosneuvirus(100.0%)	1	NA	NA
WP_023281131.1|1180843_1182133_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	7.7e-19
>prophage 95
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1192488	1199062	4744425		Planktothrix_phage(33.33%)	7	NA	NA
WP_000891692.1|1192488_1193547_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_160599540.1|1193549_1194239_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_032255631.1|1194238_1195012_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000891515.1|1195177_1195327_-	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001147439.1|1195455_1196244_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_032255627.1|1196311_1197784_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	2.7e-12
WP_001265443.1|1198045_1199062_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 96
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1203416	1206936	4744425		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|1203416_1204469_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|1204784_1205165_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000951292.1|1205278_1206220_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|1206216_1206936_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 97
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1243219	1244011	4744425		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113994.1|1243219_1244011_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.8	3.7e-08
>prophage 98
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1247389	1250439	4744425		Acinetobacter_phage(50.0%)	2	NA	NA
WP_072647074.1|1247389_1248871_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000207142.1|1249020_1250439_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
>prophage 99
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1256053	1268774	4744425		uncultured_Caudovirales_phage(25.0%)	8	NA	NA
WP_160599546.1|1256053_1260247_-	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.5e-26
WP_000424924.1|1260489_1260696_-	YbfA family protein	NA	NA	NA	NA	NA
WP_001272653.1|1261008_1261098_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000741132.1|1261097_1262771_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_072650981.1|1262793_1264842_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_001300431.1|1264850_1265423_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_160599548.1|1265415_1268100_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_000186085.1|1268096_1268774_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	5.8e-26
>prophage 100
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1277027	1277792	4744425		Mycobacterium_phage(100.0%)	1	NA	NA
WP_032255757.1|1277027_1277792_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 101
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1282074	1285953	4744425	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|1282074_1283739_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023104.1|1284006_1285953_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 102
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1290719	1292384	4744425		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1290719_1292384_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 103
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1296480	1297560	4744425		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1296480_1297560_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 104
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1305456	1309766	4744425		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|1305456_1306182_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207501.1|1306299_1307235_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_160599803.1|1308236_1309766_+	Hsp70 family protein	NA	G8DDB7	Micromonas_pusilla_virus	34.3	2.6e-66
>prophage 105
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1316705	1319288	4744425	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157887.1|1316705_1319288_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	4.7e-185
>prophage 106
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1326298	1328737	4744425		Synechococcus_phage(50.0%)	2	NA	NA
WP_072650969.1|1326298_1327387_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|1327525_1328737_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 107
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1333551	1335909	4744425	transposase	uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_000939749.1|1333551_1333935_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|1333988_1334198_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_097295295.1|1334372_1334897_-	phospholipid:lipid A palmitoyltransferase	NA	NA	NA	NA	NA
WP_000019446.1|1334928_1335909_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	4.4e-184
>prophage 108
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1350820	1352935	4744425		Morganella_phage(50.0%)	2	NA	NA
WP_000278509.1|1350820_1351249_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|1351369_1352935_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 109
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1356118	1357941	4744425		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029825.1|1356118_1357339_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
WP_000502936.1|1357311_1357941_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
>prophage 110
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1372302	1378345	4744425		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|1372302_1373118_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096692.1|1373114_1374248_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077805.1|1374463_1378345_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
>prophage 111
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1383324	1472735	4744425	tail,capsid,head,integrase,transposase,terminase,portal,holin	Cronobacter_phage(47.27%)	97	1407244:1407262	1471226:1471244
WP_001300563.1|1383324_1384437_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_032265915.1|1384513_1386796_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|1387060_1387321_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_001295299.1|1387596_1388523_+	23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF	NA	NA	NA	NA	NA
WP_089591834.1|1388519_1390745_-	mechanosensitive channel protein	NA	NA	NA	NA	NA
WP_001400142.1|1391005_1391728_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|1391724_1392384_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|1392522_1393269_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1393672_1394176_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|1394474_1395362_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|1395596_1395662_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|1395714_1396230_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_032255114.1|1396278_1397862_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_001001761.1|1398133_1398262_-	manganase accumulation protein MntS	NA	NA	NA	NA	NA
WP_101191100.1|1398429_1399470_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	62.6	5.8e-118
WP_160599556.1|1399518_1401303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101191106.1|1401380_1401965_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	40.9	5.0e-34
WP_001247709.1|1402100_1402322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101191108.1|1402352_1402856_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.9	5.9e-60
WP_000643373.1|1402865_1403039_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_040080386.1|1403047_1403476_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	55.4	4.3e-27
WP_101191110.1|1403475_1403877_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	67.7	9.9e-50
WP_000551166.1|1403944_1404178_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_101191140.1|1404174_1404765_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	72.9	6.5e-74
WP_000152853.1|1404761_1405091_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	45.5	9.7e-11
WP_101191113.1|1405080_1405941_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	82.7	1.0e-131
WP_101191115.1|1405937_1407959_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	73.9	2.6e-295
1407244:1407262	attL	GCTACATCGCGAAATACAT	NA	NA	NA	NA
WP_101191117.1|1408078_1408285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032084290.1|1408258_1408582_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	1.4e-49
WP_000038358.1|1408578_1409640_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	78.0	8.4e-165
WP_001151952.1|1409636_1411412_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	82.9	2.8e-290
WP_101191119.1|1411573_1412377_+|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	54.4	3.2e-76
WP_101191121.1|1412439_1413462_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	1.8e-159
WP_101191124.1|1413465_1414167_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	69.8	5.9e-90
WP_135566521.1|1414227_1414716_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.0	8.6e-64
WP_101191128.1|1414712_1415219_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	70.1	1.2e-65
WP_068859038.1|1415215_1415923_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	78.6	3.0e-102
WP_101191130.1|1415919_1417047_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	80.5	2.9e-171
WP_101191132.1|1417043_1417499_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	70.9	1.5e-57
WP_001155239.1|1417508_1417811_+|holin	holin	holin	Q6K1I2	Salmonella_virus	58.1	4.7e-20
WP_000175563.1|1417797_1418139_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	92.1	9.9e-51
WP_000094478.1|1418138_1418477_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	62.3	2.4e-28
WP_101191134.1|1418623_1418881_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	62.2	6.2e-21
WP_101191136.1|1419068_1421036_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.7	6.6e-272
WP_001286237.1|1421032_1421362_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	71.6	1.4e-38
WP_071290225.1|1421358_1422543_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.6	1.5e-175
WP_001001819.1|1422535_1423123_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.1	3.8e-90
WP_160599558.1|1423133_1424741_+|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	79.1	5.8e-133
WP_000576408.1|1424740_1425328_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	48.2	6.3e-45
WP_160599560.1|1425317_1426043_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.0	4.3e-59
WP_000200798.1|1426014_1426560_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	74.2	1.0e-65
WP_135566535.1|1426562_1428263_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	79.7	2.3e-225
WP_000787654.1|1428353_1428686_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	50.0	1.3e-23
WP_060773731.1|1429240_1429780_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000091016.1|1430057_1430525_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_000056442.1|1430521_1431640_+	anion transporter	NA	NA	NA	NA	NA
WP_001056384.1|1431698_1432619_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000961458.1|1432837_1434430_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|1434670_1435936_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114258.1|1436087_1436903_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209346.1|1437048_1439481_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|1439486_1440386_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|1440516_1441179_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
WP_032255111.1|1441254_1442004_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_072650795.1|1442003_1443239_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513761.1|1443442_1444408_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_032255110.1|1444394_1446266_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	3.0e-16
WP_000090140.1|1446285_1447824_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|1447841_1448762_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236051.1|1448764_1449676_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001459603.1|1449853_1452202_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000086904.1|1452209_1453538_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|1453584_1454910_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|1455122_1455506_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555031.1|1455616_1456732_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_032255108.1|1456728_1457355_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001300708.1|1457601_1458804_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
WP_000450121.1|1458850_1459609_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_001295291.1|1459666_1460263_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001180089.1|1460547_1461780_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000605480.1|1461820_1462105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000023565.1|1462190_1463006_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217859.1|1463005_1464214_-	MFS transporter	NA	NA	NA	NA	NA
WP_001295289.1|1464297_1464834_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000290937.1|1464938_1465991_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001513672.1|1466179_1466371_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047320.1|1466386_1466956_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001247707.1|1467081_1467303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|1467335_1467845_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|1467852_1468053_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001352070.1|1468016_1468358_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_001244216.1|1468425_1468659_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752613.1|1468658_1468886_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104157.1|1468882_1469740_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_160599562.1|1469736_1472151_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
1471226:1471244	attR	GCTACATCGCGAAATACAT	NA	NA	NA	NA
WP_001154434.1|1472302_1472491_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1472501_1472735_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
>prophage 112
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1476461	1509575	4744425	tail,capsid,lysis,head,plate,terminase,portal	Salmonella_phage(74.19%)	41	NA	NA
WP_095474244.1|1476461_1477487_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.9	4.9e-170
WP_001098431.1|1477486_1479253_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_028985445.1|1479395_1480229_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	85.9	1.7e-123
WP_073278881.1|1480245_1481304_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_160599564.1|1481307_1481958_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	6.2e-110
WP_063085725.1|1482053_1482518_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_053921329.1|1482517_1482721_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_000171568.1|1482724_1482940_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069908.1|1482920_1483436_+	lysozyme	NA	E5G6N1	Salmonella_phage	93.0	5.6e-90
WP_096962349.1|1483432_1483861_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	87.9	2.6e-56
WP_001039935.1|1483956_1484388_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_080884302.1|1484380_1484827_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_096962350.1|1484895_1485474_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	1.8e-92
WP_096962351.1|1485470_1485830_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	1.4e-50
WP_096962352.1|1485816_1486725_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	8.6e-142
WP_096962353.1|1486717_1487323_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	93.0	8.9e-111
WP_160599566.1|1487319_1488804_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	72.7	6.0e-201
WP_088294209.1|1488803_1489409_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	77.9	3.0e-82
WP_001236016.1|1489377_1489575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095474247.1|1489972_1490539_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	6.4e-87
WP_160599568.1|1490681_1491854_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	6.0e-204
WP_001207660.1|1491863_1492379_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281009.1|1492433_1492736_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1492750_1492870_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_096962338.1|1492862_1495940_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.3	0.0e+00
WP_001471299.1|1495936_1496422_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.1e-66
WP_040090188.1|1496418_1497519_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	6.5e-176
WP_000972391.1|1497609_1497828_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1498063_1499749_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1500018_1500396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195225.1|1500425_1500683_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_001201560.1|1500842_1501130_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_097457499.1|1501113_1501818_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1501896_1502799_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1502886_1503363_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_072650792.1|1503713_1504826_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1504920_1506054_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_001093854.1|1506063_1507017_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1507013_1507859_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1507918_1508407_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149767.1|1508447_1509575_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
>prophage 113
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1512935	1515673	4744425		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027213.1|1512935_1513664_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	4.6e-29
WP_001270734.1|1513881_1514397_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1514522_1514846_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255168.1|1514842_1515673_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 114
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1519260	1520979	4744425		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815362.1|1519260_1520979_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
>prophage 115
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1530275	1554131	4744425	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188140.1|1530275_1532222_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1532294_1532519_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1532841_1533162_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1533192_1535469_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1536328_1536547_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241676.1|1536831_1537536_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202202.1|1537577_1539299_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001043578.1|1539299_1541066_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|1541188_1542154_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|1542698_1543193_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077038.1|1543327_1547317_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1547471_1548083_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1548093_1549437_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1549527_1550820_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|1551058_1553503_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|1553513_1554131_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 116
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1560203	1563418	4744425		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|1560203_1560944_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|1561135_1563418_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 117
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1567516	1568605	4744425		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|1567516_1568605_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 118
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1573691	1578233	4744425		Bacillus_phage(100.0%)	3	NA	NA
WP_000167339.1|1573691_1573976_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|1574183_1576448_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1576484_1578233_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 119
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1592937	1603905	4744425	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|1592937_1593486_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|1593512_1594160_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_160599574.1|1594381_1595572_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|1595755_1596844_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_100286980.1|1597445_1598846_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_001307697.1|1599014_1600217_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193841.1|1600482_1603095_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090506.1|1603137_1603905_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 120
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1620600	1622508	4744425		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|1620600_1622508_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 121
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1635107	1637162	4744425		Bacillus_phage(100.0%)	1	NA	NA
WP_000420536.1|1635107_1637162_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 122
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1641395	1642055	4744425	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_032255453.1|1641395_1642055_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 123
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1662095	1674350	4744425		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1662095_1662308_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1662318_1662507_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|1662481_1662712_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1662701_1662875_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829668.1|1662922_1663996_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071828255.1|1664067_1666812_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264919.1|1666894_1667923_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1667895_1668588_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|1668717_1669890_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_072650951.1|1669889_1672436_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	2.2e-70
WP_000209869.1|1672432_1673032_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1673124_1673430_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420629.1|1673429_1674350_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
>prophage 124
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1678656	1680931	4744425		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|1678656_1678830_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001459639.1|1679087_1680416_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	6.3e-234
WP_001028095.1|1680436_1680931_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 125
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1695691	1696756	4744425		Cronobacter_phage(100.0%)	1	NA	NA
WP_000258765.1|1695691_1696756_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.1e-90
>prophage 126
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1701585	1702419	4744425		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1701585_1702419_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 127
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1706554	1707088	4744425		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_000857401.1|1706554_1707088_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	46.6	5.9e-26
>prophage 128
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1716396	1717317	4744425		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1716396_1717317_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 129
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1721979	1722225	4744425		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1721979_1722225_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 130
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1738108	1739050	4744425		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|1738108_1739050_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 131
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1751407	1752589	4744425		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1751407_1752142_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1752352_1752589_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 132
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1755861	1757504	4744425		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|1755861_1756503_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|1756499_1757504_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 133
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1769827	1770085	4744425		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1769827_1770085_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 134
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1777374	1781115	4744425		Planktothrix_phage(50.0%)	4	NA	NA
WP_072651001.1|1777374_1778076_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251384.1|1778075_1779320_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291262.1|1779348_1780260_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952737.1|1780275_1781115_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 135
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1784642	1786620	4744425		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|1784642_1785500_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531601.1|1785483_1786620_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
>prophage 136
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1791640	1793011	4744425		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|1791640_1793011_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 137
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1796147	1797824	4744425		Phage_21(50.0%)	2	NA	NA
WP_000444487.1|1796147_1797398_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|1797500_1797824_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
>prophage 138
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1805902	1806991	4744425		Escherichia_phage(100.0%)	1	NA	NA
WP_071524883.1|1805902_1806991_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	41.9	8.3e-75
>prophage 139
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1815524	1817212	4744425		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|1815524_1815944_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|1815943_1817212_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 140
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1843881	1846633	4744425		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|1843881_1845561_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1845685_1846633_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 141
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1849769	1853777	4744425		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|1849769_1850852_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456454.1|1850851_1851685_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200373.1|1851681_1852074_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1852077_1852887_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1852922_1853777_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 142
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1856875	1857106	4744425		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146444.1|1856875_1857106_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 143
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1868361	1878725	4744425		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|1868361_1869900_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|1869896_1870607_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1870606_1871284_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555857.1|1872362_1873205_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|1873254_1873713_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001295622.1|1873825_1874731_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|1874822_1875836_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1876037_1876946_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1877089_1877503_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068077.1|1878107_1878725_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 144
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1888135	1890150	4744425		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|1888135_1889149_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|1889145_1890150_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 145
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1901808	1904766	4744425		Acinetobacter_phage(100.0%)	2	NA	NA
WP_001344826.1|1901808_1903167_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763511.1|1903170_1904766_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 146
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1911737	1917029	4744425	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559274.1|1911737_1912496_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	1.5e-06
WP_000422045.1|1912715_1913765_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1913800_1914052_-	YciN family protein	NA	NA	NA	NA	NA
WP_001295576.1|1914431_1917029_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 147
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1921954	1922545	4744425		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1921954_1922545_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 148
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1930360	1936019	4744425		Lactococcus_phage(50.0%)	5	NA	NA
WP_032255159.1|1930360_1932295_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_032255158.1|1932362_1933490_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1933633_1934422_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968842.1|1934791_1935145_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573412.1|1935212_1936019_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 149
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1948933	1950199	4744425		Klosneuvirus(100.0%)	1	NA	NA
WP_160599592.1|1948933_1950199_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	1.2e-24
>prophage 150
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1964204	1965287	4744425		Planktothrix_phage(100.0%)	1	NA	NA
WP_072650774.1|1964204_1965287_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.8e-22
>prophage 151
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1981906	1982422	4744425		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|1981906_1982422_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 152
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	1988745	1996016	4744425	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_072650778.1|1988745_1989978_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1990232_1991216_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1991693_1993067_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081417.1|1993195_1994131_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001300461.1|1994307_1994742_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837924.1|1994882_1996016_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 153
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2000976	2001966	4744425		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|2000976_2001966_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 154
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2031685	2035588	4744425		Klosneuvirus(100.0%)	1	NA	NA
WP_000139565.1|2031685_2035588_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 155
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2039527	2040476	4744425		Escherichia_phage(50.0%)	2	NA	NA
WP_160599602.1|2039527_2040058_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	9.1e-19
WP_000731833.1|2040302_2040476_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 156
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2053060	2063234	4744425	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_000826416.1|2053060_2054269_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001326689.1|2054308_2055523_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|2055575_2056112_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303492.1|2056184_2058146_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|2058237_2058468_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|2058689_2058866_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|2058911_2059328_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760625.1|2059406_2060816_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047429.1|2061057_2062203_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220393.1|2062220_2063234_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 157
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2067391	2068201	4744425		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867985.1|2067391_2068201_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	40.4	5.0e-16
>prophage 158
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2073243	2075346	4744425		Salmonella_phage(100.0%)	1	NA	NA
WP_160599604.1|2073243_2075346_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.4e-134
>prophage 159
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2080253	2082362	4744425		Ralstonia_phage(100.0%)	1	NA	NA
WP_000103397.1|2080253_2082362_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.8e-26
>prophage 160
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2093998	2095543	4744425		Escherichia_phage(100.0%)	1	NA	NA
WP_000702551.1|2093998_2095543_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 161
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2102427	2102718	4744425		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|2102427_2102718_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 162
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2108908	2110349	4744425		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|2108908_2109193_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642433.1|2109338_2110349_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 163
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2113622	2115528	4744425		Planktothrix_phage(100.0%)	2	NA	NA
WP_032255679.1|2113622_2114549_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
WP_000193546.1|2114541_2115528_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 164
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2119844	2123651	4744425		Klosneuvirus(50.0%)	2	NA	NA
WP_012304876.1|2119844_2122244_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426295.1|2122268_2123651_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 165
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2128925	2131721	4744425		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_014639909.1|2128925_2131721_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	4.4e-19
>prophage 166
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2163492	2164911	4744425		Bacillus_phage(100.0%)	1	NA	NA
WP_000558030.1|2163492_2164911_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 167
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2172657	2174787	4744425		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|2172657_2173041_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803532.1|2173072_2173291_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012628.1|2173347_2174787_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	6.3e-30
>prophage 168
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2183068	2183959	4744425		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|2183068_2183959_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 169
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2189323	2254009	4744425	protease,tail,integrase,transposase,terminase,portal,holin	Enterobacteria_phage(44.44%)	69	2221205:2221221	2246430:2246446
WP_000214712.1|2189323_2189527_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_032256139.1|2189562_2191023_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	6.6e-43
WP_000347482.1|2191111_2192395_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2192998_2193112_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|2193180_2193414_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087133.1|2193732_2194323_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_032256142.1|2194420_2194996_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	6.7e-100
WP_089591998.1|2194995_2198409_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_032256439.1|2198473_2199073_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	97.5	3.7e-109
WP_089592001.1|2199140_2202536_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000741589.1|2202596_2203244_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_000140751.1|2203141_2203885_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.3e-148
WP_001152368.1|2203890_2204589_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|2204598_2204928_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_160599614.1|2204927_2207993_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|2207964_2208294_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|2208302_2208689_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|2208749_2209493_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|2209503_2209905_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677102.1|2209901_2210480_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|2210491_2210767_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097039.1|2210759_2211083_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001136588.1|2211169_2213197_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
WP_000985958.1|2213141_2214650_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
WP_001072975.1|2214649_2214862_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_032256026.1|2214858_2216961_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000373425.1|2216960_2217455_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000548593.1|2218007_2218214_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|2218507_2218681_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_059328823.1|2218853_2218967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947598.1|2219043_2220205_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_071528545.1|2220417_2220606_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2220616_2220829_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|2221192_2221690_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2221205:2221221	attL	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001101173.1|2221686_2222220_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001557934.1|2222333_2222594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189900.1|2222541_2223093_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_000839588.1|2223097_2223313_-|holin	holin	holin	A5LH82	Enterobacteria_phage	91.5	1.2e-30
WP_160599616.1|2223503_2224217_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592549.1|2224623_2225583_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|2225775_2226300_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|2226455_2226833_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_072651066.1|2226850_2227900_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.5e-113
WP_012775982.1|2227901_2228180_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000981003.1|2228246_2228498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160599618.1|2229360_2229549_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083273.1|2229545_2229737_+	YebW family protein	NA	NA	NA	NA	NA
WP_072651084.1|2229830_2232308_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001296941.1|2232395_2232632_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_160599620.1|2232666_2233947_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	61.8	2.1e-154
WP_000836059.1|2234134_2235154_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|2235165_2236380_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001295395.1|2236585_2236912_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	7.6e-24
WP_000705197.1|2237046_2237388_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2237422_2237983_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_072104773.1|2237985_2238696_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2238803_2239109_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072169196.1|2241795_2244219_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	1.3e-208
WP_089591924.1|2244229_2244847_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	8.0e-75
WP_032255138.1|2244848_2245703_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|2245745_2246360_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_001315626.1|2246518_2247811_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2246430:2246446	attR	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_000919231.1|2247763_2248459_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|2248583_2249804_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|2249938_2250832_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|2250938_2252192_+	MFS transporter	NA	NA	NA	NA	NA
WP_032255134.1|2252588_2252912_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233090.1|2253004_2253088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260865.1|2253187_2254009_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 170
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2264109	2265411	4744425		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|2264109_2265411_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 171
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2275487	2277299	4744425		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|2275487_2277299_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 172
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2297174	2298449	4744425	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2297174_2298449_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 173
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2305360	2306859	4744425		Salmonella_phage(50.0%)	2	NA	NA
WP_001424258.1|2305360_2305882_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	1.0e-46
WP_000250656.1|2305962_2306859_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 174
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2315661	2324542	4744425		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|2315661_2316477_+	C40 family peptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|2316604_2317186_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|2317420_2318590_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2318755_2318845_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|2319143_2320169_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|2320165_2321098_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|2321210_2322422_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|2322712_2323861_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|2323900_2324542_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 175
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2330046	2332313	4744425		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587561.1|2330046_2330859_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069987.1|2330862_2331648_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001349911.1|2331644_2332313_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 176
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2340603	2345687	4744425		environmental_halophage(33.33%)	5	NA	NA
WP_000144544.1|2340603_2341824_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	5.8e-93
WP_000907951.1|2341820_2343092_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948863.1|2343066_2343813_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	3.9e-07
WP_047661297.1|2343822_2345310_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|2345318_2345687_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 177
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2361999	2381593	4744425	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000553725.1|2361999_2363700_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.0	1.2e-30
WP_000069375.1|2363756_2366135_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|2366467_2367301_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|2367457_2368504_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|2368635_2368827_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175604.1|2368830_2370267_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001301292.1|2370329_2371043_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|2371289_2371754_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_000029466.1|2371831_2372581_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_160599630.1|2372580_2373132_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956574.1|2373194_2374175_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2374275_2374575_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|2374579_2376967_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2376981_2377965_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2378248_2378293_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|2378415_2378772_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2378824_2379022_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2379118_2379661_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144199.1|2379664_2381593_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	1.6e-129
>prophage 178
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2392887	2395149	4744425		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|2392887_2395149_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 179
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2401478	2402306	4744425		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|2401478_2402306_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 180
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2409782	2411003	4744425		Klosneuvirus(100.0%)	1	NA	NA
WP_000081986.1|2409782_2411003_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	4.2e-27
>prophage 181
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2417767	2418421	4744425		Bacillus_phage(100.0%)	1	NA	NA
WP_001300558.1|2417767_2418421_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 182
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2424019	2425981	4744425		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|2424019_2425981_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 183
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2430907	2434993	4744425		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|2430907_2431549_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_001300835.1|2431641_2433000_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|2433117_2433876_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723723.1|2434012_2434993_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	7.9e-08
>prophage 184
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2443806	2444661	4744425		Indivirus(100.0%)	1	NA	NA
WP_001186335.1|2443806_2444661_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	3.3e-10
>prophage 185
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2447979	2452556	4744425		Bacillus_phage(100.0%)	3	NA	NA
WP_000219687.1|2447979_2449263_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_072651065.1|2449409_2450885_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_096324251.1|2451065_2452556_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 186
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2468434	2477317	4744425	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2468434_2470120_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2470324_2470906_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_072651116.1|2470945_2471641_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_032256127.1|2471698_2473609_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	3.5e-92
WP_001295493.1|2473740_2474085_+	RidA family protein	NA	NA	NA	NA	NA
WP_001407564.1|2475259_2475583_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2475702_2475882_-	YoaH family protein	NA	NA	NA	NA	NA
WP_072650985.1|2475955_2477317_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 187
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2481179	2482736	4744425		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2481179_2482736_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 188
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2488377	2488587	4744425		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2488377_2488587_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 189
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2493917	2495966	4744425		Moraxella_phage(100.0%)	1	NA	NA
WP_072650983.1|2493917_2495966_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 190
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2503462	2507931	4744425		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|2503462_2504119_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976472.1|2504513_2504855_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879297.1|2504867_2505740_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000255065.1|2505743_2506118_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2506256_2506487_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2506588_2507245_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2507268_2507931_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 191
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2515987	2517463	4744425		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|2515987_2517463_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 192
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2521461	2529302	4744425		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|2521461_2522784_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|2522799_2523732_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202990.1|2523810_2524566_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|2524562_2525348_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2525494_2526505_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2526513_2527125_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|2527263_2527329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072650953.1|2528227_2528779_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2528780_2529302_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 193
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2533320	2535371	4744425		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|2533320_2534139_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252979.1|2534191_2534587_+	membrane protein	NA	NA	NA	NA	NA
WP_000019588.1|2534627_2535371_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 194
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2542763	2544497	4744425	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|2542763_2544497_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 195
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2549750	2553687	4744425		Tupanvirus(33.33%)	4	NA	NA
WP_000763867.1|2549750_2550140_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036361.1|2550154_2551204_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	7.9e-06
WP_032255204.1|2551206_2552067_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483202.1|2552085_2553687_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	4.9e-15
>prophage 196
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2560631	2562146	4744425		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|2560631_2562146_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 197
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2574138	2574891	4744425		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|2574138_2574891_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 198
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2587073	2587742	4744425		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334608.1|2587073_2587742_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	7.3e-82
>prophage 199
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2601758	2608582	4744425		Burkholderia_phage(50.0%)	7	NA	NA
WP_001564714.1|2601758_2603453_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
WP_000009306.1|2603690_2603873_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2603951_2604869_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212228.1|2605041_2605962_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_072651041.1|2605950_2606421_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	8.9e-34
WP_001157230.1|2606401_2607820_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.7	3.0e-101
WP_000365580.1|2607886_2608582_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.5	7.3e-08
>prophage 200
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2613648	2614320	4744425		Bacillus_phage(100.0%)	1	NA	NA
WP_001339045.1|2613648_2614320_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 201
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2617864	2618395	4744425		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|2617864_2618395_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 202
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2652532	2656128	4744425	transposase	Escherichia_phage(66.67%)	4	NA	NA
WP_160599639.1|2652532_2653805_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	1.3e-175
WP_000349537.1|2654135_2654288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072275427.1|2654326_2655109_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
WP_000255944.1|2655105_2656128_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 203
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2665904	2668063	4744425		Yersinia_phage(33.33%)	4	NA	NA
WP_063073703.1|2665904_2666726_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	1.6e-46
WP_000860076.1|2666807_2667287_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
WP_001186773.1|2667302_2667779_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692323.1|2667841_2668063_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
>prophage 204
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2672404	2673571	4744425		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830150.1|2672404_2673571_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	1.1e-226
>prophage 205
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2681215	2682115	4744425		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131776.1|2681215_2682115_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 206
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2689468	2692290	4744425		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704874.1|2689468_2690635_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	7.7e-111
WP_000043483.1|2690883_2692290_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
>prophage 207
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2695631	2708252	4744425	transposase	Escherichia_phage(37.5%)	11	NA	NA
WP_109548739.1|2695631_2696663_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L0I7	Tupanvirus	46.2	2.3e-74
WP_160599643.1|2696677_2697952_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	A7IWZ0	Paramecium_bursaria_Chlorella_virus	29.3	6.2e-29
WP_109548741.1|2698070_2699084_-	EpsG family protein	NA	NA	NA	NA	NA
WP_160449824.1|2699099_2699843_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_109548671.1|2699839_2700808_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_109548670.1|2700878_2701427_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.8	7.2e-51
WP_158302278.1|2702278_2703202_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.9e-176
WP_001459897.1|2703433_2704333_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.8	1.7e-28
WP_109548669.1|2704332_2705418_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	2.7e-102
WP_109548667.1|2705789_2706683_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.7	1.1e-45
WP_109548666.1|2706857_2708252_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.2e-19
>prophage 208
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2713964	2720758	4744425		Bacillus_phage(25.0%)	6	NA	NA
WP_001351779.1|2713964_2715335_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.6	1.7e-32
WP_000079313.1|2715527_2716964_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	7.4e-47
WP_047667219.1|2716966_2718190_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479833.1|2718186_2718666_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043590.1|2718668_2719634_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.3e-87
WP_000048190.1|2719636_2720758_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 209
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2725001	2735570	4744425		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|2725001_2725841_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137152.1|2725933_2728096_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|2728098_2728542_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2728547_2729687_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_001296218.1|2730345_2731929_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_047603443.1|2732380_2734234_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2734255_2734837_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2734928_2735570_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 210
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2740295	2741648	4744425		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469709.1|2740295_2741648_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	4.1e-07
>prophage 211
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2755496	2761603	4744425	tRNA	Bacillus_phage(50.0%)	6	NA	NA
WP_000675150.1|2755496_2756900_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|2756896_2757619_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2757809_2758142_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|2758288_2759650_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001318299.1|2759980_2760298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807356.1|2760703_2761603_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 212
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2770824	2774381	4744425		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|2770824_2771829_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011950.1|2771825_2772791_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2772764_2773511_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001373513.1|2773562_2774381_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.9e-24
>prophage 213
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2784028	2786062	4744425	tRNA	Indivirus(100.0%)	1	NA	NA
WP_160599655.1|2784028_2786062_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	1.0e-54
>prophage 214
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2797694	2807135	4744425		Enterobacteria_phage(85.71%)	10	NA	NA
WP_072650816.1|2797694_2798831_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	1.6e-161
WP_001375261.1|2798827_2800828_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2800952_2801414_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2801453_2801924_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2801970_2802690_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2802686_2804372_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2804593_2805325_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2805384_2805492_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2805472_2806204_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|2806208_2807135_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 215
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2827556	2829077	4744425		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|2827556_2829077_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 216
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2832771	2836557	4744425		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2832771_2833440_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|2833697_2834534_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489277.1|2834565_2836557_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 217
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2840626	2841484	4744425		Catovirus(100.0%)	1	NA	NA
WP_001459921.1|2840626_2841484_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	5.3e-24
>prophage 218
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2856032	2860333	4744425		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_001091940.1|2856032_2857499_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.3e-43
WP_000198828.1|2857616_2858603_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_160599660.1|2858641_2859355_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_032256184.1|2859766_2860333_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	9.5e-14
>prophage 219
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2866087	2873735	4744425		Vibrio_phage(50.0%)	7	NA	NA
WP_000194927.1|2866087_2867677_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|2867680_2868025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|2868357_2869548_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|2869575_2870271_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|2870419_2872180_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|2872304_2872589_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050793.1|2872727_2873735_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 220
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2885609	2886227	4744425		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2885609_2886227_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 221
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2895336	2901141	4744425		Bacillus_phage(25.0%)	5	NA	NA
WP_000422182.1|2895336_2896980_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
WP_000884971.1|2897055_2897706_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
WP_032255080.1|2897705_2898770_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406085.1|2898843_2899899_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865600.1|2900010_2901141_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.2	1.1e-117
>prophage 222
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2906195	2911038	4744425		Hokovirus(50.0%)	2	NA	NA
WP_000876011.1|2906195_2909045_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_000559135.1|2909211_2911038_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 223
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2925961	2928589	4744425		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|2925961_2928589_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 224
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2934033	2940180	4744425		Pseudomonas_phage(50.0%)	4	NA	NA
WP_001075164.1|2934033_2936319_+	ribonucleoside-diphosphate reductase 1 subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|2936552_2937683_+	ribonucleoside-diphosphate reductase 1 subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|2937682_2937937_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000779102.1|2939103_2940180_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 225
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2946072	2950583	4744425	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140569.1|2946072_2946972_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000150333.1|2946984_2947170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032255073.1|2947210_2948014_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001459935.1|2948031_2949321_-	MFS transporter	NA	NA	NA	NA	NA
WP_001319848.1|2949377_2950583_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 226
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2954186	2959190	4744425		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|2954186_2954789_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001295286.1|2955096_2956236_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|2956239_2957208_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|2957207_2959190_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 227
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	2993622	2996850	4744425		Salmonella_phage(50.0%)	3	NA	NA
WP_000813859.1|2993622_2994222_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|2994280_2996113_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|2996199_2996850_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 228
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3007409	3093361	4744425	tail,capsid,tRNA,head,integrase,plate,transposase,terminase,portal,holin	Enterobacteria_phage(72.55%)	93	3076417:3076476	3091378:3092145
WP_000156140.1|3007409_3008300_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	44.2	5.2e-67
WP_001293613.1|3008496_3009270_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000569958.1|3009277_3009994_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000965522.1|3009990_3010677_-	histidine ABC transporter permease HisQ	NA	NA	NA	NA	NA
WP_000737621.1|3010766_3011549_-	histidine ABC transporter substrate-binding protein HisJ	NA	NA	NA	NA	NA
WP_000748271.1|3011769_3012552_-	lysine/arginine/ornithine ABC transporter substrate-binding protein ArgT	NA	NA	NA	NA	NA
WP_000825700.1|3012817_3013387_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_000334220.1|3013481_3014999_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
WP_000262113.1|3015035_3015524_-	colicin V production protein	NA	NA	NA	NA	NA
WP_000146992.1|3015782_3016445_-	cell division protein DedD	NA	NA	NA	NA	NA
WP_000584546.1|3016434_3017703_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_160599672.1|3017772_3018687_-	acetyl-CoA carboxylase, carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_000364335.1|3018842_3019502_-	DedA family protein	NA	NA	NA	NA	NA
WP_001283585.1|3019584_3020397_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|3020396_3021410_-	USG-1 protein	NA	NA	NA	NA	NA
WP_000004836.1|3021475_3022633_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
WP_000023401.1|3022791_3023796_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	56.0	1.5e-99
WP_001390705.1|3023892_3024213_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000004249.1|3024326_3024614_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_000200501.1|3024620_3024827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813367.1|3025079_3025421_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	92.2	6.6e-55
WP_000158962.1|3025431_3025719_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514283.1|3025730_3025973_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	5.2e-38
WP_000021656.1|3025969_3026083_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000985159.1|3026169_3026373_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153674.1|3026369_3026615_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000104305.1|3026611_3026911_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_001447282.1|3026922_3027540_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000564228.1|3027536_3027926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160599674.1|3027922_3030763_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	89.3	0.0e+00
WP_001504475.1|3030839_3031799_+	plasmid segregation protein parM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
WP_025653442.1|3031803_3032118_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	53.3	1.4e-19
WP_025653443.1|3032201_3033044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|3033083_3033581_-	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000087812.1|3034229_3035276_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_021546059.1|3035275_3037027_-|terminase	phage terminase	terminase	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_160599676.1|3037181_3038018_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	2.3e-149
WP_001055104.1|3038041_3039094_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_000632332.1|3039139_3039940_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	1.4e-124
WP_000063103.1|3040041_3040536_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000864901.1|3040535_3040736_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000104350.1|3040738_3041062_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|3041058_3041451_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780549.1|3041447_3041855_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.8	4.6e-63
WP_000920594.1|3041992_3042460_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_052948113.1|3042452_3043088_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	6.9e-114
WP_001271932.1|3043084_3043666_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
WP_000213444.1|3043662_3044013_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111951.1|3044016_3044913_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	9.7e-154
WP_000071724.1|3044905_3045514_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_160599678.1|3045510_3047016_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	62.3	3.3e-154
WP_160599680.1|3047036_3047462_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.2	4.4e-72
WP_077737748.1|3048632_3049232_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	86.9	1.2e-86
WP_000979954.1|3049258_3049747_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_160599682.1|3049759_3052567_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	89.5	0.0e+00
WP_000763327.1|3052553_3052682_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
WP_000665308.1|3052717_3053083_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|3053137_3053650_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005450.1|3053649_3054834_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.5	5.6e-226
WP_160599684.1|3054991_3056101_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.4	7.4e-204
WP_000488107.1|3056143_3056404_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|3056594_3056735_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_001173929.1|3056997_3057330_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_160599686.1|3057334_3058228_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_160599688.1|3058496_3059492_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|3059488_3060667_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|3060931_3062152_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683789.1|3062310_3064317_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|3064437_3064716_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089250.1|3064749_3065298_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|3065297_3066107_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043792.1|3066106_3066931_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|3066934_3068020_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001459941.1|3068054_3068987_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730816.1|3069152_3069704_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001400721.1|3069829_3070654_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000197766.1|3070655_3071207_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000809301.1|3071203_3071683_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000789849.1|3071679_3072186_-	fimbrial protein	NA	NA	NA	NA	NA
WP_032255403.1|3072202_3072955_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_032255404.1|3072974_3075620_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033319.1|3075701_3076265_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
3076417:3076476	attL	GGTAATGACTCCAACTTACTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
WP_001195819.1|3077725_3078211_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426161.1|3078413_3080558_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531952.1|3080557_3081868_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|3082048_3082333_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_072650878.1|3082704_3084045_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776768.1|3085651_3086407_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368140.1|3086700_3087633_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_160599809.1|3087944_3089099_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	4.1e-221
WP_160599690.1|3089169_3090492_-	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	28.1	8.4e-29
WP_160599692.1|3091356_3091875_-	acyltransferase	NA	C6ZR20	Salmonella_phage	59.7	1.0e-43
WP_085947598.1|3092198_3093361_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
3091378:3092145	attR	GACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCATTACCTTGCTCTTCAACACCAAGTGACCACAAATGCATTAGTGGCTTGGTTTCTGATGCGGCGTCAAAGTAACCAGATTCATTGTAAAGAATGATGTTCTGTATAAAACCAAGACCTCCAGAAACATGCTTTCCTAGCATAACAAACTCATCGGAAAGCATCACATTCCATCCATATGCCAATGTTACAATAAGTACTAAGAGCAGTGCAGGGAATATCCTCTTAATTCTTCTTGCATAGAAATCAGAAAATGAAAACATACCCCCTAGAGTTTGCTTGAATATAATACCAGAAATGAGGTATCCAGATATCACAAAAAAGAAGTCAACCCCAACAAAACCGCCGGGGATGACATAAGGAAACGCATGATAGATAACAACGCCAAATATTGCTATTGCTCTAAGCCCGTCTATGTCAGGCCTGTATTGTCTATTTTCTTTCATTTCAGAGAGTTACAGTTGTAAAGGTTAGCAGACATTGTAACATCATGACAGTATTCGTGCCAATTTAACCTATAACAGTTCCATCAGTCAGGCTAGTCGGTGGAGAACCAAATTTACGAACCAGTTGATTAGAAGAATTCCTGAACAAATAGAATTTACTACCAAATTCAGTGCAAGGGACTCCTGTTCCTGAAGTTGATGCAAGACCTAGGTTATAGCTCACCCACGCCTTCCCATCAAATAAAATATTATTGACAATATTGGAATCAC	NA	NA	NA	NA
>prophage 229
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3097966	3098887	4744425		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|3097966_3098887_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 230
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3102705	3103440	4744425		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3102705_3103440_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 231
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3130483	3143153	4744425		Streptococcus_phage(40.0%)	12	NA	NA
WP_000443661.1|3130483_3132499_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_072650874.1|3132569_3133556_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|3133785_3134547_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|3134731_3135703_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|3136086_3136344_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|3136388_3138116_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|3138156_3138666_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096674.1|3138708_3139560_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719959.1|3139664_3140039_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000710495.1|3140071_3140806_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001295461.1|3141010_3141922_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	7.7e-58
WP_000021019.1|3142055_3143153_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 232
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3146170	3146962	4744425		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517428.1|3146170_3146962_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.2e-17
>prophage 233
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3150440	3155560	4744425		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|3150440_3151745_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|3151984_3152884_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|3152979_3153555_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000842944.1|3153615_3154065_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|3154051_3154477_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
WP_000102891.1|3154690_3155560_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 234
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3161236	3162412	4744425	integrase	Enterobacteria_phage(100.0%)	1	3154942:3154954	3163720:3163732
3154942:3154954	attL	GCTGGCGATTGCT	NA	NA	NA	NA
WP_064735519.1|3161236_3162412_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	40.6	3.6e-76
WP_064735519.1|3161236_3162412_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	40.6	3.6e-76
3163720:3163732	attR	AGCAATCGCCAGC	NA	NA	NA	NA
>prophage 235
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3184506	3185457	4744425		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3184506_3185457_+	transaldolase A	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 236
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3202745	3203459	4744425		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3202745_3203459_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 237
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3224758	3228760	4744425		Enterobacteria_phage(33.33%)	4	NA	NA
WP_160599700.1|3224758_3226048_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	1.5e-62
WP_001295473.1|3226133_3226760_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|3227084_3228122_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|3228121_3228760_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 238
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3235194	3241489	4744425		Escherichia_phage(60.0%)	6	NA	NA
WP_001344399.1|3235194_3235368_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
WP_000669402.1|3235681_3236197_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
WP_000755173.1|3236212_3236752_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138270.1|3236844_3238422_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_121865549.1|3238490_3239957_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937912.1|3240118_3241489_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 239
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3250319	3250751	4744425		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3250319_3250751_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 240
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3260961	3267418	4744425		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133580.1|3260961_3262245_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|3262422_3262623_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|3262634_3262970_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|3262971_3264822_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|3264838_3265354_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3265449_3265773_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3265789_3266176_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3266203_3267418_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 241
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3282645	3284157	4744425		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_089591771.1|3282645_3284157_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 242
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3290049	3301339	4744425		Bacillus_phage(50.0%)	7	NA	NA
WP_072650882.1|3290049_3291303_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.5	3.9e-100
WP_000883122.1|3291630_3292821_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3292865_3293204_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001459995.1|3293264_3294599_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_160599713.1|3294588_3295302_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001311037.1|3295466_3296894_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_160599715.1|3297451_3301339_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.4	1.0e-130
>prophage 243
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3305458	3305719	4744425		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|3305458_3305719_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 244
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3309178	3312920	4744425		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3309178_3309859_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002541.1|3310130_3311105_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3311120_3312920_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 245
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3318691	3324950	4744425	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|3318691_3320026_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001300638.1|3320234_3321116_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3321218_3321806_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3321861_3322245_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3322549_3323239_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3323286_3324324_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3324530_3324950_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 246
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3330243	3331542	4744425		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|3330243_3331542_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 247
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3337396	3339970	4744425		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3337396_3339970_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 248
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3345876	3346947	4744425		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_032255588.1|3345876_3346947_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	1.5e-89
>prophage 249
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3360692	3361175	4744425		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|3360692_3361175_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 250
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3366825	3377182	4744425	integrase,transposase	Salmonella_phage(33.33%)	8	3369695:3369719	3394487:3394511
WP_071524906.1|3366825_3367044_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.0	4.1e-10
WP_001347906.1|3369285_3369570_-	hypothetical protein	NA	NA	NA	NA	NA
3369695:3369719	attL	TTACCTGACCCATTACCTGACCCAA	NA	NA	NA	NA
WP_072661569.1|3369764_3371081_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.6	3.0e-34
WP_047928883.1|3371210_3371807_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	2.1e-96
WP_074152531.1|3371893_3372238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158302278.1|3372489_3373413_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	1.9e-176
WP_001562837.1|3374327_3375536_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.2	4.9e-44
WP_094323124.1|3375814_3377182_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.1	2.5e-20
3394487:3394511	attR	TTACCTGACCCATTACCTGACCCAA	NA	NA	NA	NA
>prophage 251
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3401539	3405591	4744425		Klosneuvirus(50.0%)	4	NA	NA
WP_000097662.1|3401539_3402820_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_001295173.1|3403057_3404458_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|3404478_3405141_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|3405141_3405591_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 252
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3409527	3414822	4744425		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|3409527_3409773_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|3409769_3410180_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246527.1|3410152_3412297_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000777969.1|3412306_3413266_+	ribonucleoside-diphosphate reductase 2 subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|3413619_3414822_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 253
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3427872	3433258	4744425	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3427872_3428058_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047170.1|3428292_3430923_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|3431050_3431551_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3431619_3432681_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|3432760_3433258_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 254
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3438724	3439690	4744425		Tetraselmis_virus(100.0%)	1	NA	NA
WP_032254954.1|3438724_3439690_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.3	2.7e-37
>prophage 255
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3447165	3448179	4744425		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001300815.1|3447165_3448179_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.4	9.3e-28
>prophage 256
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3466004	3479187	4744425		Escherichia_phage(40.0%)	12	NA	NA
WP_001272907.1|3466004_3468566_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	2.3e-30
WP_001141339.1|3468671_3469328_+	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.3	5.6e-50
WP_001295181.1|3469378_3470146_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847985.1|3470341_3471250_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590404.1|3471246_3472509_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
WP_001278994.1|3472505_3473144_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|3473148_3473925_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104429.1|3474013_3475378_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081561.1|3475471_3476464_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	3.9e-31
WP_001272590.1|3476526_3477666_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3477805_3478432_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_032254949.1|3478425_3479187_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	1.0e-58
>prophage 257
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3482299	3484332	4744425		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|3482299_3482905_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090361.1|3482904_3484332_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 258
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3508701	3509487	4744425		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|3508701_3509487_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 259
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3514021	3518941	4744425		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|3514021_3514693_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_072650839.1|3514831_3514972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032254940.1|3514985_3515858_+	YgcG family protein	NA	NA	NA	NA	NA
WP_032254939.1|3515917_3517216_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	9.8e-131
WP_000210878.1|3517303_3518941_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 260
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3522973	3527088	4744425		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046812.1|3522973_3524275_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	5.2e-39
WP_000186450.1|3524331_3527088_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 261
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3534623	3535472	4744425		Vibrio_phage(100.0%)	1	NA	NA
WP_000100420.1|3534623_3535472_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 262
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3540330	3541086	4744425		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3540330_3541086_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 263
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3552612	3568050	4744425	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001300698.1|3552612_3553818_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184261.1|3553817_3554261_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_072650836.1|3554311_3555118_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|3555356_3556454_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|3556922_3558176_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|3558407_3559739_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775931.1|3559800_3561627_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_001460029.1|3561626_3565169_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.2e-08
WP_001138156.1|3565161_3568050_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 264
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3573527	3580300	4744425		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|3573527_3574322_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|3574328_3575204_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|3575354_3577601_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3577613_3578144_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|3578828_3579518_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3579586_3580300_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 265
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3589931	3592426	4744425		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|3589931_3591350_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603508.1|3591664_3592426_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 266
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3597319	3601416	4744425	integrase,transposase	Acinetobacter_phage(50.0%)	3	NA	NA
WP_085968805.1|3597319_3598481_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000023114.1|3599387_3600608_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_160599727.1|3600702_3601416_-	hypothetical protein	NA	A0A291LAA9	Escherichia_phage	57.6	2.8e-63
>prophage 267
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3612473	3623335	4744425	tRNA	Clostridium_phage(16.67%)	8	NA	NA
WP_001272558.1|3612473_3613229_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
WP_131419234.1|3613643_3616001_+	xanthine dehydrogenase molybdenum-binding subunit XdhA	NA	A0A2L1IV26	Escherichia_phage	100.0	6.1e-06
WP_077250666.1|3616711_3617206_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|3617248_3618766_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3618775_3619874_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813208.1|3619964_3621698_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	4.1e-60
WP_000715214.1|3621703_3622414_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3622438_3623335_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 268
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3627259	3632632	4744425		Pandoravirus(50.0%)	3	NA	NA
WP_001338826.1|3627259_3628693_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
WP_000951948.1|3628749_3629493_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195061.1|3629758_3632632_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
>prophage 269
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3640768	3642001	4744425		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3640768_3642001_-	D-3-phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 270
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3670296	3713299	4744425	protease,transposase,integrase,tRNA	Escherichia_phage(33.33%)	37	3687283:3687297	3707371:3707385
WP_001062128.1|3670296_3671451_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3671874_3673269_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_001300769.1|3673345_3673843_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3673937_3674645_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300912.1|3674724_3675456_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|3675468_3676419_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3676527_3677091_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3677090_3677507_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001295381.1|3677690_3678671_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_001424369.1|3678688_3679393_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3679410_3679977_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3679973_3680264_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174735.1|3680271_3680865_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239928.1|3680857_3681994_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032237482.1|3682148_3683156_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|3683272_3684319_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3684494_3685214_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|3685397_3685724_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3685723_3686443_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_032255037.1|3686603_3687656_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
3687283:3687297	attL	CGCTGCCGGAGCGCA	NA	NA	NA	NA
WP_000091700.1|3687683_3687959_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3688023_3689103_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001299430.1|3689304_3690561_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839760.1|3690610_3692746_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|3693143_3693851_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_025670815.1|3694229_3695495_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	43.3	1.2e-80
WP_001039463.1|3696961_3697348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|3697356_3697548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049100257.1|3697625_3700565_+	AAA family ATPase	NA	U5J9B0	Bacillus_phage	25.5	7.1e-12
WP_073503524.1|3700561_3701986_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001118621.1|3702217_3703141_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	100.0	8.4e-177
WP_001067855.1|3703673_3704378_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000844627.1|3707118_3707361_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001493764.1|3707392_3708043_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
3707371:3707385	attR	TGCGCTCCGGCAGCG	NA	NA	NA	NA
WP_001493765.1|3708148_3709348_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001351729.1|3710400_3710793_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001067855.1|3712594_3713299_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 271
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3720208	3725802	4744425	transposase	Escherichia_phage(100.0%)	5	NA	NA
WP_001067855.1|3720208_3720913_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032319017.1|3721060_3723334_+	thiosulfate reductase PhsA	NA	NA	NA	NA	NA
WP_016153548.1|3723348_3723927_+	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	38.0	2.1e-21
WP_032319018.1|3723923_3724691_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001067855.1|3725097_3725802_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 272
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3742576	3743461	4744425		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|3742576_3743461_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 273
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3749424	3758774	4744425		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000013149.1|3749424_3750252_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000848528.1|3751427_3751685_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|3751727_3753947_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|3754057_3755470_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|3755544_3756282_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3756515_3758774_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 274
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3762086	3762479	4744425		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|3762086_3762479_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 275
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3766306	3777269	4744425		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|3766306_3768199_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3768227_3768809_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444752.1|3768808_3769636_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3769660_3770083_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3770083_3770713_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|3770917_3772399_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|3772546_3773218_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|3773223_3774384_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000188362.1|3774421_3775237_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3775352_3776126_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3776183_3776354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3776615_3777269_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 276
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3786785	3788219	4744425		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_032255097.1|3786785_3788219_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.9e-40
>prophage 277
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3793356	3794595	4744425	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708487.1|3793356_3794595_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
>prophage 278
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3800995	3817191	4744425	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|3800995_3802009_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|3802246_3802462_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3802572_3804318_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|3804512_3806354_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|3806432_3806939_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001066494.1|3807192_3807957_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|3808244_3808868_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000094697.1|3809021_3810542_-	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	53.0	6.2e-36
WP_000626913.1|3810848_3812339_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	1.4e-32
WP_000450594.1|3812380_3812713_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|3812931_3813915_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_160599743.1|3814098_3817191_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	2.1e-155
>prophage 279
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3830045	3831011	4744425		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|3830045_3831011_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 280
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3851806	3854101	4744425		Tetraselmis_virus(100.0%)	1	NA	NA
WP_160599745.1|3851806_3854101_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	40.8	8.2e-157
>prophage 281
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3862194	3863340	4744425		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|3862194_3863340_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 282
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3886349	3894143	4744425		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809271.1|3886349_3887210_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	5.6e-50
WP_072651018.1|3887274_3889311_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000246830.1|3889268_3889664_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|3889683_3890274_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|3890283_3890859_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147574.1|3890972_3892013_-	permease	NA	NA	NA	NA	NA
WP_001300423.1|3892085_3892721_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|3892848_3893367_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|3893346_3893790_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189333.1|3893840_3894143_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 283
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3899845	3901735	4744425		Klosneuvirus(100.0%)	1	NA	NA
WP_160599749.1|3899845_3901735_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A1V0SIR5	Klosneuvirus	35.3	9.1e-53
>prophage 284
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3907216	3913855	4744425		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|3907216_3909889_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|3909913_3911401_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|3911428_3911881_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|3912511_3913855_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 285
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3917937	3920810	4744425	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|3917937_3918786_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|3918875_3920810_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 286
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3927584	3929063	4744425		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|3927584_3928556_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|3928784_3929063_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 287
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3933131	3947925	4744425		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|3933131_3933941_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_072651019.1|3934150_3935128_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|3935141_3936128_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|3936148_3936715_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|3936711_3937287_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|3937255_3937813_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3937819_3938545_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|3938592_3940026_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|3940048_3940336_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|3940453_3940945_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3940990_3941845_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3941841_3942114_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_032255193.1|3942326_3942959_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|3942955_3943684_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|3943680_3944334_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_152935754.1|3944563_3946900_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.5	4.4e-41
WP_001299745.1|3946995_3947925_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 288
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3957621	3959112	4744425		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|3957621_3959112_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 289
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3962815	3963313	4744425	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3962815_3963313_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 290
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3967279	3969804	4744425	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|3967279_3968647_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|3968736_3969804_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 291
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3986580	3987624	4744425		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3986580_3987624_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 292
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	3996911	4001424	4744425		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000132907.1|3996911_3998411_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.8	1.4e-11
WP_001341904.1|3998471_3999362_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000275535.1|3999397_4000252_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_000843960.1|4000593_4001424_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 293
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4006761	4007646	4744425		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|4006761_4007646_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 294
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4014150	4018304	4744425		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|4014150_4015176_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019674.1|4015243_4016425_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001297685.1|4016434_4017538_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078339.1|4017545_4018304_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 295
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4028808	4030280	4744425	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|4028808_4029318_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_160599753.1|4029332_4030280_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 296
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4051495	4053448	4744425		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|4051495_4053448_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 297
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4062278	4070837	4744425		uncultured_Caudovirales_phage(40.0%)	8	NA	NA
WP_000773156.1|4062278_4064972_-	bifunctional chitinase/lysozyme	NA	M1HC48	Acanthocystis_turfacea_Chlorella_virus	36.0	8.7e-41
WP_000031783.1|4065263_4066448_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|4066518_4068633_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|4068729_4069200_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4069296_4069671_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001753123.1|4069796_4070084_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_001753124.1|4070091_4070451_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	6.2e-11
WP_001209689.1|4070450_4070837_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 298
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4076407	4085948	4744425		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|4076407_4078321_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_032254965.1|4078320_4079343_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|4079336_4079555_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|4079608_4080478_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|4080532_4080937_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|4081238_4081871_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|4081921_4084012_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|4084078_4085299_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001753126.1|4085384_4085948_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.3e-60
>prophage 299
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4110196	4111033	4744425		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|4110196_4111033_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 300
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4127937	4131704	4744425		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|4127937_4129560_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|4129635_4130988_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|4130984_4131704_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 301
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4138267	4139146	4744425		Sodalis_phage(100.0%)	1	NA	NA
WP_000039063.1|4138267_4139146_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 302
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4145180	4147574	4744425		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|4145180_4147574_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 303
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4151953	4153180	4744425		Ralstonia_phage(100.0%)	1	NA	NA
WP_099528438.1|4151953_4153180_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	59.8	3.4e-133
>prophage 304
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4162410	4164858	4744425		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|4162410_4164858_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 305
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4184868	4186679	4744425		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073599.1|4184868_4185612_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	2.9e-10
WP_000907792.1|4185608_4186679_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 306
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4190220	4191703	4744425		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|4190220_4190934_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|4190935_4191703_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 307
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4197437	4200256	4744425		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4197437_4198292_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4198536_4199595_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617726.1|4199587_4200256_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	3.8e-14
>prophage 308
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4203280	4207412	4744425		Dickeya_phage(50.0%)	4	NA	NA
WP_000964724.1|4203280_4203907_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106560.1|4203980_4206179_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	1.5e-118
WP_000130621.1|4206280_4206526_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|4206746_4207412_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 309
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4215305	4220837	4744425		Bacillus_virus(50.0%)	3	NA	NA
WP_000173631.1|4215305_4216112_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|4216117_4216519_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_160599761.1|4216721_4220837_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	7.1e-26
>prophage 310
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4224212	4226948	4744425		Staphylococcus_phage(100.0%)	1	NA	NA
WP_160599763.1|4224212_4226948_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 311
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4240550	4242593	4744425		Indivirus(100.0%)	1	NA	NA
WP_113987186.1|4240550_4242593_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	1.8e-46
>prophage 312
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4245938	4248073	4744425		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|4245938_4246292_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_032255175.1|4246345_4247635_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	1.0e-172
WP_000065769.1|4247647_4248073_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 313
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4252954	4253602	4744425		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|4252954_4253602_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 314
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4300340	4302325	4744425		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|4300340_4301345_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|4301341_4302325_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 315
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4312537	4314871	4744425		Escherichia_phage(100.0%)	1	NA	NA
WP_001544177.1|4312537_4314871_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.0e-70
>prophage 316
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4318525	4319318	4744425	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|4318525_4318738_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135732.1|4318924_4319077_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_122990545.1|4319156_4319318_+|transposase	transposase	transposase	A0A2I6AZV8	Macacine_betaherpesvirus	100.0	1.2e-19
>prophage 317
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4323978	4324974	4744425		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|4323978_4324974_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 318
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4330292	4331834	4744425		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|4330292_4331834_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 319
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4356108	4366258	4744425	tRNA	uncultured_Caudovirales_phage(66.67%)	6	NA	NA
WP_000582470.1|4356108_4357953_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
WP_000206275.1|4357949_4359341_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|4359438_4360047_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_160599773.1|4360275_4364409_+	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.9	2.1e-25
WP_000072850.1|4364429_4365272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001346013.1|4365424_4366258_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	47.0	3.3e-23
>prophage 320
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4388087	4397594	4744425		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|4388087_4388339_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4388480_4388912_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116565.1|4389156_4390701_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|4390710_4391994_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|4391997_4392957_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|4392943_4393978_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646007.1|4394216_4395242_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|4395251_4396448_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|4396661_4397594_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 321
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4400993	4403087	4744425		Catovirus(50.0%)	2	NA	NA
WP_000064004.1|4400993_4401977_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.5	2.4e-12
WP_000364795.1|4402061_4403087_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
>prophage 322
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4410525	4415088	4744425		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|4410525_4411005_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_160599779.1|4411043_4411853_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	3.4e-25
WP_001051798.1|4411950_4412118_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4412138_4412375_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|4412591_4413260_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050139.1|4413431_4414652_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_001298007.1|4414632_4415088_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
>prophage 323
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4418417	4431683	4744425	integrase	Morganella_phage(33.33%)	14	4414304:4414317	4432858:4432871
4414304:4414317	attL	AAAGCAGGCCACGC	NA	NA	NA	NA
WP_160599781.1|4418417_4419674_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1W6JPG6	Morganella_phage	64.1	6.3e-159
WP_072651171.1|4420082_4420490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072651168.1|4420564_4420747_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_131419180.1|4420762_4421239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131419178.1|4421295_4422729_+	nucleoside triphosphatase	NA	Q7M2A8	Enterobacteria_phage	38.8	8.1e-86
WP_160599813.1|4423547_4423955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044071072.1|4423951_4424158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000935764.1|4424277_4424559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300958.1|4424933_4425758_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
WP_000924289.1|4426048_4426666_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870047.1|4426662_4428345_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.5e-22
WP_001295237.1|4428602_4429226_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4429280_4429556_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|4429574_4431683_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
4432858:4432871	attR	AAAGCAGGCCACGC	NA	NA	NA	NA
>prophage 324
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4436804	4438196	4744425		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4436804_4438196_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 325
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4444338	4453932	4744425	integrase	Enterobacteria_phage(100.0%)	12	4444156:4444178	4454409:4454431
4444156:4444178	attL	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
WP_001593793.1|4444338_4445523_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	90.7	6.4e-206
WP_160599783.1|4445512_4446487_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001593797.1|4446575_4446800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000446146.1|4447117_4447690_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.8	5.0e-95
WP_000638636.1|4447763_4448264_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283042.1|4448260_4448995_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	5.2e-129
WP_001149160.1|4449546_4449813_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980246.1|4449809_4450400_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	99.3	1.3e-69
WP_023568264.1|4450392_4450680_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	1.1e-47
WP_023568265.1|4450672_4451128_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4451263_4451584_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_023568266.1|4451598_4453932_+	phage DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
4454409:4454431	attR	GACTCCTGTGATCTTCCGCCAAA	NA	NA	NA	NA
>prophage 326
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4460567	4461902	4744425		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|4460567_4461902_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 327
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4469208	4478229	4744425		Micromonas_sp._RCC1109_virus(25.0%)	11	NA	NA
WP_000168475.1|4469208_4470897_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001315912.1|4471002_4471101_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000454295.1|4471087_4471378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060506.1|4471665_4471755_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|4472034_4473219_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|4473226_4473724_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4473720_4474083_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4474072_4474420_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|4474527_4474977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828527.1|4475023_4476517_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.6	2.3e-30
WP_032255418.1|4476513_4478229_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 328
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4484581	4485535	4744425		Synechococcus_phage(50.0%)	2	NA	NA
WP_087891894.1|4484581_4485010_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.7e-13
WP_001243437.1|4485121_4485535_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 329
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4489962	4491111	4744425		Oenococcus_phage(100.0%)	1	NA	NA
WP_004025742.1|4489962_4491111_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 330
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4495818	4503187	4744425		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|4495818_4498233_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4498261_4499335_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4499334_4500435_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4500439_4501843_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122985655.1|4502139_4502220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|4502449_4502590_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4502606_4502966_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4502929_4503187_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 331
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4513385	4514723	4744425		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|4513385_4514723_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 332
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4525710	4533317	4744425		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|4525710_4526484_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251978.1|4526666_4527557_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4527556_4528516_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4528601_4529642_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334099.1|4529955_4531785_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|4531946_4533317_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 333
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4545272	4546265	4744425		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845113.1|4545272_4546265_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.9e-50
>prophage 334
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4549433	4555286	4744425		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|4549433_4551302_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_000715936.1|4551468_4551888_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387752.1|4551895_4553401_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|4553405_4554371_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|4554395_4555286_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 335
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4568678	4570325	4744425		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012608.1|4568678_4570325_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 336
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4578798	4584210	4744425		Bacillus_phage(33.33%)	4	NA	NA
WP_001238890.1|4578798_4580820_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_000535975.1|4580866_4582351_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|4582484_4583750_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|4583880_4584210_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 337
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4588252	4594396	4744425		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866670.1|4588252_4589383_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_000006621.1|4589379_4590642_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_021574853.1|4590641_4591709_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	3.9e-101
WP_000676056.1|4591727_4592609_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145168.1|4592586_4593261_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|4593265_4594396_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 338
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4602471	4604127	4744425		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395844.1|4602471_4604127_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 339
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4614431	4618290	4744425		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|4614431_4615328_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|4615327_4616044_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|4616127_4618290_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 340
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4624008	4625850	4744425		Catovirus(100.0%)	1	NA	NA
WP_032255548.1|4624008_4625850_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 341
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4652414	4655701	4744425		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187543.1|4652414_4654055_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|4654133_4654403_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4654406_4654922_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4654924_4655701_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 342
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4664680	4665295	4744425		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|4664680_4665295_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 343
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4679854	4682641	4744425		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|4679854_4682641_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 344
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4686755	4689226	4744425		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188775.1|4686755_4688165_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|4688176_4689226_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 345
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4705486	4708266	4744425		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|4705486_4706383_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621647.1|4706550_4707447_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|4707480_4708266_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 346
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4715583	4718634	4744425		Escherichia_phage(100.0%)	1	NA	NA
WP_077251946.1|4715583_4718634_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 347
NZ_CP047094	Salmonella sp. S13 chromosome, complete genome	4744425	4735232	4744164	4744425	integrase	Salmonella_phage(30.0%)	13	4737224:4737236	4744223:4744235
WP_032255223.1|4735232_4735853_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	60.3	1.3e-64
WP_001166063.1|4736112_4737096_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
4737224:4737236	attL	TTTCTCGTGGAGA	NA	NA	NA	NA
WP_032255224.1|4737244_4737919_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4738024_4739398_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4739394_4740093_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4740242_4740743_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985249.1|4740928_4741909_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	98.2	1.7e-183
WP_001017512.1|4741978_4742272_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	100.0	4.0e-48
WP_000453532.1|4742407_4742680_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
WP_000217677.1|4742849_4743350_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|4743413_4743638_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001747926.1|4743637_4743940_+	hypothetical protein	NA	A0A0F7LCL4	Escherichia_phage	95.0	2.1e-44
WP_001113264.1|4743939_4744164_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
4744223:4744235	attR	TCTCCACGAGAAA	NA	NA	NA	NA
>prophage 1
NZ_CP047090	Salmonella sp. S13 plasmid pS13-1, complete sequence	96320	0	95184	96320	tail,transposase,integrase,holin,head	Escherichia_phage(59.57%)	98	32822:32837	47937:47952
WP_001113737.1|1347_2232_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	100.0	9.5e-162
WP_001281124.1|2566_2959_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	100.0	1.5e-71
WP_000007765.1|3136_3559_-	hypothetical protein	NA	Q71TL5	Escherichia_phage	100.0	5.0e-60
WP_072643889.1|3598_4387_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	93.9	1.4e-116
WP_001369296.1|4395_4575_-	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	98.3	6.8e-27
WP_063099995.1|4849_5134_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_072643888.1|5126_6032_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.3	1.0e-158
WP_113426945.1|6028_8293_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	68.4	0.0e+00
WP_000467133.1|10051_10486_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
WP_000146942.1|10485_10650_+	DUF3927 domain-containing protein	NA	Q1MVI2	Enterobacteria_phage	98.1	6.9e-18
WP_113426946.1|11122_12487_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.3	1.8e-252
WP_001198652.1|12486_13485_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.4	2.1e-194
WP_000535208.1|13531_14164_-	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_000212019.1|14156_15173_-	hypothetical protein	NA	A0A1B0V7N3	Salmonella_phage	100.0	4.5e-192
WP_000602713.1|15174_15960_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	100.0	7.2e-145
WP_000896806.1|15946_16675_-	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_001141901.1|16678_17896_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	1.9e-224
WP_000235786.1|17905_18283_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_047609414.1|18429_18675_+	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	98.8	5.7e-40
WP_047609413.1|18677_19256_+	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	98.4	3.7e-106
WP_000095380.1|19322_19478_+	hypothetical protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
WP_012817939.1|19419_20082_+	hypothetical protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
WP_032332861.1|19979_20606_+	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	98.6	6.8e-122
WP_001354545.1|20602_21280_+	calcineurin phosphoesterase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
WP_000684845.1|21276_21978_+	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_000107690.1|22279_23542_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	1.6e-234
WP_000021754.1|23614_24121_+	hypothetical protein	NA	A0A077SK53	Escherichia_phage	99.4	1.4e-93
WP_063112853.1|24387_27504_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.3	5.8e-28
WP_001293319.1|27625_28831_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016236874.1|28827_30384_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	3.8e-105
WP_001190712.1|30566_30788_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|30787_31168_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113019.1|31172_31352_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_113418246.1|31379_32423_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.0	3.1e-204
WP_001326849.1|32511_32964_+	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
32822:32837	attL	AAAAACTCCAGAATGA	NA	NA	NA	NA
WP_000219615.1|33049_34243_+	hypothetical protein	NA	A0A077SL59	Escherichia_phage	99.5	1.8e-179
WP_000124159.1|34242_35727_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_071528000.1|35928_36288_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	2.6e-25
WP_023351533.1|36284_37400_+	DNA-binding protein Roi	NA	A0A077SLR9	Escherichia_phage	97.6	4.1e-202
WP_000611656.1|37432_38284_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874154.1|38394_38604_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
WP_052908434.1|39438_40470_+|integrase	site-specific integrase	integrase	A0A077SLE7	Escherichia_phage	99.4	8.4e-194
WP_001224236.1|40520_40832_+	hypothetical protein	NA	A0A077SK03	Escherichia_phage	99.0	2.3e-46
WP_063112855.1|41078_41639_+	Ref family protein	NA	A0A077SL37	Escherichia_phage	99.5	1.1e-99
WP_023352065.1|41828_42470_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	99.5	2.8e-115
WP_000747846.1|42509_42758_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|42754_43195_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_131419569.1|43228_49996_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.5	0.0e+00
47937:47952	attR	AAAAACTCCAGAATGA	NA	NA	NA	NA
WP_058820834.1|50071_51781_+	hypothetical protein	NA	A0A1B0V850	Salmonella_phage	99.3	0.0e+00
WP_000132937.1|51773_52793_+|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_000777466.1|52837_53056_-	hypothetical protein	NA	Q71TF4	Escherichia_phage	100.0	5.6e-31
WP_001345478.1|53084_53642_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_000068862.1|53811_54300_+	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	98.8	2.5e-87
WP_000724558.1|54533_55646_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	96.0	4.6e-198
WP_001165932.1|56388_56700_-	hypothetical protein	NA	A0A077SLG5	Escherichia_phage	100.0	1.8e-46
WP_029401679.1|56689_59677_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.3	0.0e+00
WP_029401678.1|59689_60055_-	hypothetical protein	NA	A0A077SK35	Escherichia_phage	99.2	2.3e-45
WP_063112814.1|60051_61971_-	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.6	0.0e+00
WP_029401676.1|61972_62575_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	98.0	3.0e-98
WP_000580770.1|62561_63005_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	99.3	2.9e-82
WP_000887652.1|63001_63331_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000145199.1|63405_63669_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	67.1	1.1e-22
WP_001165547.1|64104_64677_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.0	4.4e-83
WP_042004948.1|64766_65177_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	70.4	1.9e-48
WP_071852593.1|65205_65691_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.2	2.0e-41
WP_001408993.1|65731_66205_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	49.1	3.4e-33
WP_033559473.1|66233_66683_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	63.9	2.0e-46
WP_001408991.1|66711_67170_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.6	6.0e-43
WP_023156927.1|67180_67609_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	54.9	1.3e-39
WP_001408994.1|67619_68081_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.6	2.0e-54
WP_042004947.1|68091_68550_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.2	9.3e-44
WP_000367945.1|68549_69161_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	78.6	3.6e-83
WP_012478345.1|69345_70320_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_049589868.1|70515_72141_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_113426883.1|72212_72545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160599459.1|72912_74412_-|tail	tail fiber protein	tail	A0A1B0V7G4	Salmonella_phage	63.5	2.1e-07
WP_001286325.1|74423_74858_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	99.3	7.4e-75
WP_001189832.1|74936_75773_-	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	100.0	1.4e-154
WP_000047923.1|75772_77206_-	bleomycin hydrolase	NA	A0A1B0VAD6	Salmonella_phage	100.0	3.7e-272
WP_000002800.1|77202_77559_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_000440170.1|77558_80951_-	transglycosylase SLT domain-containing protein	NA	Q1MVL3	Enterobacteria_phage	96.5	0.0e+00
WP_000926345.1|81032_81914_-	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
WP_000523980.1|81928_82540_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000188919.1|82550_83117_-	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.9	3.3e-99
WP_000846124.1|83175_83445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120524.1|83713_84388_-	hypothetical protein	NA	Q71TC4	Escherichia_phage	94.0	6.8e-19
WP_071678700.1|84786_85008_+	host cell division inhibitor Icd-like protein	NA	A0A077SLM6	Escherichia_phage	98.6	8.1e-38
WP_113426881.1|85004_86048_+	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	93.4	8.3e-173
WP_001187876.1|86212_87013_+	protein kilA	NA	A0A077SL47	Escherichia_phage	100.0	1.4e-148
WP_023154394.1|87042_87888_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	99.3	3.8e-152
WP_001369095.1|87938_88184_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
WP_001313475.1|88365_88521_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_000509939.1|88637_89147_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|89158_89740_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_000041772.1|89775_90591_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	1.4e-111
WP_000085146.1|90600_92190_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	98.9	4.0e-304
WP_000067710.1|92250_93957_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_000038866.1|94182_95184_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
