The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP028229	Lactobacillus plantarum strain SRCM101222 chromosome, complete genome	3170950	492914	501538	3170950		Streptococcus_phage(66.67%)	11	NA	NA
WP_013355240.1|492914_493910_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.5	2.0e-51
WP_003640969.1|494048_494834_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_013355239.1|494837_495734_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	4.4e-82
WP_003640967.1|495832_496180_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003640966.1|496204_497224_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640965.1|497240_497570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101140.1|497566_498232_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640957.1|498629_498881_-	YaaL family protein	NA	NA	NA	NA	NA
WP_003637790.1|498895_499495_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640956.1|499510_499819_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003644909.1|499840_501538_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
>prophage 2
NZ_CP028229	Lactobacillus plantarum strain SRCM101222 chromosome, complete genome	3170950	638305	698060	3170950	tRNA,protease,bacteriocin	uncultured_Mediterranean_phage(20.0%)	55	NA	NA
WP_060684287.1|638305_639577_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.9	2.6e-96
WP_003642042.1|640043_641657_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	1.2e-143
WP_003642041.1|641829_642438_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_003642040.1|642482_642923_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003643833.1|643285_644218_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_003643832.1|644232_645585_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.9	5.2e-26
WP_015379810.1|645604_646414_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_160231069.1|646582_647569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642034.1|647651_648674_-	YdcF family protein	NA	NA	NA	NA	NA
WP_003643830.1|648962_649943_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	36.3	4.9e-42
WP_085438943.1|650308_651133_-	serine hydrolase	NA	NA	NA	NA	NA
WP_003642031.1|651368_652751_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	33.2	5.7e-28
WP_003642030.1|652819_653656_-	pur operon repressor	NA	NA	NA	NA	NA
WP_063722866.1|654148_654412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063722867.1|654426_654969_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_003642024.1|656149_656953_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003642023.1|656939_657638_-	ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	27.8	1.2e-15
WP_003642022.1|657905_658850_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003643828.1|659159_660026_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003642020.1|660158_660410_-	Veg protein	NA	NA	NA	NA	NA
WP_011101015.1|660514_661405_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_011101014.1|661401_661965_-	ribonuclease M5	NA	NA	NA	NA	NA
WP_003643825.1|661951_662728_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_160231070.1|662850_664035_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_003643823.1|664266_666318_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	35.8	2.7e-90
WP_011101012.1|666639_667029_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003642012.1|667625_668468_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_003646490.1|668467_669172_-	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_160231071.1|669193_670153_-	IpaB/EvcA family protein	NA	NA	NA	NA	NA
WP_011101011.1|670145_671420_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_011101010.1|671465_672383_-	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_003643820.1|672552_673347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101008.1|673351_674584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011101007.1|674939_675953_-|tRNA	tRNA-dihydrouridine synthase family protein	tRNA	NA	NA	NA	NA
WP_003642004.1|676065_676812_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101006.1|676961_677858_-	ROK family protein	NA	NA	NA	NA	NA
WP_003642002.1|677978_679415_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.5	9.7e-31
WP_003643816.1|679432_680788_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642000.1|681010_681433_-	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_003641999.1|681422_681611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641998.1|681617_682979_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_011101005.1|683051_683762_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101004.1|684169_685186_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003643814.1|685624_686401_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_011101002.1|686659_688969_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003646479.1|689258_689552_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	48.3	9.9e-07
WP_063722041.1|689563_689851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057136860.1|689966_690653_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_160231073.1|690746_691427_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_063721086.1|691513_692182_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_062688861.1|693026_694403_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_063721087.1|694418_696569_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_003641985.1|696835_697006_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_021356667.1|697030_697189_+|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_021356666.1|697286_698060_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP028229	Lactobacillus plantarum strain SRCM101222 chromosome, complete genome	3170950	701478	750602	3170950	protease,bacteriocin	Paramecium_bursaria_Chlorella_virus(50.0%)	49	NA	NA
WP_003641979.1|701478_701625_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641978.1|701960_702149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641977.1|702502_703249_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_160231076.1|703279_704479_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003641975.1|704596_704764_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003641974.1|704891_705092_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003641973.1|705953_706121_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnJ	bacteriocin	NA	NA	NA	NA
WP_003641972.1|706151_706325_+|bacteriocin	two-peptide bacteriocin plantaricin JK subunit PlnK	bacteriocin	NA	NA	NA	NA
WP_003641971.1|706321_706990_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_003643803.1|707014_707167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160231077.1|707385_707601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100995.1|707985_709170_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_011100994.1|709214_710591_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_003641966.1|711116_711932_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_160231078.1|712091_712964_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100993.1|713034_713826_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_003641963.1|713829_714984_+	MFS transporter	NA	NA	NA	NA	NA
WP_160231079.1|714987_715605_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_011100991.1|715931_716210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100990.1|717480_717888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160231080.1|717964_718111_-	TNT domain-containing protein	NA	NA	NA	NA	NA
WP_003641955.1|718040_718241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646454.1|718572_718728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646453.1|718953_719340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643788.1|719721_719925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100988.1|720041_720305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160231081.1|720319_720862_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016526893.1|721406_721580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011100986.1|721586_722504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074161480.1|722627_722744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639936.1|723124_723331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044428967.1|725250_728946_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_003641945.1|729532_730255_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.9	3.2e-30
WP_003643774.1|730269_732099_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_003643773.1|732113_733631_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003646444.1|734096_735428_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003641941.1|735505_736477_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_003643770.1|736477_738004_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_011100979.1|738859_740740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015379753.1|741179_742079_-	oxidoreductase	NA	NA	NA	NA	NA
WP_011100977.1|742215_743136_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_003641936.1|743301_743874_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_011100976.1|743977_744433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003646440.1|744451_744922_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_011100975.1|745031_746228_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|746880_747249_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_013355172.1|747513_749019_-	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_024002428.1|749176_749845_-	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003643762.1|750038_750602_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
>prophage 4
NZ_CP028229	Lactobacillus plantarum strain SRCM101222 chromosome, complete genome	3170950	1942103	1950617	3170950		Synechococcus_phage(33.33%)	9	NA	NA
WP_003642585.1|1942103_1942589_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
WP_011101896.1|1942572_1943703_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003642587.1|1943705_1944437_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_003642588.1|1944438_1944693_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_011101895.1|1944692_1945373_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_021356102.1|1945365_1947585_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_003642591.1|1947569_1949024_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_003642592.1|1949020_1950046_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.7	8.4e-61
WP_003642593.1|1950038_1950617_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.0	1.9e-22
>prophage 5
NZ_CP028229	Lactobacillus plantarum strain SRCM101222 chromosome, complete genome	3170950	2137352	2179789	3170950	portal,holin,integrase,terminase,tail,capsid	Lactobacillus_phage(68.75%)	57	2137113:2137133	2180024:2180044
2137113:2137133	attL	CCGTGCGGGTGATAAGTCGAC	NA	NA	NA	NA
WP_160248339.1|2137352_2138474_-|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.1	8.4e-46
WP_053566836.1|2138695_2139709_-	acyltransferase	NA	NA	NA	NA	NA
WP_160248341.1|2140126_2140918_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_011101078.1|2141404_2141581_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	53.4	1.2e-07
WP_160248343.1|2141721_2142441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160248345.1|2142544_2143408_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_160248347.1|2143461_2143893_-	ImmA/IrrE family metallo-endopeptidase	NA	O03904	Lactobacillus_phage	95.8	2.3e-76
WP_076638543.1|2143901_2144300_-	helix-turn-helix transcriptional regulator	NA	O03970	Lactobacillus_phage	62.9	2.2e-41
WP_160248349.1|2144464_2144725_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_160248351.1|2144903_2145209_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_160248354.1|2145275_2145788_+	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	8.0e-28
WP_046947675.1|2145854_2146025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046947676.1|2146157_2146271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248356.1|2146288_2146819_+	hypothetical protein	NA	E9LUU0	Lactobacillus_phage	59.2	7.9e-55
WP_160248358.1|2146830_2147805_+	hypothetical protein	NA	A6M982	Geobacillus_virus	49.6	1.8e-57
WP_160248360.1|2147884_2148793_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_003642800.1|2148789_2149077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248362.1|2149073_2149592_+	hypothetical protein	NA	O03915	Lactobacillus_phage	53.9	5.4e-40
WP_013355743.1|2149588_2149969_+	endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_160248364.1|2149961_2150129_+	hypothetical protein	NA	A0A2P0ZLB5	Lactobacillus_phage	79.6	4.4e-12
WP_160248366.1|2150131_2150386_+	hypothetical protein	NA	A0A2H4PBA1	Lactobacillus_phage	81.9	5.7e-35
WP_160248368.1|2150388_2150496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248370.1|2150507_2150891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248373.1|2150868_2151276_+	hypothetical protein	NA	A0A2K9VD97	Lactobacillus_phage	52.9	6.5e-33
WP_160248485.1|2151275_2151767_+	DUF1642 domain-containing protein	NA	A0A2K9VC51	Lactobacillus_phage	56.0	1.0e-40
WP_160248375.1|2151884_2152052_+	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	85.1	1.4e-13
WP_076633972.1|2152179_2152641_+	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	3.1e-39
WP_015380624.1|2153708_2153906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248377.1|2153883_2154081_+	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	58.0	1.0e-07
WP_060417502.1|2154247_2154913_+	hypothetical protein	NA	A0A1S5SAA7	Streptococcus_phage	53.3	1.2e-44
WP_160248379.1|2154893_2156219_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1S5SA45	Streptococcus_phage	55.7	2.9e-138
WP_160248381.1|2156221_2157817_+|portal	phage portal protein	portal	B5LPR1	Bacillus_virus	37.5	9.9e-85
WP_160248384.1|2157809_2158895_+	hypothetical protein	NA	A0A059T7W2	Listeria_phage	30.2	2.4e-37
WP_041153370.1|2158958_2159561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248386.1|2159574_2160522_+|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	60.2	1.6e-90
WP_065980404.1|2160881_2161286_+	hypothetical protein	NA	A5GYM1	Lactococcus_phage	26.7	3.4e-05
WP_065980405.1|2161286_2161676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248388.1|2161672_2162074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015380612.1|2162073_2162499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248390.1|2162516_2163134_+	hypothetical protein	NA	A0A2I7QIP9	Bacillus_phage	33.3	9.4e-07
WP_065980407.1|2163252_2163771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248392.1|2163767_2164409_+	hypothetical protein	NA	U3PFU8	Lactobacillus_phage	28.2	1.7e-06
WP_160248394.1|2164424_2170055_+|tail	phage tail tape measure protein	tail	A0A1S5SFC1	Streptococcus_phage	25.1	7.7e-23
WP_160248396.1|2170055_2170874_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_160248398.1|2170885_2172013_+	hypothetical protein	NA	O03938	Lactobacillus_phage	42.6	4.0e-72
WP_160248400.1|2172005_2172227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248402.1|2172223_2172514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160248404.1|2172514_2174323_+	hypothetical protein	NA	O03968	Lactobacillus_phage	66.5	1.7e-210
WP_160248406.1|2174338_2175124_+	hypothetical protein	NA	O03971	Lactobacillus_phage	85.4	2.2e-125
WP_160248408.1|2175123_2175444_+	DUF2977 domain-containing protein	NA	Q7M292	Lactobacillus_phage	72.6	9.1e-30
WP_160248436.1|2175440_2175587_+	XkdX family protein	NA	NA	NA	NA	NA
WP_160248486.1|2175596_2176757_+	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	37.2	5.1e-38
WP_160248438.1|2176757_2177054_+	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	75.5	4.9e-38
WP_063964066.1|2177040_2177415_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	71.8	1.5e-20
WP_160248487.1|2177558_2177891_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_063964065.1|2177991_2178639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063964064.1|2178646_2179789_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	32.2	4.0e-35
2180024:2180044	attR	CCGTGCGGGTGATAAGTCGAC	NA	NA	NA	NA
>prophage 6
NZ_CP028229	Lactobacillus plantarum strain SRCM101222 chromosome, complete genome	3170950	3012431	3025209	3170950		Lactobacillus_phage(70.0%)	11	NA	NA
WP_021356804.1|3012431_3013376_-	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	45.8	6.7e-73
WP_013355473.1|3013400_3014066_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_021356352.1|3014775_3015468_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	5.3e-35
WP_021356351.1|3015460_3016828_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.4	2.0e-25
WP_021356350.1|3017218_3017659_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	95.9	4.4e-75
WP_021356349.1|3017729_3018290_-	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	99.5	1.0e-100
WP_160231001.1|3018377_3020816_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.4	0.0e+00
WP_063723106.1|3020818_3021433_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	99.5	2.4e-111
WP_003643099.1|3021775_3022723_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_015825455.1|3022908_3023880_+	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.4	1.8e-182
WP_065080349.1|3023970_3025209_-	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	96.4	3.0e-214
>prophage 7
NZ_CP028229	Lactobacillus plantarum strain SRCM101222 chromosome, complete genome	3170950	3044352	3113012	3170950	portal,tRNA,head,holin,integrase,terminase,tail,protease,capsid	Lactobacillus_phage(84.09%)	73	3065942:3065958	3107287:3107303
WP_160248470.1|3044352_3046041_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.9	5.2e-76
WP_160231007.1|3046312_3046759_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003643130.1|3047147_3047393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643131.1|3047519_3048911_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003644260.1|3049186_3050962_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_003645241.1|3051471_3053211_-	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_075060694.1|3053432_3054410_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003643136.1|3054378_3055002_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	40.6	6.3e-27
WP_044430280.1|3055004_3056180_-	sulfate adenylyltransferase	NA	A0A2P1ELS9	Moumouvirus	31.7	3.8e-49
WP_003643138.1|3056157_3057795_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_160231008.1|3058683_3060990_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011101376.1|3061003_3062860_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_003645248.1|3062932_3063292_+	YisL family protein	NA	NA	NA	NA	NA
WP_011101375.1|3063390_3063906_-	GtrA family protein	NA	NA	NA	NA	NA
WP_003644258.1|3063960_3065031_+	membrane protein	NA	NA	NA	NA	NA
WP_003643144.1|3065063_3065183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011101374.1|3065195_3065621_+	lipoprotein	NA	NA	NA	NA	NA
3065942:3065958	attL	CTGCCTGGGGCATAATT	NA	NA	NA	NA
WP_016058344.1|3066665_3067196_-	hypothetical protein	NA	E9LUS0	Lactobacillus_phage	100.0	2.9e-41
WP_003644510.1|3067208_3067472_-|holin	holin	holin	E9LUR9	Lactobacillus_phage	100.0	2.0e-38
WP_072534410.1|3068502_3068715_-	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	83.6	3.6e-19
WP_072534409.1|3068711_3069752_-	hypothetical protein	NA	A0A2P0ZLF6	Lactobacillus_phage	96.1	1.8e-58
WP_160231012.1|3069900_3070149_-	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	95.8	1.6e-29
WP_160231013.1|3070141_3072661_-|tail	phage tail protein	tail	A0A2K9VDD0	Lactobacillus_phage	69.9	8.6e-216
WP_160231014.1|3072677_3075092_-	hypothetical protein	NA	A0A2P0ZLF8	Lactobacillus_phage	92.9	0.0e+00
WP_122036799.1|3075158_3076934_-|tail	phage tail protein	tail	A0A2P0ZLH2	Lactobacillus_phage	89.3	1.5e-299
WP_146708716.1|3077005_3081940_-	tape measure protein	NA	E9LUR1	Lactobacillus_phage	83.0	0.0e+00
WP_016058335.1|3081952_3082144_-	hypothetical protein	NA	E9LUR0	Lactobacillus_phage	100.0	1.5e-27
WP_057137284.1|3082140_3082524_-	hypothetical protein	NA	E9LUQ9	Lactobacillus_phage	99.2	1.5e-63
WP_021732001.1|3082725_3083364_-|tail	major tail protein	tail	E9LUQ8	Lactobacillus_phage	92.9	3.7e-107
WP_022638398.1|3083364_3083748_-	DUF806 family protein	NA	E9LUQ7	Lactobacillus_phage	96.9	1.0e-64
WP_021732003.1|3083744_3084185_-	hypothetical protein	NA	E9LUQ6	Lactobacillus_phage	97.9	3.2e-78
WP_021732004.1|3084174_3084537_-|head	phage head closure protein	head	E9LUQ5	Lactobacillus_phage	99.2	1.5e-65
WP_016058329.1|3084520_3084859_-|head,tail	phage gp6-like head-tail connector protein	head,tail	E9LUQ4	Lactobacillus_phage	100.0	7.0e-57
WP_114619779.1|3084931_3086164_-|capsid	phage major capsid protein	capsid	E9LUQ3	Lactobacillus_phage	87.7	1.9e-200
WP_033608392.1|3086163_3086922_-|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	94.4	1.5e-126
WP_160231015.1|3086899_3088096_-|portal	phage portal protein	portal	E9LUQ1	Lactobacillus_phage	89.7	1.5e-205
WP_033608390.1|3088098_3088293_-	DUF1056 family protein	NA	E9LUQ0	Lactobacillus_phage	92.2	2.0e-24
WP_122036924.1|3088282_3090190_-|terminase	terminase large subunit	terminase	E9LUP9	Lactobacillus_phage	49.7	9.8e-180
WP_033608389.1|3090176_3090638_-|terminase	phage terminase small subunit P27 family	terminase	A0A286QRF4	Streptococcus_phage	58.2	6.5e-45
WP_122036801.1|3090858_3091371_-	HNH endonuclease	NA	E9LUP7	Lactobacillus_phage	93.6	6.6e-83
WP_122036802.1|3091339_3091519_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	71.2	8.6e-14
WP_160248472.1|3091565_3091769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122036804.1|3091840_3092458_-	DUF4145 domain-containing protein	NA	Q20DE2	Lactobacillus_phage	49.0	7.8e-54
WP_122036805.1|3092880_3093306_-	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	79.4	7.7e-61
WP_152707026.1|3093650_3093848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160231017.1|3093920_3094301_-	hypothetical protein	NA	A0A2P0ZKS9	Lactobacillus_phage	56.9	8.8e-32
WP_076637232.1|3094541_3095033_-	methyltransferase domain-containing protein	NA	O03918	Lactobacillus_phage	89.9	1.2e-84
WP_160231018.1|3095117_3095426_-	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	93.1	6.0e-47
WP_122036806.1|3095561_3096347_-	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	90.8	3.5e-131
WP_122036807.1|3096346_3097144_-	replication protein	NA	Q9AZA0	Lactobacillus_prophage	68.9	1.3e-53
WP_063487248.1|3097193_3097886_-	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	88.7	1.5e-117
WP_063487249.1|3097905_3098211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072534386.1|3098424_3098655_-	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	78.1	1.3e-22
WP_063487251.1|3098657_3098912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063487252.1|3099001_3099331_-	DUF771 domain-containing protein	NA	E9LUT3	Lactobacillus_phage	81.7	4.4e-48
WP_072534385.1|3099423_3100143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080466786.1|3100306_3101050_-	hypothetical protein	NA	A0A1P8BM06	Lactococcus_phage	44.9	9.7e-51
WP_080382821.1|3101523_3101751_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003644552.1|3101836_3102052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641361.1|3102307_3102634_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	44.1	6.9e-17
WP_003641360.1|3102664_3103054_+	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	54.3	4.6e-36
WP_160231019.1|3103118_3103319_+	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	98.5	3.2e-25
WP_128536997.1|3103608_3103803_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	60.3	3.3e-11
WP_160248474.1|3103946_3104444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080488510.1|3104650_3105055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072534383.1|3105044_3105503_-	SocA family protein	NA	NA	NA	NA	NA
WP_072534382.1|3105578_3105920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064775478.1|3106033_3107170_+|integrase	site-specific integrase	integrase	E9LUS1	Lactobacillus_phage	99.2	4.0e-213
WP_011101373.1|3107814_3110085_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	31.5	6.7e-119
3107287:3107303	attR	CTGCCTGGGGCATAATT	NA	NA	NA	NA
WP_003643147.1|3110146_3110434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643148.1|3110548_3111061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003644254.1|3111174_3111654_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011101372.1|3112346_3113012_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP028230	Lactobacillus plantarum strain SRCM101222 plasmid unnamed1, complete sequence	53672	0	6085	53672		Enterococcus_phage(50.0%)	3	NA	NA
WP_050557824.1|1180_1783_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	53.9	1.8e-50
WP_072535832.1|2924_4697_-	adenine deaminase	NA	NA	NA	NA	NA
WP_080488660.1|4732_6085_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	32.3	6.3e-48
>prophage 2
NZ_CP028230	Lactobacillus plantarum strain SRCM101222 plasmid unnamed1, complete sequence	53672	25476	51783	53672	transposase,holin	Enterococcus_phage(45.45%)	26	NA	NA
WP_160248500.1|25476_28362_-	DEAD/DEAH box helicase	NA	Q9T1H9	Lactobacillus_phage	24.7	3.9e-23
WP_072535843.1|28348_28774_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_011031953.1|29059_29398_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_160248502.1|29355_29736_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_057717082.1|30559_31348_+	AAA family ATPase	NA	F0PIG8	Enterococcus_phage	36.9	7.9e-35
WP_072535827.1|31340_31574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072535828.1|31815_32058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123808968.1|32119_32476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072535830.1|33740_34616_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0E3XCL7	Enterococcus_phage	77.8	1.4e-24
WP_020923829.1|36477_37032_-	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	45.1	8.9e-33
WP_072540920.1|37173_37473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160248504.1|37619_38540_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	37.9	1.6e-50
WP_016378676.1|39290_39395_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_160248506.1|39627_40929_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	40.0	5.1e-79
WP_039107792.1|40921_41242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072540898.1|41234_41621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072540899.1|41738_42476_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072540900.1|42821_43793_+	Nisin resistance protein	NA	A0A2P0ZL68	Lactobacillus_phage	28.6	2.1e-13
WP_106904955.1|43851_43995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072540901.1|44264_44561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016527441.1|45343_45961_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003646148.1|46021_46972_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	55.3	5.0e-100
WP_024971945.1|46986_47913_-	ribonucleoside-diphosphate reductase	NA	A0A096XT60	Enterococcus_phage	33.7	1.3e-41
WP_033615749.1|48018_50166_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.1	9.8e-253
WP_072535998.1|50193_50646_-	ribonucleotide reductase assembly protein NrdI	NA	NA	NA	NA	NA
WP_003646115.1|51096_51783_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	49.6	9.9e-58
>prophage 1
NZ_CP028234	Lactobacillus plantarum strain SRCM101222 plasmid unnamed5, complete sequence	18589	0	1589	18589		Streptomyces_phage(100.0%)	3	NA	NA
WP_080280589.1|796_931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006844823.1|930_1254_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_015474701.1|1274_1589_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.0	2.0e-13
>prophage 2
NZ_CP028234	Lactobacillus plantarum strain SRCM101222 plasmid unnamed5, complete sequence	18589	6935	10274	18589	transposase,integrase	Bacillus_phage(66.67%)	5	3078:3091	10904:10917
3078:3091	attL	TTTTACAATCTACC	NA	NA	NA	NA
WP_160248640.1|6935_7523_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	35.4	3.7e-21
WP_160248642.1|7610_7874_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001748110.1|7867_8212_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_080241820.1|8465_8747_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.3	3.6e-06
WP_160248645.1|9104_10274_+	SH3 domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	47.6	1.5e-34
10904:10917	attR	GGTAGATTGTAAAA	NA	NA	NA	NA
>prophage 3
NZ_CP028234	Lactobacillus plantarum strain SRCM101222 plasmid unnamed5, complete sequence	18589	14780	17529	18589	integrase	Bacillus_phage(50.0%)	4	10381:10395	15448:15462
10381:10395	attL	TGTTAATGCTAATGT	NA	NA	NA	NA
WP_160248649.1|14780_15368_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	34.8	3.2e-20
WP_027822197.1|15444_15723_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
15448:15462	attR	ACATTAGCATTAACA	NA	NA	NA	NA
WP_027822196.1|15722_16079_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_050340448.1|16197_17529_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.7	3.2e-20
